A Salam

ANALISIS YURIDIS PUTUSAN BEBAS TERHADAP ANAK PELAKU TINDAK PIDANA KESUSILAAN DENGAN KORBAN ANAK (Putusan Nomor 24/Pid.Sus/A/2012/PN.Pso)

... tidak terbukti bersalah melakukan tindak pidana kesusilaan adalah tidak tepat jika dikaitkan dengan fakta yang terungkap di persidangan. Berdasarkan fakta-fakta di persidangan pemeriksaan alat bukti keterangan saksi, surat dan keterangan terdakwa telah diperoleh fakta bahwa terdakwa melakukan tindak pidana persetubuhan dengan kekerasan sebagaimana dalam ... segala keterbatasan dan kesempurnaan hanyalah milik Allah SWT. Semoga skripsi ini dapat memberikan manfaat dan berguna bagi pengembangan ilmu pengetahuan, agama, dan bangsaku. Jember, Agustus 2013 Penulis, xi RINGKASAN Kejahatan dalam kehidupan merupakan gejala sosial yang akan selalu dihadapi oleh setiap manusia, masyarakat, dan negara. Tidak ... kecuali jika disebutkan mengenai sumbernya dan belum pernah diajukan pada instansi manapun serta bukan karya tulis jiplakan. Saya bertanggung jawab atas keabsahan isinya sesuai dengan sikap ilmiah yang harus dijunjung tinggi. Demikian pernyataan ini saya buat dengan sebenar-benarnya tanpa ada tekanan dan paksaan dari pihak manapun serta bersedia menerima
 7  76  16

A DESCRIPTIVE STUDY ON THE TENTH YEAR STUDENTS’ RECOUNT TEXT WRITING ABILITY AT MAN 2 SITUBONDO IN THE 2012/2013 ACADEMIC YEAR

... Diningsih A. Md. Keb and Tari Susanti. 4. My adorable nephew, Fauzan Yahya Fadlillah. iv MOTTO Writing is a Struggle Against Silence (Carlos Fuentes) v STATEMENT OF THESIS AUTHENTICITY I certify that this thesis is an original and authentic piece of work by the author herself. All materials incorporated from secondary sources have been fully acknowledged ... English Language Education Study Program of the Language and Arts Education Department of the Faculty of Teacher Training and Education Jember University Name : Lisyulianti Identification Number : 050210491059 Level : 2005 Place, Date of Birth : Sumbawa, July 28th, 1986 Department : Language and Arts Program : English Language Education Approved By: Consultant ... category or 50.19. It was in the range score of 40-59. The average score of each indicator in grammar was 46.45 or poor category, mechanics was 51.93 or poor category, content was 62.58 or fair category, vocabulary was 50 or poor category, and organization was 49.35 or poor category. The indicator of grammar was the most difficult writing aspect for the students
 5  117  17

A DISCOURSE ANALYSIS ON “SPA: REGAIN BALANCE OF YOUR INNER AND OUTER BEAUTY” IN THE JAKARTA POST ON 4 MARCH 2011

... through a discourse analysis. The aim of this study is also to describe the application of grammatical cohesive devices and lexical cohesive devices to the article of Spa: Regain Balance of Your Inner and Outer Beauty in The Jakarta Post Newspaper and to find out whether grammatical cohesive devices and lexical cohesive devices can make the text coherent and ... A DISCOURSE ANALYSIS ON “SPA: REGAIN BALANCE OF YOUR INNER AND OUTER BEAUTY” IN THE JAKARTA POST ON 4 MARCH 2011 THESIS Written by AFIFI LAYLI SHOFA NIM 070110101012 ENGLISH DEPARTMENT FACULTY OF LETTERS JEMBER UNIVERSITY 2011 A DISCOURSE ANALYSIS ON “SPA: REGAIN BALANCE OF YOUR INNER AND OUTER BEAUTY” IN THE JAKARTA POST ON 4 MARCH 2011 THESIS A ... **) _______________________ ) http://www.brainyquote.com/quotes/authors/m/mattie stepanek.html **) http://www.brainyquote.com/quotes/authors/j/jessica savitch.html iii DECLARATION I hereby state that the thesis entitled Spa: Regain Balance of Your Inner and Outer Beauty in The Jakarta Post on 4 March 2011 is an original piece of writing. I declare that the analysis and the research
 9  108  13

Enriching students vocabulary by using word cards ( a classroom action research at second grade of marketing program class XI.2 SMK Nusantara, Ciputat South Tangerang

... Tangerang )”. Skripsi, Jurusan Pendidikan Bahasa Inggris, Fakultas Ilmu Tarbiyah dan Keguruan, Universitas Islam Negeri Syarif Hidayatullah Jakarta. Kata Kunci: pengayaan kosa kata, word card. Penelitian ini dilakukan to memperkaya kosa kata siswa dengan menggunakan word cards kelas XI.2 program pemasaran SMK Nusantara, Ciputat, Tangerang Selatan. Dalam ... melakukan wawancara, pengamatan, dan test ( pre test dan post test ). Dari penelitian ini, para siswa dapat memperkaya kosa kata mereka dengan menggunakan word card, hal itu dibuktikan dari nilai hasil pre test dan post test. Pada pre test, nilai rata-rata dari seluruh siswa adalah 54.4, hanya ada satu siswa yang lulus KKM, sementara persentase dari ... siswa yang lulus KKM adalah 3.44%, kemudian nilai tersebut naik pada post test 1, yakni pada penelitian siklus 1, nilai rata-rata dari seluruh siswa adalah 74, ada 15 siswa yang lulus KKM, dengan persentase 51.72%, nilai tersebut naik lagi pada post test 2, nilai rata-rata siswa menjadi 84, dengan siswa yang lulus KKM berjumlah 25 orang, adapun persentasenya
 11  126  101

Pembaruan pendidikan islam KH. A. Wahid Hasyim ( Menteri Agama RI 1949-1952)

... perubahan dalam pembaruan dengan dua pelaku. Pertama, perubahan masyarakat yang pelakunya adalah Allah swt. dan kedua, perubahan keadaan diri manusia yang pelakunya adalah manusia. Perubahan yang dilakukan Allah terjadi secara pasti melalui hukum-hukum masyarakat yang diterapkannya. Hukum-hukum tersebut tidak memilih atau membedakan antara satu masyarakat ... lingkungan yang dekat, sampai pada lingkungan yang luas di ruang angkasa. Dan salah satu ayat al-Qur‟an lainnya yang menyangkut pembaruan yang dilakukan dengan perubahan dan pelakunya adalah yang dirumuskan dalam firman Allah: … sesungguhnya Allah tidak mengubah keadaan suatu kaum (masyarakat) sampai mereka mengubah (terlebih dahulu) apa yang ada pada diri ... di Indonesia tidak bisa dipisahkan dari pendidikan Nasional.1 Demikian dalam kaitan pembangunan bangsa, pendidikan agama pada hakikatnya merupakan bangunan dasar dari moral bangsa. Ketentraman hidup sehari-hari di dalam masyarakat tidak hanya semata-mata ditentukan oleh ketentuan hukum semata, tetapi juga dan terutama didasarkan atas ikatan moral nilai-nilai
 8  97  117

Analysis On Students'Structure Competence In Complex Sentences : A Case Study at 2nd Year class of SMU TRIGUNA

... talks about the research design, research objective, place and time, population and sample, research instrument, and technique of data analysis; the second part is research findings which talks about data identification, data description and explanation, and data interpretation. The last chapter is conclusion and suggestion which consists of two parts: conclusion ... Fauzi 103014026988 ENGLISH EDUCATION DEPARTMENT FACULTY OF TARBIYA AND TEACHERS TRAINING SCIENCIES SYARIF HIDAYATULLAH STATE ISLAMIC UNIVERSITY JAKARTA 2008 ANALYSIS ON STUDENTS’ STRUCTURE COMPETENCE IN COMPLEX SENTENCES ( A Case Study at 2nd Year Class of SMU TRIGUNA) A Skripsi Presented to the Faculty of Tarbiya and Teachers' Training Sciences In Partial Fulfillment ... competence at a particular stage and illustrate some of the general characteristic of language acquisition. It is related to a specific interpretation of the target language which manifested as a universal phenomena. They include generalization (over-generalization and ignorance of rule restrictions), incomplete application of rules and false concept hypothesis. Jack
 8  96  53

The correlation between listening skill and pronunciation accuracy : a case study in the firt year of smk vocation higt school pupita bangsa ciputat school year 2005-2006

... EDUCATION DEPARTMENT FACULTY OF TARBIYAH AND TEACHERS TRAINING STATE ISLAMIC UNIVERSITY SYARIF HIDAYATULLAH JAKARTA 1428 H/2007 M THE CORRELATION BETWEEN LISTENING SKILL AND PRONUNCIATION ACCURACY A SKRIPSI Presented to Faculty of Tarbiyah and Teachers Training In partial fulfillment of the requirements For Sarjana Degree (S1) By: HANISTIYA EKA DAMIATI 202014001008 Approved ... penyerapan dan pengembangan ilmu pengetahuan, tekhnologi dan pembinaan hubungan dengan bangsa-bangsa lain.”2 English as the first foreign language in Indonesia and it has been taught from elementary school up to university, for many years. But now, it can be seen that there are so many private schools that have taught English in preschool age and Kindergarten. They ... learner. Because learners must interact to achieve understanding, access to speaker of the language is essential. Moreover, learners’ failure to understand the language they hear is an impetus, not an obstacle, to interaction and learning. 3. Authentic spoken language presents a challenge foe the learner to attempt to understand as native speakers actually
 8  123  37

Modul TK A EDIT Dea 150 hal dini elis revisi 07Juni16

... faktor keamanan bagi anak dan orang-orang yang terlibat dalam pembelajaran di sekolah. c) Kelengkapan sarana dan prasarana pembelajaran Stimulasi pertumbuhan dan perkembangan anak tidak dapat dilepaskan dari tersedia tidaknya sarana dan prasarana pembelajaran yang dibutuhkan. Dalam konteks ini, sarana pembelajaran yang diperlukan sesuai dengan lingkup-lingkup perkembangan ... juga mengikuti lingkup lainnya. a. Lingkup Perkembangan Nilai Agama Pada mulanya seorang anak dilahirkan ke dunia dalam keadaan belum mengenal apa-apa, termasuk mengenal agama. Anakanak terus tumbuh dan berkembang dalam durasi tertentu berdasarkan tahap-tahap pertumbuhan dan perkembangannya. Orang tua di rumah merupakan faktor utama dan pertama dalam menentukan ... Keluarga memberikan pengaruh perkembangan sosial mengidentifikasi tiga yang anak. lingkup sangat Erikson penting besar, terutama (Wolfolk, dalam pada 2009:103) perkembangan posikososial pada tahun-tahun prasekolah, yaitu kepercayaan dan ketidakpercayaan, pada masa bayi, otonomi versus rasa malu dan ragu-ragu, yang menandai pengendalian diri dan rasa percaya diri, serta inisiatif versus rasa bersalah yang menambahkan pada otonomi kualitas-kualitas seperti menjalankan, merencanakan, dan memecahkan tugas-tugas demi menjadi aktif dan
 12  272  172

Kolokial Bahasa Inggris Dalam Novel A Diary OF Wimpy Kid Karya Jeff Kinney Dan Terjemehannya Diary Bocah Tengil

 4  127  1

PENGARUH ARUS PENGELASAN TERHADAP KEKUATAN TARIK PADA PENGELASAN BIMETAL (STAINLESS STEEL A 240 Type 304 DAN CARBON STEEL A 516 Grade 70) DENGAN ELEKTRODA E 309-16

... berat sesuai grade-nya. Fungsi karbon dalam baja adalah sebagai unsur pengeras. Unsur paduan lain yang biasa ditambahkan selain karbon adalah mangan (manganese), krom (chromium), vanadium, dan nikel. Dengan memvariasikan kandungan karbon dan unsur paduan lainnya, berbagai jenis kualitas baja bisa didapatkan. Penambahan kandungan karbon pada baja dapat meningkatkan ... mengetahui berapa nilai kekuatannya dan dimanakah letak putusnya suatu sambungan las. Pembebanan tarik adalah pembebanan yang 34 diberikan pada benda dengan memberikan gaya tarik berlawanan arah pada salah satu ujung benda. Penarikan gaya terhadap beban akan mengakibatkan terjadinya perubahan bentuk (deformasi) bahan tersebut. Untuk melaksanakan pengujian ... langsung pada mesin las. Tegangan las umumnya tidak dapat diatur secara langsung pada mesin las, tetapi pengaruhnya terhadap masukan panas tetap ada. G. Daerah Pengaruh Panas (Heat Affected Zone) Pengelasan logam akan menghasilkan konfigurasi logam lasan dengan tiga daerah pengelasan yaitu pertama daerah logam induk merupakan daerah yang tidak mengalami
 8  119  86

EFEK KEMOPREVENTIF PEMBERIAN INFUSA DAUN SIRSAK (Annona muricata L.) PADA EPITEL DUKTUS JARINGAN PAYUDARA TIKUS BETINA GALUR SPRAGUE DAWLEY YANG DIINDUKSI SENYAWA 7,12-DIMETHYLBENZ[A]ANTHRACENE (DMBA)

... 2009). Aliran darah balik pembuluh vena dari payudara mengikuti aliran arteri secara berlawanan. Darah kembali menuju vena cava melalui vena aksilaris dan vena torakalis interna. Selain itu, darah juga kembali ke vena cava melalui pleksus vertebralis. Aliran balik vena pada kuadran atas lebih besar daripada aliran balik vena dari kuadran bawah (Moore, ... bervariasi mulai dari merah muda sampai coklat tua. Warna areoala ini bergantung pada umur, jumlah paritas, dan pigmentasi kulit (Djamaloedin, 2008). Payudara adalah organ yang kaya akan suplai pembuluh darah yang berasal dari arteri dan vena. Cabang dari arteri torakalis interna menembus ruang antara iga 2, 3, dan 4 untuk memperdarahi setengah dari bagian ... Kelenjar ini dinamakan sebagai kelenjar payudara dan merupakan modifikasi dari kelenjar keringat. Payudara terletak di bagian superior dari dinding dada. Pada wanita, payudara adalah organ yang berperan dalam proses laktasi, sedangkan pada pria organ ini tidak 12 berkembang dan tidak memiliki fungsi dalam proses laktasi seperti pada wanita (Van De Graaff,
 1  55  56

PENINGKATAN KUALITAS PEMBELAJARAN IPS MELALUI MODEL MAKE A MATCH DENGAN MEDIA SLIDE SUARA DI SDN BENDAN NGISOR KOTA SEMARANG

... MASALAH DAN PEMECAHAN MASALAH 1.2.1 Rumusan Masalah Berdasarkan latar belakang masalah, dapat dirumuskan permasalahan yang utama adalah: Bagaimanakah model make a match dengan media slide-suara dapat meningkatkan kualitas pembelajaran IPS pada siswakelas IVB SDN Bendan Ngisor Kota Semarang? Adapun rumusan masalah tersebut dapat diperinci sebagai berikut: a. Apakah ... sedangkan yang lain hanya mengandalkan teman. Permasalahan-permasalahan pada proses pembelajaran IPS mengakibatkan hasil belajar siswa dan kualitas pembelajaran IPS belum tercapai secara optimal. Pencapaian hasil belajar belum optimal dan belum menunjukkan ketuntasan yang ditetapkan yaitu ≥66. Pencapaian hasil belajar ditunjukkan dengan ketuntasan klasikal ... kelulusan siswa dari satuan pendidikan pada pendidikan dasar dan menengah”. Oleh karena itu, mata pelajaran IPS dinyatakan sebagai salah satu mata pelajaran inti yang perlu diberikan kepada siswa untuk menunjang tercapainya fungsi dan tujuan umum pendidikan. Pelaksanaan pembelajaran IPS secara umum adalah untuk mempersiapkan siswa menjadi warga negara yang
 6  50  307

ULANGAN HARIAN MATA PELAJARAN AQIDAH A

... berbahasa .... 13. Al Qur’an adalah mukjizat terbesar Nabi .... 14. Kitab berisi pedoman dan petunjuk agar kita selamat di ... dan akhirat 15. Kita akan hidup ... jika melaksanakan ajaran dalam kitab Allah 16. Kebutuhan ... terpenuhi dengan membaca kitab-kitab Allah 17. Kitab-kitab Allah diwahyukan kepada ... 18. Lembaran-lembaran yang dikumpulkan dan ... ULANGAN HARIAN MATA PELAJARAN AQIDAH AKHLAK 2 KELAS II BILAL BIN ROBBAH SD AISYIYAH GEMOLONG Nama : __________________ A. Isilah titik-titik di bawah ini dengan jawaban yang tepat ! 1. Menurut bahasa, iman bermakna .... 2. Iman kepada kitab-kitab Allah adalah rukun iman yang ke ... 3. Kita wajib mengimani kitab-kitab Allah yang berjumlah .... 4. Nabi ... dikumpulkan dan dibukukan disebut dengan .... 19. Al Qur’anul Karim terdiri atas ... juz 20. … ayat 44 berisi tentang Nabi Musa yang menerima kitab … dari Allah B. Jawablah pertanyaan-pertanyaan di bawah ini dengan jawaban yang benar ! 21. Apakah nama kitab Allah yang paling sempurna dan dijaga keasliannya hingga hari kiamat? Jawab : _______________________________________________________________________ 22.
 1  40  1

IMPROVING STUDENTS’ MOTIVATION IN READING COMPREHENSION BY USING MULTIPLE INTELLIGENCES STRATEGIES (A Classroom Action Research at Grade VIII G Students of SMP Negeri 1 Alian, Kebumen in the Academic Year of 2012 2013)

... Siblings : Mas Teguh and Mba Indah Mas Sahid and MbaUmi Yu Asih and Mas Khumaid Mas Arbi and Ka Ray Yu Janah and Mas Irul My Nieces : Hanna, Najma, Nissa, Ray, Icha, Sarah My Nephews : Naufal, Umar, Yassar iv ACKNOWLEDGEMENT First and foremost, I would like to express my gratitude to Allah SWT, the Almighty for the endless blessing and mercy given ... say special appreciation to my father, Tuja Hartono and my mother SitiRofingah who always support, pray, and give an advice in every step of my way. My brothers, Mas Teguh, Mas Sahid, Mas Arbi, Mas Khumeid, and Mas Irul and also My Sisters, Yu Asih, Yu Jannah, Mba Indah, MbaUmi and Ka Ray, who never give up to support any decision and give suggestion ... Hasanah 2201409067 ENGLISH DEPARTMENT FACULTY OF LANGUAGES AND ARTS SEMARANG STATE UNIVERSITY 2013 i APPROVAL This final project was approved by the Board of Examiners of the English Department of the languages and Arts Faculty of Semarang State University on July 12, 2013. Board of Examiners 1. Chairman Drs. Syahrul Syah Sinaga, M.Hum. NIP.196408041991021001 ___________________ 2.
 2  54  109

HE USE OF FIVE MINUTE ACTIVITIES TO IMPROVE STUDENTS’ ABILITY IN WRITING A DESCRIPTIVE TEXT AT THE SEVENTH GRADEJUNIOR HIGH SCHOOL

... karya ilmiah ini, baik yang langsung maupun tidak langsung, ditulis disertai dengan sumber kepustakaan sesuai dengan aturan yang lazim dipakai dalam penulisan karya ilmiah. Untuk itu, walaupun tim penguji telah membubuhkan tanda tangan sebagai tanda keabsahan, seluruh isi dalam karya ilmiah ini menjadi tanggung jawab saya dan apabila nantinya terdapat ... (An Experimental Study at the Seventh Grade Students of SMP N 6 Tegal in the Academic Year of 2010/2011) Yang saya tulis sebagai salah satu syarat untuk memperoleh gelar sarjana, adalah sepenuhnya karya saya sendiri, yang saya susun setelah menjalani proses penelitian, pembimbingan, diskusi, dan pemaparan atau ujian. Semua kutipan yang terdapat dalam ... terdapat kesalahan, saya bersedia bertanggung jawab. Demikian, harap pernyataan ini dapat digunakan seperlunya. Semarang, Yang menyatakan, Astri Nirmala Mulyadi iii MOTTO AND DEDICATION “It may be that you dislike a thing which is good for you and that you like a thing which is bad for you. Allah knows everything but you know nothing” (Al-Qur’an, 2:216) “Sometimes,
 3  45  160

Hubungan Persepsi Diri dan Komunikasi Interpersonal dengan Motivasi Berprestasi Anak Pidana Di Lembaga Pemasyarakatan Anak Pria Klas II A Tangerang

... Tesis Hubungan Persepsi Diri dan Komunikasi Interpersonal dengan Motivasi Berprestasi Anak Pidana Di Lembaga Pemasyarakatan Anak Pria Klas II A Tangerang Nama Mahasiswa Chodidjah Makarim NRP 99509 Program Studi Komunikasi Pembangunan Pertanian dan Pedesaan Menyetujui, 1. Komisi Pembimbing Prof.Dr.lr. Dedi Fardiaz,M.Sc Ketua Dr.lr.Budi Suharjo,MS f,nggota Mengetahui, 2. ... Pedesaan Menyetujui, 1. Komisi Pembimbing Prof.Dr.lr. Dedi Fardiaz,M.Sc Ketua Dr.lr.Budi Suharjo,MS f,nggota Mengetahui, 2. Ketua Program Studi Komunikasi Pembangunan Pertanian dan Pedesaan Dr.lr.Aida Vitayala S. Hubeis Tanggal Lulus : 26 Maret 2003 j[Iᄋゥイ・QHヲセi」ァ@ rarn Pascasarjana
 3  34  188

Effect of Tempeh Supplementation on Gut Microbiota and Immunoglobulin A Profiles in Sprague Dawley Rats

... Bacteria Size (bp) Temperature (°C) 126 60 495 50 126 60 GCACAAGCAGTGGAGT CTTCCTCCGTTTTGTCAA 239 50 ACTCCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG 220 60 Primer Sequence Bact934F Bact1060R g-Bfra-F GGARCATGTGGTTTAATTCGATGAT AGCTGACGACAACCATGCAG ATAGCCTTTCGAAAGRAAGAT G-Bfra-R Firm934F Firm 1060R Sg-Clep-F Sg-Clep-R CCAGTATCAACTGCAATTTTA GGAGYATGTGGTTTAATTCGAAGCA Eub338F Eub518R AGCTGACGACAACCATGCAC Quantification of Bacterial Specific-Group ... merupakan makanan fermentasi tradisional Indonesia yang terbuat dari kacang kedelai (Glycine max) dan telah menjadi makanan yang populer di dunia terutama bagi kelompok vegetarian. Tempe dihasilkan melalui proses fermentasi kacang kedelai yang melibatkan sejumlah mikroorganisme seperti cendawan, khamir, bakteri asam laktat dan juga beberapa kelompok bakteri ... Gram negatif. Selama proses fermentasi, terjadi biosintesis vitamin, senyawa fitokimia dan komponen bioaktif lainnya yang dapat berpengaruh terhadap kesehatan. Selain itu, pada tempe masih dapat ditemukan komponen oligosakarida dan polisakarida yang bernilai positif terhadap kesehatan. Mikroorganisme yang ada di dalam tempe akan turut masuk ke dalam saluran
 0  22  56

Methodologies for Maintaining and Comparing Designs in a Cooperative Design Environment

 0  25  283

Ovine Pregnancy Associated Glycoprotein (ovPAG) as a marker of pregnancy on Garut Sheep

... Setiakomara (Alm); Ibunda Suryati (Almh) dan Ayahanda Adi Siswoyo (Alm); suami Drs. Mulyo Suprapto, Akt.; anak-anak M. Luthfiadi Setiapratama dan M. Rezky Setiapraptadi, serta saudara-saudara penulis atas segala kasih sayang; pengertian; doa bantuan immateriil dan materiil sehingga dapat menyelesaikan pendidikan dengan baik. Selama melaksanakan penelitian penulis juga mendapat banyak kemudahan ... S3. Semoga amal kebaikan tersebut diterima dan diridhoi Allah SWT serta mendapat balasan dariNYA dengan kebaikan yang berlipatganda. Penulis menyadari selama berinteraksi dengan rekan-rekan terutama saat menjalankan penelitian banyak melakukan kesalahan dalam tindakan maupun komunikasi yang kurang menyenangkan maka penulis mohon maaf lahir dan batin. Semoga ... Domba Garut adalah karya saya dengan arahan dari komisi pembimbing dan belum diajukan dalam bentuk apapun kepada perguruan tinggi manapun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam Daftar Pustaka di setiap akhir bab dalam disertasi ini Bogor,
 1  49  134

Spatial patterns of greenhouse gas emission in a tropical rainforest in Indonesia

... staff at Pasir Mayang Research Site. We extend our thanks to the assistants Ms. Banzawa, Ms. Yoshizawa, Ms. Matsuoka at NIAES, and Ms. Takeuchi at FFPRI. References Ambus P. and Christensen S. 1994. Measurement of N2O emission from a fertilized grassland: An analysis of spatial variability. J. Geophys. Res. 99: 16549–16555. Bergstrom D.W., Monreal ... Hokkaido 062-8516, Japan; 2Department of Soil Science, Bogor Agricultural University (IPB), Jl. Raya Pajajaran, Bogor 16143, Indonesia; 3National Institute for Agro-Environmental Sciences, Tsukuba, Ibaraki 305-8604, Japan; 4Department of Geophysics and Meteorology, Bogor Agricultural University (IPB), Jl. Raya Pajajaran, Bogor 16143, Indonesia; *Author ... 0.18 and 0.18 mg C m–2 d–1 and the bias to replace them to zero could be considered negligible for further calculation, the trace data were replaced as zero. For the trace data of N2O flux, we used two ways for further calculation. One is the calculation of arithmetic mean and standard deviation and geostatistical analysis, in which the trace data were
 1  18  8

Development of a Process for Producing Red Tea Syrup Using Vacuum Evaporator EVAP-50 Owner Food Machinery

... hijau (green tea) rendah kalori [manuscript]. Bogor (ID): Institut Pertanian Bogor. Wirakartakusumah MA, Hermaninato D, Andarwulan N. 1989. Prinsip Teknik Pangan. Bogor (ID): Departemen Pendidikan dan Kebudayaan Direktorat Jendral Pendidikan Tinggi Pusat Antar Universitas Pangan dan Gizi. IPB. 20 APPENDICES Appendix 1 Moisture content and dry matter ... oBrix. METHOD Raw Materials and Chemical Agents Dried red tea leaves (Camellia sinensis var. assamica) were supplied by Boon Rawd Farm Co., Ltd in Chiang Rai. Refined sugar was obtained from local market. Copper (II) sulfate pentahydrate (CuSO 4· 5H 2 O), gallic acid, zinc sulfate heptahydrate (ZnSO 4· 7H 2 O), potassium sodium tartarate tetrahydrate (KNaC 4 ... (54.6%) was an indispensable item that is regularly consumed after carbonated drinks (55.7%) (Ekachampaka and Wattanamano 2007). Red tea is popular and one of the main ingredients to make popular Thai tea. Thai tea is a native-grown red-leafed tea, sometimes spiced with star anise seed is adde (depends on company), which is usually brewed strong and then
 0  11  44

Consumption of Carbonated Beverages and the Risk For Gastrointestinal Disease: A Systematic Review

... mengenai dampak karbona si pad a minuman ring an te rhadap kesehatan , terutama kcse ha18n sa lur;:m pencernaan , telah banyak beredar beserta pembahasannya , baik secara ilmiah maupu n tidal< . "':fek kc seha181l dari unsur karbonasi pad a minuman ringall sangat jarang dibahas dan dipublikasikall pada jurn al il rni ah. Melakukan systematic review status ... penapisan (screell ill g) untuk kesesuaian subjek artikel dan akses. Tahap terakhir adalah focus group discussion bersama peer/ahli dalam bidang gizi, kesehatan dan keamanan pangan. Hasil dari systematic review memperlih atl
 0  10  9

Islam and the struggle for religious pluralism in indonesia; a political reading of the religious thought of Mukti Ali

... Kegigihannya d.alam memperjuangkan semangat pluraiitas agama-agama, keterbukaamtya dalam memahami tradisi agamanya sendiri, Islam, boleh jadi akan menimb:ulkan praduga yang berlebihan bagi banyak kalangan. Tetapi, hal ゥエオ N セエゥ、。ォ@ akan memperkecil sumbangannya terhadap upaya dalam membangun sebuah 'payung' di bawah mana masyarak.at beragama Indonesia dapat ... prinsip yang mengontrol perilaku keagamaan seseorang memiliki makna sosial dan politik yang did.asarkan pada perasaan solidarit.as komunal. Tentu saja, bagi Mukti Ali, tidak semua lapisan sosial masyarak.at beragama dapar. men.erima pesan dialog semacam ini. Tapi ia percaya bahwa ada lapisan-lapisan masyarakat yang baik secara intelektu.al maupun reLigious ... yang patut diajukan: benarkah pemikiran keagamaan Mukti Ali telah mengalami penjinakan oleh Orde Baru? Dalam komeks yang lebih lt 1a. s, benarkah Mukti Ali, bersama kebijaksanaan politik-k.eagamaarmya, menjadi agen sekularisasi? Kalau diamati secara seksama perjalanan hidup Mukti Alimasa kanak-kanaknya di keluarga santri rradisional, aktif di Muhammadiyah,
 0  13  50

Error Analysis On The Students Writing Of Descriptive Text ( A Case Study at Second Grade Students of SMP PGRI 2 Ciputat).

... –Jamilah and Jamaroh-, who have given the greates love, prayer, and moral encouragement. 7. All her beloved friend at Syarif Hidayatullah State Islamic University, especially Didit Dharmawan , Anna Agus Selviana, Syarifatunnisa, Eni Nuraeni , Ari Puji Lestari , Rifadah , Yana Ida Subekti, Rinda Rizaldi Syarif, Ira Ihsanudin, Immawan Moh. Alamiri and all ... penjelasan dan diagnosis, evaluasi, dan pencegahan dan umpan balik. Data dikumpulkan melalui tes tertulis dan wawancara. Temuan penelitian ini menunjukkan frekuensi tertinggi dari kesalahan misformation (53.33%). Frekuensi terendah dari kesalahan adalah kesalahan misordering (6.67%). Di sisi lain, penyebab tertinggi kesalahan First Language (52.54%), sedangkan ... penyebab kesalahan siswa dalam menggunakan kata sifat dalam menulis teks deskriptif. Penelitian ini dikategorikan sebagai studi kasus dilakukan untuk 25 siswa dari SMP PGRI 2 Ciputat. Metode yang digunakan dalam penelitian ini adalah Deskriptif Metode Kualitatif. Penelitian ini dilakukan prosedur berikut analisis kesalahan: pengumpulan data, identifikasi,
 0  25  132

Bharali S., Deka J., Saikia P., Khan M.L., Paul A., Tripathi O.P., Singha L.B. and Uma Shankar 2012. Pinus merkusii Jungh et de Vries – a vulnerable gymnosperm needs conservation NeBIO 3 (1): 94-95.

... reforestation and afforestation of critical land and can be used as a pioneer species in a plantation for shade tolerant species (Harahap, 1995). The conservation status of Pinus merkusii has been changed to vulnerable from rare because of its over exploitation, unsustainable extraction for timber, clear felling and degradation of habitat as well as frequent ... natural habitat. However, till date no such initiatives have been undertaken to assess the population status of P. merkusii in India particularly in Arunachal Pradesh. Therefore, if proper conservation measures have not been taken this important species may vanish from this region of India in near future. Acknowledgements Financial assistance by Department ... conservation and management of this species (Siregar and Hattemar, 1999). Studies on genetic variation become a fundamental principle of the conservation ethics just as the conviction that genetic variation or diversity is an important consideration when managing forest stands, ecosystems and landscapes. The main threat to species includes decline the areas
 0  5  2

Dokumen yang terkait


Feedback