Identifikasi Alel CYP2A6*4 pada Isolat DNA perokok ras kulit hitam Papua Indonesia dengan Metode Polymerase Chain Reaction - USD Repository

Gratis

0
0
43
2 weeks ago
Preview
Full text
(1)PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI IDENTIFIKASI ALEL CYP2A6*4 PADA ISOLAT DNA PEROKOK RAS KULIT HITAM PAPUA INDONESIA DENGAN METODE POLYMERASE CHAIN REACTION SKRIPSI Diajukan untuk Memenuhi Salah Satu Syarat Memperoleh Gelar Sarjana Farmasi (S.Farm.) Progam Studi Farmasi Oleh: Elisa Gitaningtyas NIM : 158114131 FAKULTAS FARMASI UNIVERSITAS SANATA DHARMA YOGYAKARTA 2018 i

(2) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI IDENTIFIKASI ALEL CYP2A6*4 PADA ISOLAT DNA PEROKOK RAS KULIT HITAM PAPUA INDONESIA DENGAN METODE POLYMERASE CHAIN REACTION SKRIPSI Diajukan untuk Memenuhi Salah Satu Syarat Memperoleh Gelar Sarjana Farmasi (S.Farm.) Progam Studi Farmasi Oleh: Elisa Gitaningtyas NIM : 158114131 FAKULTAS FARMASI UNIVERSITAS SANATA DHARMA YOGYAKARTA 2018 i

(3) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI iii

(4) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI iv

(5) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI HALAMAN PERSEMBAHAN Skripsi ini saya persembahkan kepada Tuhan Yesus Kristus yang selalu menyertai dan memberkati setiap langkah saya dari awal penyusunan, penelitian dan momen final pada ujian. Papa, Mama, Adik, Eyang dan Mbah di Salatiga yang tak henti-henti memberi dukungan moral, doa dan materi. Tante, Om, Adik Oscar dan Nora di Jogja sudah menjadi orangtua dan rumah kedua bagi saya, terimakasih sudah menerima dan mendukung saya layaknya anak dan saudara kandung. Kepada sahabat baik yang di Jogja, Salatiga, Solo, Semarang dan dimanapun kalian berada terimakasih telah ada dalam suka duka, rollcoaster kehidupan saya yang tidak terduga. Tak lupa untuk almamater tercinta Universitas Sanata Dharma yang senantiasa memberi ilmu, hendaknya dapat berguna bagi nusa dan bangsa. v

(6) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI vi

(7) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI vii

(8) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI PRAKATA Penulis menghaturkan puji dan syukur kehadirat Tuhan Yesus, atas cinta kasih-Nya penulis dapat menyusun dan menyelesaikan penelitian skripsi yang berjudul Identifikasi alel CYP2A6*4 pada perokok ras kulit hitam papua dengan metode polymerase Chain reaction untuk memenuhi persyaratan memperoleh gelar Sarjana Farmasi ( S.Farm) Progam Studi Farmasi Fakultas Farmasi Universitas Sanata Dharma. Dalam penyusunan skripsi ini tidak lepas dari campur tangan dan bantuan dari berbagai pihak, melalui naskah prakata ini penulis hendak menghaturkan rasa terimakasih yang sebesar-besarnya kepada 1. Dr Yustina selaku Dekan Fakultas Farmasi Universitas Sanata Dharma, Yogyakarta. 2. Dr. Christine Patramurti, M.Si., Apt., selaku Ketua Progam Studi Fakultas Farmasi Universitas Sanata Dharma, serta selaku Dosen Pembimbing atas ilmu, dukungan, semangat, arahan dan kasih sayang selama proses penelitian dari awal hingga tahap akhir penyusunan naskah skripsi. 3. Damiana Sapta Candrasari, S.Si., M.Sc selaku Kepala Laboratorium Fakultas Farmasi Universitas Sanata Dharma, serta selaku Dosen Penguji yang telah memberikan ilmu, kritik dan saran sehingga penelitian ini semakin maju dan berkembang ke arah yang positif. 4. Maywan Hariono Ph.D., Apt., selaku Dosen Penguji yang telah memberikan ilmu, kritik dan saran sehingga penelitian ini semakin maju dan berkembang ke arah yang positif. 5. Setyaningsih, selaku Dosen Pembimbing Akademik atas arahan dan bimbingan dari awal saat menjadi mahasiswa baru hingga saat ini. 6. Pak kayat, Pak Parlan, Pak Bimo, dan Pak Bima selaku laboran yang membantu proses penelitian dari awal hingga akhir. 7. Segenap dosen Fakultas Farmasi Universitas Sanata Dharma yang telah berdedikasi penuh dengan semagat dan sabar dalam membimbing dan mentransfer ilmu pengetahuan. 8. Segenap staff dan karyawan Fakultas Farmasi Universitas Sanata Dharma yang ikut andil dalam menjalankan kegiatan akademik. vii

(9) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI ix

(10) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI DAFTAR ISI COVER ........................................................................................................... i HALAMAN JUDUL ........................................................................................ ii HALAMAN PERSETUJUAN PEMBIMBING ............................................... iii HALAMAN PENGESAHAN .......................................................................... iv HALAMAN PERSEMBAHAN........................................................................ v LEMBAR PERNYATAAN PERSETUJUAN PUBLIKASI ........................... vi PERNYATAAN KEASLIAN KARYA ........................................................... vii PRAKATA........................................................................................................ viii DAFTAR ISI .................................................................................................... x DAFTAR TABEL............................................................................................. xi DAFTAR GAMBAR ........................................................................................ xii DAFTAR LAMPIRAN..................................................................................... xiii ABSTRAK ........................................................................................................ xiv ABSTRACT ....................................................................................................... xv PENDAHULUAN............................................................................................. 1 METODE PENELITIAN.................................................................................. 3 HASIL DAN PEMBAHASAN......................................................................... 6 KESIMPULAN................................................................................................. 15 SARAN............................................................................................................. 15 DAFTAR PUSTAKA ....................................................................................... 15 LAMPIRAN...................................................................................................... 18 BIOGRAFI PENULIS ...................................................................................... 28 x

(11) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI DAFTAR TABEL Tabel I. Frekuensi alel CYP2A6 pada Ras Kulit Hitam Papua Indonesia...........12 Tabel II. Tingkat Ketergantungan Terhadap Nikotin Berdasarkan Skor FTND..14 xi

(12) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI DAFTAR GAMBAR Gambar 1. Hasil analisis kualitatif isolat DNA menggunakan teknik elektroforesis......................................................................................................... 7 Gambar 2. Posisi penempelan primer pada sekuen basa nukleotida CYP2A6*1..8 Gambar 3. Urutan nukleotida produk PCR gen CYP2A6*1 dan CYP2A6*4......10 Gambar 4. Elektroforegram produk PCR pada berbagai isolat DNA perokok ras kulit hitam Papua .................................................................................................11 xii

(13) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI DAFTAR LAMPIRAN Lampiran 1. Ethical Clearance Penelitian............................................................19 Lampiran 2. Go Taq Green Master Mix Certification of Analysis........................20 Lampiran 3. Usage Information of Go Taq Green Master Mix.............................21 Lampiran 4. Product Datasheet of DNA Ladder and Markers..............................22 Lampiran 5.Data Subjek......................................................................................23 Lampiran 6. Elektroforegram Analisis Kualitatif Isolat DNA..............................25 Lampiran 7. Elektroforegram Produk PCR..........................................................26 Lampiran 8. Frekuensi alel...................................................................................27 xiii

(14) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI ABSTRAK Nikotin adalah zat psikoaktif dalam rokok yang bertanggung jawab atas ketergantungan merokok tembakau pada individu. Enzim sitokrom P450 (CYP) 2A6 merupakan salah satu enzim yang banyak terdapat pada hepar, yang terutama bertanggungjawab terhadap metabolisme nikotin. Enzim sitokromP450 (CYP) 2A6 dikode oleh gen CYP2A6 yang memiliki tingkat polimorfisme yang tinggi pada populasi Asia. Polimorfisme pada CYP2A6 dapat menyebabkan perubahan aktivitas dan bentuk dari enzim CYP2A6. CYP2A6*4 (whole gene deletion) merupakan salah satu bentuk polimorfisme pada CYP2A6 yang mengalami penurunan aktivitas metabolik nikotin yang lebih rendah dibandngkan dengan individu dengan CYP2A6*1 (wildtype). Polimorfisme CYP2A6*4 banyak terdapat pada perkokok berkulit gelap. Metode yang digunakan untuk mengidentifikasi adaanya polimorfisme pada CYP2A6 ialah menggunakan PCR (Polymerase Chain Reaction) yang merupakan metode amplifikasi DNA dengan teknik menggunakan DNA polimerase. Pada penelitian ini juga menggunakan metode elektroforesis untuk menganalisis produk amplifikasi PCR dan mengetahui frekuensi varian CYP2A6*4 pada isolat DNA perokok ras kulit hitam Papua Indonesia . Kata kunci : Nikotin, CYP2A6*4, ras Papua, Metode PCR, Metode elektrofores xiv

(15) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI ABSTRACT Nicotine is a psychoactive substance in cigarettes that is responsible for the dependence of tobacco smoking on individuals. Cytochrome P450 (CYP) 2A6 enzyme is one of the many enzymes found in the liver, which is primarily responsible for nicotine metabolism. Enzyme cytochrom P450 (CYP) 2A6 is encoded by the CYP2A6 gene which has a high level of polymorphism in the Asian population. Polymorphism in CYP2A6 can cause changes in the activity and conformation of the CYP2A6 enzyme. CYP2A6 * 4 (whole gene deletion) is a form of polymorphism in CYP2A6 which has a lower decrease in nicotine metabolic activity compared to individuals with CYP2A6 * 1 (wildtype). CYP2A6 * 4 polymorphisms are common in dark-skinned smokers. The method used to identify the presence of polymorphism in CYP2A6 is to use PCR (Polymerase Chain Reaction) by amplificying using DNA polymerase techniques. In this study also used electrophoresis method to analyze PCR amplification products and determine the frequency of CYP2A6 * 4 variants in smoker DNA isolates of Indonesian Papuan black race. Keywords: Nicotine, CYP2A6 * 4, Papuan race, PCR method, electrophoresis method xv

(16) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI PENDAHULUAN Merokok menjadi salah satu masalah kesehatan yang memiliki kemampuan merusak tubuh manusia. Perhimpunan dokter spesialis kardiovaskuler menyatakan meskipun rokok sampai saat ini belum terbukti langsung mempengaruhi tekanan darah, namun kebiasaan merokok merupakan salah satu faktor risiko penyakit kardiovaskular (Perdosi, 2015). Kebiasaan merokok dapat disebabkan karena faktor lingkungan. Menurut penelitian Liem (2014) merokok dikarenakan pengaruh keluarga dan masyarakat sekitar dalam lingkungan hidup yang memiliki kebiasaan merokok. Penelitian lain yang dilakukan Minematsu et al (2006) menyatakan bahwa kebiasaan merokok tidak hanya dipengaruhi oleh faktor lingkungan namun juga faktor genetik. Asap rokok (tembakau) mengandung lebih dari 4000 bahan kimia dan 69 diantaranya merupakan senyawa karsinogenik (Tobacco Control Center Indonesia, 2010). Salah satu zat kimia yang terkandung dalam rokok adalah nikotin. Nikotin bertanggung jawab terhadap ketergantungan merokok pada individu. Konsentrasi nikotin yang rendah dalam plasma dan cairan serebrospinal dapat meningkatkan keinginan untuk merokok secara terus menerus. Kadar nikotin dalam plasma dipengaruhi oleh aktivitas proses metabolisme nikotin yang dikatalisis oleh enzim CYP2A6 (Minematsu et al, 2006). CYP2A6 merupakan salah satu enzim yang banyak terdapat pada hepar. CYP2A6 merupakan salah satu enzim utama yang bertanggung jawab terhadap metabolisme nikotin. CYP2A6 merupakan enzim yang memediasi proses metabolisme nikotin menjadi kotinin dan kemudian dioksidasi menjadi trans hidroksi kotinin (Hukkanen et al., 2005). Gen CYP2A6 menyandi enzim CYP2A6 yang menurut penelitian Hukkanen et al (2005) memiliki polimorfisme yang tinggi. Polimorfisme adalah fenomena munculnya variasi bentuk dari gen yang menghasilkan dua atau lebih varian dan masing-masing varian memiliki frekuensi yang cukup tinggi (Maggert, 2012). Polimorfisme gen CYP2A6 menjadi penyebab utama variasi aktivitas enzimatik antar individu sehingga penting untuk dilakukan karakterisasi enzimatik (Kitagawa, 2001). Penelitian Raunio dan Rahnasto-Rilla (2012) menyatakan bahwa pada saat ini terdapat 38 variasi alel dan beberapa diantarnya mengalami single nucleotide polymorphisms (SNPs), perubahan varian 1

(17) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI genetik tersebut menyebabkan perubahan aktivitas dan bentuk dari enzim CYP2A6, salah satu bentuk variannya adalah CYP2A6*4. CYP2A6*4 banyak terdapat pada populasi Asia dibandingkan pada populasi lain (Schoedel et al., 2004; Hukkanen et al., 2005). Polimorfisme CYP2A6*4 yang berupa whole gen deletion menyebabkan penurunan aktivitas enzimatik sehingga kadar nikotin dalam plasma seorang perokok yang mempunyai alel CYP2A6*4 lebih tinggi dibandingkan pada alel CYP2A6*1. Sehingga akan menurunkan risiko seorang perokok terhadap efek ketergantungan pada nikotin dibandingkan dengan perokok yang mempunyai gen CYP2A6 normal (CYP2A6*1/ wild type) (Ando et al, 2003; Ariyoshi et al., 2002; Fujieda et al., 2004; Minematsu et al., 2006; Rao et al., 2000). Penelitian lain yang dilakukan Benowitz et al (1999) menyatakan ras memiliki pengaruh yang siginifikan terhadap proses metabolisme nikotin, penelitian tesebut menyatakan bahwa metabolisme nikotin pada perokok berkulit hitam lebih rendah daripada perokok berkulit putih (Haiman et al., 2006). Hal tersebut didukung penelitian Nakajima et al (2006) yang menyatakan bahwa frekuensi polimorfisme CYP2A6*4 banyak ditemukan pada ras kulit hitam. Sehingga perokok ras kulit hitam diduga akan memiliki tingkat ketergantungan merokok yang lebih rendah karena hanya membutuhkan nikotin dalam jumlah kadar yang rendah untuk mempertahankan kadarnya dalam plasma darah. Indonesia merupakan negara yang memiliki berbagai macam ras dan suku dengan karakteristik warna kulit yang beragam. Salah satunya adalah provinsi Papua dengan masyarakat asli yang memiliki kulit cenderung gelap. Oleh karena itu, pada penelitian ini digunakan subjek uji perokok ras kulit hitam Papua untuk mengindentifikasi adanya polimorfisme pada gen CYP2A6 yaitu alel CYP2A6*4. Tujuan utama dari penelitian ini adalah mengidentifikasi adanya polimorfisme pada isolat DNA perokok ras kulit hitam Papua Indonesia yaitu berupa varian alel CYP2A6*4 dengan menggunakan metode Polymerase Chain Reaction (PCR) yang merupakan metode untuk mengamplifikasi segmen DNA dalam jumlah jutaan kali hanya dalam beberapa jam. Secara garis besar, PCR terdiri dari tiga tahapan utama yaitu denaturasi, annealing dan extension. (Somma and 2

(18) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Querci, 2000). Pada metode PCR dibutuhkan primer yang berperan untuk mengawali proses amplifikasi molekµL DNA dan gen target yang yang ingin diamplifikasi (Marchesi et al, 1998) dan juga diperlukan komponen lain seperti templat DNA, dNTPs (deoxynucleotide triphosphastes), enzim DNA polimerase, buffer PCR dan magnesium klorida yang merupakan parameter-parameter yang berkontribusi dalam proses PCR. METODE PENELITIAN Bahan Bahan yang digunakan dalam penelitian ini adalah sebanyak 30 isolat DNA perokok ras Papua yang telah di isolasi oleh Prabowo (2017). Primer forward: 5' CCT CAT CAC ACA CAA CTT CCT C 3', primer reverse: 5' CGC AGG TAC TGG GTG CTT GGT AG 3', Promega Go Taq Green Master Mix, Tris-BorateEDTA Buffer (10x), 1% gel agarose, larutan gel red (0,44 mg/mL), 100 bp DNA Ladder (Smo-BIO), DNA loading dye, etanol 96% (Sigma Chemical Co., St. Louis), aqua bidestilata steril (Ikapharmindo). Alat Alat yang digunakan dalam penelitian ini adalah Thermal cycler Perkin Elmer 2400, satu set Elektroforesis (Biorad), UV Transilluminator (Fisher Scientific), dispossable gloves, microtubes (0,2 mL), hot plate (Ika Combing-red), timbangan analitik (Metler toledo), mikropipet 1 µL dan 10 µL (Socorex Swiss), mikropipet 10 µL dan 20 µL (Socorex Swiss), erlenmeyer 250 mL (Pirex), labu takar 50 mL dan 100 mL (Iwaki pyrex), ice box, gelas beaker 200 mL (Iwaki pyrex), kamera DSLR. Penyiapan Gel Agarose Pembuatan agarose 1,5 % dilakukan dengan cara menimbang 1,5 g agarose yang kemudian dilarutkan dalam larutan TBE 1X sebanyak 100 mL. Larutan tersebut dipanaskan menggunakan hot plate dengan dilakukan pengadukan hingga terlarut dan mendidih, dan ditambahkan 1,0 µL larutan gel red dengan dilakukan pengadukan hingga homogen. Larutan sebanyak 25 mL dituang ke dalam cetakan gel yang telah diberi sisiran pada tepi gel. Setelah gel mengeras sisiran dicabut atau dilepas sehingga terbentuk sumuran. Konsentrasi agarose 1,5% digunakan untuk 3

(19) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI mengidentifikasi hasil PCR, sedangkan untuk mengidentifikasi kemurnian isolat DNA menggunakan agarose dengan konsentrasi 1%. Analisis Kemurnian Isolat DNA Penelitian ini menggunakan isolat DNA yang berasal dari subjek uji dalam penelitian yang dilakukan oleh Prabowo (2017), dengan kriteria subjek uji merupakan perokok aktif minimal selama 5 tahun, berjenis kelamin laki-laki, keturunan ras kulit hitam Papua asli minimal third degree relativies (kakek dan nenek orang Papua asli), rentang usia 20 sampai 40 tahun dan berdomisili di Yogyakarta. Subjek uji yang sedang menggunakan terapi pengobatan rutin atau sedang menjalani pengobatan untuk berhenti merokok dalam sebulan terakhir, pasien dengan penyakit yang mengharuskan beristirahat total selama ≥ 10 hari dalam sebulan terakhir, seperti heart diseases, renal failure, pulmonary diseases, pasien dengan penyakit hepar seperti hepatitis, sirosis hati, dan hepatoma tidak dapat dimasukkan dalam kriteria subjek uji yang digunakan pada penelitian. Analisis kemurnian isolat DNA dengan metode elektroforesis menggunakan gel agarose 1,0% sebagai fase diam yang telah ditambahkan dengan gel red. Gel Agarose 1,0% yang sudah keras diletakkan kedalam gel tray elektroforesis yang berisi TBE 1X hingga permukaan agarose 1,0% terendam. Analisis dilakukan dengan menyiapkan sebanyak 2,0 µL isolat DNA, 3,0 µL, aquabidest dan 1,0 µL loading dye diperoleh campuran dengan volume akhir sejumlah 6,0 µL yang kemudian dimasukkan ke dalam sumur-sumur gel agarose 1,0% menggunakan mikropipet. Kemudian dilakukan elektroforesis dengan kondisi tegangan 110 Volt dan running selama 45 menit, hasil elektroforesis dideteksi menggunakan lampu UV Trasilluminator dan didokumentasikan dengan kamera. Amplifikasi Isolat DNA dengan Metode PCR Amplifikasi fragmen DNA dari alel CYP2A6*4 dilakukan dengan menggunakan primer forward: 5' CCT CAT CAC ACA CAA CTT CCT C 3', primer reverse: 5' CGC AGG TAC TGG GTG CTT GGT AG 3'. Amplifikasi isolat DNA dengan PCR dilakukan menggunakan promega Go Taq Green Master Mix (berisi Taq DNA polimerase, dNTPs, MgCl2 , dan buffer) dengan volume akhir campuran 25,0 µL, yang terdiri dari reagen 12,50 µL, primer forward 1,250 µL, 4

(20) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI primer reverse 1,25µL, isolat DNA 5,0 µL, dan nuclease-free water 5 µL. Amplifikasi dilakukan dengan mesin PCR (Thermal cycler parkin elmer 2400). Kondisi PCR yang digunakan ialah intial denaturasi pada suhu 95°C selama 5 menit dilanjutkan dengan denaturasi pada 98°C selama 20 detik, annealing pada suhu 62,6 °C selama 15 detik dan ekstensi pada suhu 72°C selama 30 detik. Siklus amplifikasi tersebut dilakukan sebanyak 30 kali dan selanjutnya diakhiri dengan final ekstensi pada suhu 72°C selama 5 menit . Analisis Produk PCR dengan Teknik Elektroforesis Untuk melihat keberhasilan amplifikasi isolat DNA yang dilakukan dengan metode PCR, dilakukan elektroforesis menggunakan gel agarose 1,5% sebagai fase diam yang telah ditambahkan dengan gel red. Gel agarose 1,5% yang sudah mengeras diletakkan dalam gel tray elektroforesis yang berisi TBE 1X hingga permukaan agarose 1,5 % terendam. Kemudian dilakukan pencampuran produk PCR sebanyak 5 µL dan loading dye 1,0 µL dan diambil menggunakan mikropipet dengan volume akhir 6 µL yang dimasukkan kedalam sumuran agarose 1,5%. Pada salah satu sumuran pada gel tersebut diisi dengan DNA ladder 4,0 µL. Dilakukan elektroforesis dengan dengan kondisi tegangan 110 Volt dan running selama 45 menit, hasil elektroforesis dievaluasi menggunakan lampu UV Trasilluminator. Adanya alel CYP2A6*1 dan CYP2A6*4 dapat dideteksi dengan menggunakan metode elektroforesis. Produk yang terbentuk pada 350 bp menunjukkan alel CYP2A6*1, namun jika tidak terbentuk produk maka menunjukkan adanya alel CYP2A6*4. Analisis Hasil Hasil elektroforesis dengan panjang pita 350 bp menunjukkan adanya alel CYP2A6*1 dan jika hasil elektroforesis tidak terdeteksi menunjukkan adanya alel CYP2A6*4. Frekuensi alel CYP2A6*1 dan alel CYP2A6*4 dihitung dengan persamaan : 𝐹𝑟𝑒𝑘𝑢𝑒𝑛𝑠𝑖 = 𝐹𝑟𝑒𝑘𝑢𝑒𝑛𝑠𝑖 = jumlah alel CYP2A6 ∗ 1 yang diperoleh 𝑥100% jumlah seluruh alel (30) jumlah alel CYP2A6 ∗ 4 yang diperoleh jumlah seluruh alel (30) 5 𝑥100%

(21) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI HASIL DAN PEMBAHASAN Pada penelitian terdapat tiga tahapan untuk mendeskripsikan hasil dari penelitian yaitu, analisis kualitatif kemurnian isolat DNA, amplifikasi CYP2A6*4 dan analisis produk Polymerase Chain Reaction (PCR) menggunakan metode elektroforesis. Pada penelitian ini digunakan metode PCR untuk mengamplifikasi isolat DNA yang dianalisis ada tidaknya polimorfisme yang berupa varian alel CYP2A6*4 pada isolat DNA perokok ras kulit hitam Papua. CYP2A6*4 dipilih sebagai alel yang akan diidentifikasi karena pada penelitian Nakajima et al (2006) disebutkan bahwa pada perokok ras kulit hitam ditemukan frekuensi polimorfisme CYP2A6*4 yang cukup tinggi dan dapat memberikan manfaat teoritis terkait adanya variasi alel (polimorfisme) pada isolat DNA perokok ras kulit hitam Papua Indonesia. Sehingga dapat dijadikan dasar edukasi dalam mengupayakan pengurangan angka ketergantungan merokok sesuai dengan profil metabolisme pada individu. Analisis Kualitatif Isolat DNA Isolat DNA yang digunakan merupakan hasil isolasi DNA oleh Prabowo (2017). Analisis kemurnian isolat DNA dilakukan dengan teknik elektroforesis yang kemudian diamati menggunakan lampu UV transilluminator. Isolat DNA yang digunakan memiliki pita dengan panjang lebih dari 3000 bp. Pita hasil analisis seharusnya menghasilkan pita tunggal (single band) dan tebal, namun apabila pita yang dihasilkan tidak sesuai maka ada indikasi cemaran atau sudah mengalami degradasi saat proses penyimpanan (Patramurti et al., 2014). Hasil yang didapatkan menunjukkan hasil pita yang tipis dan single band hal ini menunjukkan bahwa isolat DNA yang digunakan belum mengalami degradasi/ kerusakan dan bebas dari kontaminan (Gambar 1). 6

(22) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI 7 6 5 4 3 2 1 M Gambar 1. Hasil analisis kualitatif isolat DNA menggunakan teknik elektroforesis Keterangan : M 1,3,5,6,7 2,5 Kondisi elektroforesis volume injeksi 6 µL : 100 bp + 3K bp DNA ladder sebagai marker : isolat DNA dengan pita tunggal dan tipis : isolat DNA dengan pita tunggal dan sangat tipis : Fase diam agarose 1%, fase gerak larutan TBE 1X, Analisis produk PCR dengan Teknik Elektroforesis Polimorfisme pada CYP2A6 menyebabkan variasi pada gen CYP2A6, sehingga terjadi perbedaan aktivitas dari enzim dalam memetabolisme nikotin. Terdapat tiga tipe kelompok berdasarkan aktivitas metabolismenya yaitu NM (normal metabolizer), IM (intermediate metabolizer) dan SM (slow metabolizer). CYP2A6*1 merupakan bentuk alel normal dan aktif CYP2A6, sedangkan salah satu bentuk polimorfismenya yaitu alel CYP2A6*4 yang merupakan alel yang mengalami penurunan aktivitas metabolisme hingga ≤ 50% (Audrain-McGovern J et al., 2007). Pada penelitian ini dilakukan amplifikasi fragmen DNA dari alel CYP2A6*4 dilakukan dengan menggunakan primer forward: 5' CCT CAT CAC ACA CAA CTT CCT C 3', primer reverse: 5' CGC AGG TAC TGG GTG CTT GGT AG 3'. Amplifikasi DNA dengan PCR dilakukan dengan menggunakan Promega Go Taq Green Master Mix. Volume akhir campuran PCR 25 µL dengan komponen sebagai berikut, reagen 12,5 µL, primer forward 1,25 µL, primer reverse 7

(23) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI 1,25 µL, isolat DNA 5,0 µL dan nuclease-free water 5,0 µL dan dengan kadar genomik DNA yang digunakan kurang lebih 50 ng. Pada penelitian dilakukan optimasi penentuan suhu annealing dengan hasil suhu optimal 62,1°C, sedangkan kondisi pada tahapan PCR yang lainnya adalah intial denaturasi pada suhu 95°C selama 5 menit dilanjutkan dengan denaturasi pada 98°C selama 20 detik, dan ekstensi pada suhu 72°C selama 30 detik. Siklus amplifikasi dilakukan sebanyak 30 kali dan selanjutnya diakhiri dengan final ekstensi pada suhu 72°C selama 5 menit. Terdapat tiga tahapan dalam proses PCR yang meliputi, denaturasi, annealing dan ekstensi. Pada tahap pertama DNA mengalami denaturasi pada suhu yang tinggi supaya terjadi pemisahan untai ganda menjadi untai tunggal (single strand). Tahap kedua ialah annealing, pada tahap ini terjadi penurunan suhu dan terjadi proses penempelan primer pada template DNA yang kemudian digunakan untuk membuat salinan yang identik seperti target template DNA yang diinginkan. Tahap ketiga ekstensi, pada tahapan ini terjadi pada tahap akhir penempelan primer pada DNA template target, enzim DNA polimerase memanjangkan DNA template target dan membentuk salinan untai DNA yang komplementer (Joshi et al, 2011). Pada tiga tahap tersebut, tahap annealing merupakan tahapan yang kritis pada siklus PCR. Tahap ini sangat penting karena jika primer tidak menempel pada DNA template target maka tidak terbentuk salinan DNA seperti yang diharapkan. Situs penempelan primer untuk menghasilkan produk CYP2A6*1 dengan ukuran 350 bp diilustrasikan seperti pada Gambar 2 . Primer forward 5’ CCTCATCACACACAACTTCCTC 3’ CTACCAAGCACCCA GTA CCTGCG GATGGTTCGTGGGTCATGGA CGC 3’ 5’ GAGTAGTGTGTGTTGAAGGA G Primer reverse Gambar 2. Posisi penempelan primer pada sekuen basa nukleotida CYP2A6*1 Keterangan : : arah penempelan primer forward : arah penempelan primer reverse Keberhasilan PCR ditentukan oleh spesifitas primer. Primer yang spesifik akan menempel pada DNA target, sehingga akan dihasilkan produk yang sesuai 8

(24) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI dengan target peneliti (McPherson and Moller, 2006). Pada penelitian ini dilakukan desain primer untuk mengamplifikasi CYP2A6*1. Sesuai dengan guidelilne protokol desain primer, primer yang spesifik memiliki 18-30 pasang basa nukleotida, primer dengan panjang basa nukleotida kurang dari persyaratan tersebut akan mudah terjadi hibridisasi sekunder, susunan basa nukleotida G dan C tidak dianjurkan lebih dari 4 dalam setiap susunannya. Primer yang baik hendaknya memiliki melting temperature yang optimum umumnya 52-58 °C, akan tetapi batas melting temperature pada primer adalah kurang dari 65 °C, selain itu primer diharuskan memiliki komposisi basa nukleotida GC 45-60% dari jumlah total susunan basa nukleotida. Pada primer juga ditetapkan basa nukleotida G dan C sebagai the end atau menempati posisi akhir dari primer supaya mencegah terbentuknya strand yang tidak diinginkan (Abd-Esalam, 2003). Primer yang digunakan pada penelitian ini adalah primer forward 5’ CCT CAT CAC ACA CAA CTT CCT C 3’ dan primer reverse 5' CGC AGG TAC TGG GTG CTT GGT AG. Primer tersebut kemudian akan menghasilkan produk dengan panjang sebanyak 350 bp. Variasi pada posisi urutan basa nukleotida 350 yang ditandai dengan pewarnaan warna kuning (gambar 3) menunjukkan adanya variasi alel yang kemudian menyebabkan tidak terbentuknya produk PCR yang berisikan isolat DNA dengan variasi alel CYP2A6*4. Hal tersebut terjadi karena primer yang mengamplifikasi CYP2A6*1 tidak dapat melakukan annealing pada alel CYP2A6*4 karena adanya perubahan jenis basa nukleotida G (CYP2A6*1/ wild type) menjadi basa nukleotida A (CYP2A6*4) yang ditunjukkan oleh warna kuning pada gambar 3. 9

(25) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI CYP2A6*1CCTCATCACACACAACTTCCTCCTCCCTACCAGGGCACCGAAGTGTT CYP2A6*4CCTCATCACACACAACTTCCTCCTCCCTACCAGGGCACCGAAGTGTT CYP2A6*1CTATGCTGGGCTCTGTGCTGAGAGACCCCAGTTTCTTCTCCAACCCC CYP2A6*4CTATGCTGGGCTCCGTGCTGAGAGACCCCAGCTTCTTCTCCAACCCT CYP2A6*1GGACTTCAATCCCCAGCACTTCCTGAATGAGAAGGGGCAGTTTAAGA CYP2A6*4GGACTTCAATCCCCAGCATTTCCTGGATGACAAGGGGCAGTTTAAGA CYP2A6*1AGTGATGCTTTTGTGCCCTTTTCCATCGGTAAGAGACCACTGTTTGC CYP2A6*4AGTGATGCTTTTGTGCCCTTTTCCATCGGTAAGAGACCACTGTTTGC CYP2A6*1CCAGGCCACGGCTCACACCAGCAGGGGCCTCCCTCACCCTCCTCCCC CYP2A6*4CCAGGCCACTGCTCACACCAGCAGGCGCCTCCCTCACCCACCTCCCC CYP2A6*1TCTGCGGTGTAGCCTGGTATTTCTCCAGCTTGGAAGTTCCTGTTAGA CYP2A6*4TCTGCGGTGTAGCCTGGTATTTCTCCAGCTTGGAAGTTCCTGTTAGA CYP2A6*1CTACCCTTGAGCCAGCAGCTGATACTTCCTTAACTACCAAGCACCCA CYP2A6*4CTACCCTTGAGCCAGCAGCTGATACTTCCTTAACTACCAAGCACCCA CYP2A6*1CCCAAGTGTCATGTACCTGCG CYP2A6*4CCCAAGTGTCATGTACCTGCA Gambar 3. Urutan basa nukleotida produk PCR gen CYP2A6*1 dan CYP2A6*4 Produk PCR kemudian dianalisis menggunakan teknik elektroforesis yang dievaluasi dengan menggunakan kamera. Pada penelitian ini didapatkan hasil bentuk pita tunggal dan tebal pada posisi 350 bp yang menunjukkan bahwa produk PCR tersebut merupakan isolat DNA dengan tipe alel aktif yaitu CYP2A6*1 dan juga didapatkan hasil adanya pita yang tidak terbentuk atau tidak terekspresi pada gel agarose yang menunjukkan bahwa produk PCR tersebut merupakan isolat DNA dengan alel CYP2A6*4 ( Gambar 4) 10

(26) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI M 1 2 3 4 5 6 7 Produk PCR panjang 350 bp dengan pita yang tunggal dan tebal Produk PCR yang tidak terdapat hasil ekspresi pita tunggal dan tebal. Gambar 4. Elektrogam produk PCR pada berbagai isolat DNA perokok ras kulit hitam Papua Keterangan : M : 100 bp +3 k bp DNA ladder sebagai marker 1-7 : Produk PCR dari isolat DNA perokok ras kulit hitam Papua Dengan kondisi elektroforesis menggunakan agarose 1.5% sebagai fase diam, TBE 1X sebagai fase gerak, volume injeksi 6 µL, tegangan 110 volt dan running selama 45 menit Adanya alel CYP2A6*1 dan CYP2A6*4 dapat diidentifikasi dengan menggunakan metode elektroforesis. Adanya produk yang terbentuk dengan panjang basa nukleotida 350bp menunjukkan alel CYP2A6*1, namun jika tidak terbentuk produk maka menunjukkan adanya alel CYP2A6*4. Pada gambar 4 pita yang terekspresi mengalami pola pembentukan pita yang tidak seragam dan fenomena curved DNA band (smilling effects), hal ini dapat disebabkan karena kondisi elektroforesis yang kurang tepat yaitu tingkat voltase yang terlampau tinggi, menurut Magdeldin (2012) tingkat voltase optimum pada elektroforesis adalah 5-8 V/cm. Voltase yang digunakan pada penelitian adalah 110 V dan sudah sesuai dengan ketentuan kondisi elektroforesis, sehingga fenomena ini dapat disebabkan oleh faktor lain seperti terjadinya gel shift effect yaitu peristiwa munculnya ikatan antara DNA dengan protein seperti ligase, fosfatase, dan enzim retriksi yang menghambat migrasi DNA pada gel dan juga dapat disebabkan kadar garam pada sampel yang tinggi serta adanya gelembung pada sampel pada saat dilakukan elektroforesis. Pada penelitian ini didapatkan hasil terdapat adanya 8 produk PCR 11

(27) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI yang tidak terekspresi pada saat proses analisis dengan metode elektroforesis yang dilihat dengan bantuan uv transiluminator, hal ini menunjukkan adanya 8 isolat DNA pada produk PCR mengandung variasi alel CYP2A6*4 dengan frekuensi 26,6% dan 22 produk lainnya dengan frekuensi 73,3% terbentuk pita pada 350 bp menunjukkan bahwa isolat DNA pada produk tersebut mengandung tipe alel aktif / wild type yaitu CYP2A6*1. Hal ini menunjukkan sebanyak 8 subjek uji isolat DNA perokok ras kulit hitam Papua indonesia memiliki aktivitas metabolisme yang lebih lambat dibandingkan individu lainnya yang memiliki alel CYP2A6*1 (wild type). Sehingga dapat menyebabkan potensi tingkat ketergantungan akan merokok tembakau akan lebih rendah dibandingkan individu dengan tipe alel aktif CYP2A6*1. Pada penelitian juga melakukan aktivitas penelusuran penelitian yang dilakukan oleh Prabowo (2017) untuk melihat variasi alel yang muncul pada isolat DNA perokok ras kulit hitam Papua Indonesia, pada penelitian tersebut didapatkan hasil tidak ditemukannya variasi alel CYP2A6*9 pada subjek uji. Sehingga didapatkan hasil pada perokok ras kulit hitam Papua Indonesia memiliki frekuensi variasi alel CYP2A6*9 sebesar 0% (Tabel 1.). Tabel 1. Frekuensi alel CYP2A6 pada ras kulit hitam Papua Indonesia Alel CYP2A6*1 CYP2A6*4 CYP2A6*9 Jumlah Frekuensi 22 8 0 73,3% 26,6% 0% Ketergantungan merokok dipengaruhi oleh faktor genetik dan lingkungan. Faktor genetik berupa adanya polimorfisme pada CYP2A6 berpengaruh terhadap aktivitas CYP2A6 dalam memetabolisme nikotin. Adanya polimorfisme pada CYP2A6 dengan bentuk alel non aktif seperti CYP2A6*4 dan CYP2A6*9 menyebabkan aktivitas enzimatik yang lebih rendah sehingga, pada individu dengan genotipe CYP2A6*1/*4, CYP2A6*4/*9 dan CYP2A6*1/*4/*9 masuk dalam kategori slow metabolizers ( Mwenifumbo et al., 2008 and Sceoedel et al., 2004). Individu dengan aktivitas enzimatik yang lebih rendah memiliki 12

(28) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI kadar nikotin yang terjaga dalam plasma sehingga menyebabkan penurunan potensi ketergantungan merokok dibandingkan individu dengan alel aktif normal CYP2A6*1. Pada tabel 2 menunjukkan hubungan tingkat ketergantungan terhadap nikotin berdasarkan skor FagerstrrÖm Test for Nicotine Dependence (FTND). Kuisioner FTND merupakan metode yang digunakan dalam penelitian yang dilakukan oleh Nugroho (2017) untuk menganalisis tingkat ketergantungan rokok ras kulit hitam Papua Indonesia. Berdasarkan penelitian Heatherton (1991) pengukuran efek ketergantungan rokok pada subyek uji dilakukan berdasarkan nilai FTND yang didapatkan melalui kuisioner diberikan pada subyek uji sebelum melakukan pengambilan darah. Dalam FTND terdapat penggolongan subyek berdasarkan skor yang diperoleh untuk memperlihatkan tingkat ketergantungan merokok pada subyek uji. Pada tabel tersebut menunjukkan hasil genotipe yang muncul pada isolat DNA perokok ras kulit hitam Papua Indonesia hanya CYP2A6*1/*4 dan CYP2A6*1/*1 yang kemudian dihubungan dengan perolehan skor FTND sesuai dengan penelitian yang dilakukan Nugroho (2017). Hanya dua jenis genotipe yang muncul karena pada penelitian yang dilakukan Prabowo (2017) didapatkan hasil frekuensi varian alel CYP2A6*9 sebesar 0% pada subyek uji, sehingga tingkat ketergantungan merokok subyek uji tidak dipengaruhi oleh CYP2A6*9. 13

(29) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Tabel 2. Tingkat ketergantungan terhadap nikotin berdasarkan skor FTND Skor Tingkat ketergantungan Jumlah Genotype - - 3 1 3 2 10 1 3 1 3 1 2 - CYP2A6*1/*4 CYP2A6*1/*1 CYP2A6*1/*1 CYP2A6*1/*4 CYP2A6*1/*1 CYP2A6*1/*1 CYP2A6*1/*1 CYP2A6*1/*4 CYP2A6*1/*1 CYP2A6*1/*4 CYP2A6*1/*1 - 0 1 Sangat rendah 2 3 Rendah 4 5 Sedang 6 Tinggi 7 8-10 Sangat tinggi Pada penelitian alel yang teridentifikasi adalah CYP2A6*1/*4, terdapat pada kategori tingkat ketergantungan sangat rendah pada tiga subjek uji, tingkat ketergantungan rendah pada dua subjek uji, tingkat ketergantungan sedang pada satu subjek uji dan tingat ketergantungan tinggi pada satu subjek uji. Dua kategori rendah dan sangat rendah tersebut sesuai dengan teori karena bentuk polimorfisme alel non aktif CYP2A6*4 menyebabkan turunnya aktivitas metabolisme nikotin hingga kurang dari 50% (Akrodou, 2015), sehingga individu dengan variasi CYP2A6*4 memiliki tingkat ketergantungan merokok yang lebih rendah dibandingkan dengan CYP2A6*1 (wild type), akan tetapi pada penelitian didapatkan hasil terdapat alel non aktif pada individu dengan kategori ketergantungan sedang dan tinggi hal ini kemungkinan dapat disebabkan oleh faktor lingkungan seperti kebudayaan, ekonomi, tingkat pendidikan dan gaya hidup dalam lingkungan tempat tinggal yang dapat mempengaruhi kebiasaan merokok (Akrodou ,2015). Pada penelitian Nugroho (2017) didapatkan jumlah kedua kategori ketergantungan rendah dan sangat rendah pada 23 subjek uji sedangkan pada penelitian hanya terdapat 8 subyek uji dengan jenis alel CYP2A6*4. Perbedaan antara jumlah alel non aktif yang terekspresi dan nilai tingkat ketergantungan perokok ras kulit hitam Papua Indonesa dikarenakan pada 14

(30) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI penelitian mengidentifikasi dua jenis alel non aktif, sedangkan Nakajima (2006) menyatakan ada beberapa jenis alel non aktif seperti CYP2A6 *4, *7, *9, *10, dan *19. Penelitian ini belum cukup untuk mengkorelasikan hubungan antara faktor genetik dengan ketergantungan merokok dikarenakan sedikitnya jumlah alel yang diidentifikasi. KESIMPULAN Hasil penelitian amplifkasi salah satu variasi alel CYP2A6 yaitu alel CYP2A6*4 pada isolat DNA perokok berjenis kelamin laki-laki ras kulit hitam Papua Indonesia yaitu ditemukan adanya polimorfisme yaitu terdapat 8 sampel isolat DNA yang memiliki variasi alel CYP2A6*4 dengan frekuensi 26,6%. SARAN Pada penelitian selanjutnya, peneliti menyarankan adanya peningkatan jumlah subjek uji untuk mengidentifikasi alel CYP2A6*4 serta peningkatan jumlah identifikasi polimorfisme CYP2A6 dengan tipe alel yang berbeda yang mempengaruhi proses metabolisme nikotin pada ras kulit hitam Papua Indonesia. DAFTAR PUSTAKA Abd-Elsalam. K.A. 2003. Bioinformatic tools and guideline for PCR primer design . African Journal of Biotechnology. 2 (5); 91-95. Akrodou Y.M. 2015. CYP2A6 polymorphisms may strengthen individualized treatment for nicotine dependence. Scientifica . 2015:1-7 Ando M, Hamajima N, Ariyoshi N, Kamataki T, Matsuo K, Ohno Y. 2003. Association of CYP2A6 gene deletion with cigarette smoking status in Japanese adults. J Epidemiol. 13(3):176–81. Ariyoshi N, Miyamoto M, Umetsu Y, Kunitoh H, Dosaka-Akita H, Sawamura Y-I, et al. Genetic polymorphism of CYP2A6 gene and tobacco-induced lung cancer risk in male smokers. Cancer. 2002. Epidemiol biomarkers Prev a Publ Am Assoc Cancer Res cosponsored by Am Soc Prev Oncol.11(9):890–4 Audrain-McGovern J., et al., 2007. The Role of CYP2A6 Emergence in the of Nicotine Dependence in Adolescents, PEDIATRICS, 119(1) Benowitz, N.L., Perez-Stable, E.J., Fong I., Herrera, B., Jacob ,PI., Ethnic differences in N-glucuronidation of nicotine and cotinine. J Pharmacol Exp Ther. 291(3):1196-1203. B-Rao C., 2001. Sample size consideration in genetic polymorphism studies. Human Heredity, 52:191-200. Fujieda M, Yamazaki H, Saito T, Kiyotani K, Gyamfi MA, Sakurai M, et al. 2004. Evaluation of CYP2A6 genetic polymorphisms as determinants of 15

(31) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI smoking behavior and tobacco-related lung cancer risk in male Japanese smokers. Carcinogenesis. 25(12):2451–8. Haiman, C.A., Stram, D.O., Wilkens, L. R., Pike, M.C., Kolonel, L. N., Henderson, B. E., et al,. 2006 . Ethnic and racial differences in the smoking-related risk of lung cancer. New England Journal of Medicine, 354:333-342 Handoyo, D., dan Rudiretna, A. 2001. Prinsip Umum Dan Pelaksanaan Polymerase Chain Reaction (PCR).General Principles and Implementation of Polymerase. 9(1):17–29. Heatherton, T.F., Kozlpwski, L.T., Frecker, R.C & Fagerstrom, K.O. 1991. Ther Fagerstrom Test for Nicotine Dependence: A reevision od the Fagerstrom Tolerance Questionnaire. British Journal of addictions. 86. Hukkanen, J., Jacob III, P. & Benowitz, N.L. 2005. Metabolism and Disposition Kinetics of Nicotine. The American Society for Pharmacology and Experimental Therapeutics. 57(1) Joshi M., & Deshpande J.2010. Polymerase Chain Reaction: Methods, Principles And Application. International Journal of Biomedical Research.(5). 8197 Liem, A., 2014. Pengaruh Media Massa, Keluarga, dan Teman terhadap Perilaku Merokok. Makara Hubs-Asia. 18 (1): 41-52. Magdeldin, S., 2012, Gel Electrophoresis- Principles and Basic. Croatia; InTech. 49. Maggert, K. A., 2012, Genetics: Polymorphisms, Epigenetics, and Something In Between, Genetic Research International, 1-9. McPherson, M.J., and Moller, S.G. 2006. PCR, 2 end edition, New York: Taylor & Francis, 292. Marchesi, J.R., T. Sato, A.J. Weightman, T.A. Martin, J.C. Fry, S.J. Hiom, & W.G. Wade. 1998. Design and Evaluation of Useful Bacterium Specific PCR Primer that Amplify Genes Coding for Bacterial 16S-rRNA.Applied and Environmental Microbiology. 64: 795–799. Minematsu, N., Nakamura N., Furuuchi, M., Nakajima T., Takahashi., Tateno H., and Ishuzaka, 2006. Limitation of ciggarette consumotion by , limitation of ciggarette consumotion by CYP2A6*4, *7 and *9 polymorphisms. European Respiratory Journal Nakajima, M., Fukami,T., Yamanaka,H., Higasi,E., Sakai,H., Yoshida, R., et al (2006). Comprehensive evaluation of variability in nicotine metabolism and CYP2A6 polymorphic allels in four ethnic popµLations. 277, 1010– 1015 6. Clinical pharmacology& therapeutics. 80(3):282-97 Nugroho R.T., 2017. Penagaruh Polimorfisme Gen Sitokrom P450 2A6 (CYP2A6) alel *9 Terhadap Ketergantungan Rokok pada Subyek Uji Ras Kulit Hitam Papua Indonesia. Skripsi. Fakultas Farmasi Universitas Sanata Dharma, Yogyakarta Patramurti, C., Sugiyanto, Nurrochmad, A., and Martono, S., 2014, Polymorphism of Cytochrome P450 2A6 (CYP2A6*1 adn CYP2A6*4) Among Javanese Indonesian Smoker and Non Smoker, Indonesian Journal of Pharmacy, 26(1), 11-19. 16

(32) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI POKDI Stroke Perhimpunan Dokter Spesialis Saraf Indonesia (PERDOSSI). 2011. Guideline Stroke, Bagian Ilmu Saraf RSUD FakµLtas Kedokteran UR. Prabowo D.A., 2017. Identifikasi Gen Sitokrom P450 2A6 (CYP2A6) Alel *9 pada Subjek Uji Perokok Ras Kulit Hitam Papua Indonesia. Skripsi. Fakultas Farmasi Universitas Sanata Dharma, Yogyakarta Rao Y, Homann E, Zia M, Bodin L, Zeman M, Sellers EM, et al. 2000. Duplications and defects in the CYP2A6 gene: identifi cation, genotyping, and in vivo eff ects on smoking. Mol Pharmacol.58(4):747–55 Raunio, H. and Rahnasto-Rilla, M., 2012, CYP2A6: Genetics, Structure, RegµLation, and Function, Drugs Metabolism and Drug Interactions, 27(2), 73-88. Schoedel, K A., Hofmfmann, E B., Rao, Y., Sellers, M E., Tyndale, R F., 2004, Ethnic Variation in CYP2A6 and Association of Genetically Slow Nicotine Metabolism and Smoking in AdµLt Caucasians, Lippincott Williams & Wilkins Pharmacogenetics 14 (9) :615-619 Somma, M., Querci, M., 2000, The Analysis of Food Samples for the Presence of Genetically Modified Organisms Session 6 The Polymerase Chain Reaction (PCR), JRC European Comission, Europe Yoshida R, Nakajima M, Watanabe Y, Kwon J-T, Yokoi T. 2002. Genetic polymorphisms in human CYP2A6 gene causing impaired nicotine metabolism. Br J Clin Pharmacol.54(5):511–7. 17

(33) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI LAMPIRAN 18

(34) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 1. Ethical Clearance Penelitian 19

(35) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 2. Go Taq Green Master Mix Certificate of Analysis 20

(36) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 3. Usage Information of Go Tag Green Master Mix 21

(37) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 4. Product Datasheet of DNA Ladder and Markers 22

(38) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 5. Data Subjek Tingkat Ketergantungan Rokok Skor FTND Genotip 1p 3 CYP2A6*1/*1 Rendah 2p 3 CYP2A6*1/*1 Rendah 3p 3 CYP2A6*1/*1 Rendah 4p 1 CYP2A6*1/*4 Sangat rendah 5p 6 CYP2A6*1/*1 Tinggi 6p 3 CYP2A6*1/*1 Rendah 8p 3 CYP2A6*1/*1 Rendah 9p 1 CYP2A6*1/*4 Sangat rendah 10p 4 CYP2A6*1/*4 Rendah 11p 2 CYP2A6*1/*1 Sangat rendah 12p 3 CYP2A6*1/*1 Rendah 13p 3 CYP2A6*1/*4 Rendah 14p 3 CYP2A6*1/*1 Rendah 15p 1 CYP2A6*1/*1 Sangat rendah 16p 2 CYP2A6*1/*1 Sangat rendah 17p 6 CYP2A6*1/*1 Tinggi 18p 4 CYP2A6*1/*1 Rendah 19p 5 CYP2A6*1/*1 Sedang 20p 3 CYP2A6*1/*1 Rendah 21p 3 CYP2A6*1/*4 Rendah 23p 4 CYP2A6*1/*1 Rendah 24p 3 CYP2A6*1/*1 Rendah 26p 2 CYP2A6*1/*1 Sangat rendah 27p 5 CYP2A6*1/*1 Sedang Subjek 23

(39) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI 28p 1 CYP2A6*1/*4 Sangat rendah 29p 5 CYP2A6*1/*4 Sedang 30p 5 CYP2A6*1/*1 Sedang 31p 4 CYP2A6*1/*1 Rendah 32p 3 CYP2A6*1/*1 Rendah 33p 6 CYP2A6*1/*4 Tinggi 24

(40) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 6. Elektroforegram Analisis Kualitatif Isolat DNA M 1 2 3 4 5 6 7 21 20 19 18 17 16 15 M 33 32 31 30 29 14 13 28 M 25 27 12 11 10 9 26 25 24 23 8 22 M M

(41) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 7. Elektrogram Produk PCR 7 21 6 5 4 3 2 20 19 18 17 16 29 M 30 1 M 15 M 26 14 13 28 27 12 26 11 10 9 8 25 24 23 22 33 32 31 M M M

(42) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI Lampiran 8. Frekuensi alel Frekuensi alel CYP2A6*1 = = jumlah alel CYP2A6∗1 yang diperoleh jumlah seluruh alel ( 30) 22 30 𝑥100% 𝑥100% = 73,3% Frekuensi alel CYP2A6*4 = = jumlah alel CYP2A6∗4 yang diperoleh jumlah seluruh alel ( 30) 8 30 𝑥100% = 26,6% 27 𝑥100%

(43) PLAGIAT MERUPAKAN TINDAKAN TIDAK TERPUJI BIOGRAFI PENULIS Penulis bernama lengkap Elisa Gitaningtyas, lahir di Kabupaten Semarang tanggal 28 Mei 1997, yang merupakan anak pertama dari pasangan suami istri Sigit Novianto S.E dan Setyaningsih S.E M.M,. Penulis telah menempuh pendidikan formal yaitu dari bangku pendidikan tingkat TK, Sekolah Dasar dan Sekolah Menengah Pertama di lembaga pendidikan Sekolah Kristen Satya Wacana dibawah naungan Universitas Satya Wacana Salatiga (UKSW) pada tahun 2001-2012 dan dilanjutkan pendidikan Sekolah Menengah Akhir Negeri Satu Salatiga pada tahun 2012-2015. Penulis melanjutkan pendidikan pada bangku Perguruan Tinggi di Fakultas Farmasi Universitas Sanata Dharma Yogyakarta pada tahun 2015. Selama perkuliahan penulis aktif dalam berbagai kepanitian yaitu Cara Belajar Insan Aktif (CBIA) sebagai koordinator divisi acara tahun 2016 dan ketua pada tahun 2017, panitia Pelepasan Wisuda II tahun 2016 sebagai anggota divisi dana dan keuangan (DDU), panitia Seminar Nasional sebagai anggota divisi acara pada tahun 2016 dan sebagai koordinator divisi acara pada tahun 2017, panitia Herbal Cosmetic Competition pada tahun 2017 sebagai koordinator divisi acara, panitia FACTION tahun 2017 sebagai anggota divisi sponsorship dan panitia Job Fair Farmasi tahun 2018, serta mengikuti organisasi Jaringan Mahasiswa Kesehatan Indonesia (JMKI) pada tahun 2016/2017 sebagai anggota divisi pengabdian masyarakat dan pada tahun 2017/2018 sebagai wakil komisaris. Bukan hanya aktif dalam organisasi dan kepanitiaan, penulis pada tahun 2017 merupakan anggota Progam Kreativitas Mahasiswa yang didanai oleh KEMENRISTEKDIKTI sehingga mendapatkan predikat sebagai mahasiswa berprestasi, serta pernah menajdi asisten dosen pada praktikum Biologi Sel Molekuler dan Anatomi Fisiologi Manusia. 28

(44)

Dokumen baru

Download (43 Halaman)
Gratis

Tags

Dokumen yang terkait

Perbandingan antara Metode SYBR Green dan Metode Hydrolysis Probe dalam Analisis DNA Gelatin Sapi dan DNA Gelatin Babi dengan Menggunakan Real Time Polymerase Chain Reaction (PCR)
1
62
90
Deteksi DNA Babi dan DNA Sapi dengan Menggunakan Metode Insulated Isothermal Polymerase Chain Reaction (ii-PCR)
1
8
66
Amplifikasi DNA Leptospira dengan menggunakan metode Insulated Isothermal Polymerase Chain Reaction (ii-PCR)
2
21
64
Inverse Polymerase Chain Reaction
0
13
3
Deteksi DNA Canine Parvovirus Tipe 2 (CPV-2) Isolat Lokal Menggunakan Teknik Polymerase Chain Reaction (PCR).
0
10
63
Penentuan Jenis Kelamin pada Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR)
0
10
88
Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. Pada Daging Ayam
0
11
12
Detection of Porcine DNA Residu By Polymerase Chain Reaction on Food Processing Equipments after Ritual Purification
0
3
5
Deteksi Mutasi Daerah RRDR Gen rpoB Pada Isolat DNA Sputum Pasien Multidrug Resistant Mycobacterium Tuberculosis (MDR-TB) Dengan Metode Polymerase Chain Reaction - Restriction Fragment Length Polymorphism (PCR-RFLP).
1
6
46
Usaha Amplifikasi Gen 16S rRNA Isolat Salmonella sp. Dw30 Dengan Teknik Polymerase Chain Reaction - Ubaya Repository
0
0
1
Deteksi Mycobacterium leprae dengan teknik Polymerase Chain Reaction dari Saliva Penderita Kusta
0
0
15
Deteksi Mycobacterium leprae dengan teknik Polymerase Chain Reaction dari Saliva Penderita Kusta
0
0
2
Deteksi Mycobacterium leprae dengan teknik Polymerase Chain Reaction dari Saliva Penderita Kusta
0
0
5
Deteksi Mycobacterium leprae dengan teknik Polymerase Chain Reaction dari Saliva Penderita Kusta
0
0
20
Akurasi Polymerase Chain Reaction (PCR) Dibandingkan dengan Uji Tuberkulin untuk Diagnosis Tuberkulosis pada Anak
0
0
5
Show more