Variasi DNA Kloroplas Shorea spp (Shorea acuminata Dyer, Shorea leprosula Miq dan Shorea parvifolia Dyer) Berdasarkan Penanda Mikrosatelit

Gratis

1
14
54
2 years ago
Preview
Full text
VARIASI DNA KLOROPLAS Shorea spp (Shorea acuminata Dyer, Shorea leprosula Miq dan Shorea parvifolia Dyer) BERDASARKAN PENANDA MIKROSATELIT ZULFAHMI SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2006 VARIASI DNA KLOROPLAS Shorea spp (Shorea acuminata Dyer, Shorea leprosula Miq dan Shorea parvifolia Dyer) BERDASARKAN PENANDA MIKROSATELIT ZULFAHMI Tesis Sebagai salah satu syarat untuk memperoleh gelar Magister Sains pada Program Studi Ilmu Pengetahuan Kehutanan SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2006 ABSTRACT ZULFAHMI. Chloroplast DNA Variation in Shorea spp (Shorea acuminata Dyer, Shorea leprosula Miq and Shorea parvifolia Dyer) Based on Microsatellite Marker. Under supervision of ISKANDAR ZULKARNAEN SIREGAR and ULFAH JUNIARTI SIREGAR Shorea acuminata, Shorea leprosula, and Shorea parvifolia are members of the Diptecarpaceae family. They are ecologically and commercially important in the Southeast Asia region. In this present study, we used chloroplast microsatellites (cpSSR) to study the variation within and among Shorea species populations and the distribution of chloroplast DNA haplotypes of Shorea species. Based on chloroplast microsatellite analysis, the following diagnostic haplotypes were detected; namely haplotype A, C, and D for S. leprosula, S. parvifolia, and S. acuminata, respectively. In general, haplotype variation of cpSSR was low in this studies. The highest within population variation of cpSSR was observed in S. acuminata. The highest genetic differentiation was detected in S. parvifolia (Gst = 0.58) followed by S. acuminata (Gst = 0.31) and S. leprosula (Gst = 0.14). The haplotypes distribute evenly among different populations and between islands, and do not correspond with geographical separation among populations and islands. Some haplotypes from one species were shared by other species, indicating the possibility of gene flow via interspecific hybridization, that occurred currently and/or in the past. Introgressive hybridization probably occurred among Shorea species due to co-existance in the forest stands and overlapping flowering times. Key word : Dipterocarpaceae, Shorea, Chloroplast microsattelit, Genetic variation, hybridization ABSTRAK ZULFAHMI. Variasi DNA Kloroplas Shorea spp (Shorea acuminata Dyer, Shorea leprosula Miq dan Shorea parvifolia Dyer) Berdasarkan Penanda Mikrosatelit. Di bawah Bimbingan ISKANDAR ZULKARNAEN SIREGAR dan ULFAH JUNIARTI SIREGAR Shorea acuminata, Shorea leprosula, dan Shorea parvifolia adalah anggota famili Dipterocarpaceae, yang secara ekologis dan ekonomis sangat penting di daerah Asia Tenggara. Dalam studi ini, digunakan kloroplas mikrosatelit (cpSSR) untuk mengetahui variasi genetika di dalam dan antar populasi jenis Shorea dan mengamati distribusi haplo tipe DNA kloroplas dari ketiga jenis tersebut. Hasil menunjukkan bahwa terdapat beberapa haplotipe diagnostik yang dideteksi, berturut-turut adalah haplotipe A, C, dan D untuk S. leprosula, S. parvifolia, dan S. acuminata. Variasi cpSSR di dalam populasi tertinggi diamati pada S. acuminata. Secara umum, variasi haplotype cpSSR adalah rendah dalam studi ini. Diferensiasi genetik tertinggi dideteksi pada S. parvifolia (Gst = 0.58) diikuti oleh S. acuminata (Gst = 0.31) dan S. leprosula (Gst = 0.14). Semua haplotipe menyebar merata pada populasi yang ada di setiap pulau, sehingga tidak ditemukan asosiasi antara distribusi haplotipe dengan pemisahan secara geografis. Beberapa haplotipe dari satu jenis ternyata juga ditemukan pada jenis lain, mengindikasikan kemungkinan adanya aliran gen melalui interspesifik hibridisasi yang terjadi sekarang dan/atau pada waktu lampau. Introgresif hibridisasi mungkin terjadi di antara jenis Shorea karena mereka tumbuh alami pada areal yang sama dalam hutan dan waktu pembungaan mereka yang tumpang tindih. Kata kunci: Dipterocarpaceae, Shorea, Kloroplas mikrosatelit, Variasi Genetika, hibridisasi SURAT PERNYATAAN Dengan ini saya menyatakan bahwa Tesis Variasi DNA Kloroplas Shorea spp (Shorea acuminata, Dyer, Shorea leprosula, Miq dan Shorea parvifolia, Dyer) Berdasarkan Penanda Mikrosatelit adalah karya saya sendiri di bawah Bimbingan Dr. Ir. Iskandar Zulkarnaen Siregar, M.For.Sc dan Dr. Ir. Ulfah Juniarti Siregar, M.Agr belum diajukan dalam bentuk apapun kepada perguruan tinggi mana pun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan mau pun tidak diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam daftar pustaka di bagian akhir Tesis ini. Bogor, April 2006 Zulfahmi NIM E051030211  Hak cipta milik Zulfahmi, tahun 2006 Hak cipta dilindungi Dilarang mengutip dan memperbanyak tanpa izin tertulis dari Institut Pertanian bogor, sebagian atau seluruhnya dalam Bentuk apa pun, baik cetak, fotokopi, mikrofilm dan sebagianya Judul Tesis : Variasi DNA Kloroplas Shorea spp (Shorea acuminata Dyer, Shorea leprosula Miq dan Shorea parvifolia Dyer) Berdasarkan Penanda Mikrosatelit. Nama : Zulfahmi NIM : E051030211 Disetujui Komisi Pembimbing Dr. Ir. Iskandar Z Siregar, M.For.Sc Ketua Dr. Ir. Ulfah J Siregar, M.Agr Anggota Diketahui Ketua Program Studi Ilmu Pengetahuan Kehutanan Dr. Ir. Dede Hermawan, M.Sc Tanggal Ujian : 14 Pebruari 2006 Dekan Sekolah Pascasarjana Prof. Dr. Ir. Syafrida Manuwoto, M.Sc. Tanggal Lulus: 12 April 2006 PRAKATA Puji dan syuk ur penulis panjatkan kepada Allah SWT atas segala karuniaNya sehingga karya ilmiah ini berhasil diselesaikan. Tema yang dipilih dalam penelitian adalah Variasi Genetik DNA Kloroplas dengan judul Tesis adalah Variasi DNA Kloroplas Shorea spp (Shorea acuminata, Dyer, Shorea leprosula, Miq dan Shorea parvifolia, Dyer) Berdasarkan Penanda Mikrosatelit. Terima kasih penulis ucapkan kepada: Dr. Ir. Iskandar Zulkarnaen Siregar, M. For. Sc dan Dr. Ir. Ulfah Juniarti Siregar, M. Agr selaku dosen pembimbing, Prof. Dr. Reiner Finkeldey yang telah memberi kesempatan kepada penulis untuk melakukan penelitian di Institut Genetika Hutan dan Pemuliaan Pohon Hutan Universitas Goettingen Jerman, Dr. Oliver Gailing, Dr. Ludger Leinemann, Dr. Barbara Vornam, Prof. Dr. Martin Ziehe, Dr. Elizabeth Gillet yang telah membimbing penulis selama melakukan penelitian di Universitas Goettingen Jerman. Ucapan terima kasih juga penulis sampaikan kepada DFG (Deutsche Forschungsgemeinschaft) dan AUNP (Asean-EU University Network Programme) melalui proyek Genetic Variation of Shorea spp in Indonesian dan Conservation and Sustainable Utilization of Plant Genetic Resources in SE-Asia yang telah mendanai penelitian serta kepada Pemerintah Provinsi Riau atas Beasiswa yang diberikan penulis dala m menempuh pendidikan Magister di IPBBogor. Ungkapan terima kasih juga disampaikan kepada Ayah, Ibu, Paman, abang, dan adik-adikku tercinta serta seluruh keluarga atas segala doa, kasih sayang dan pengorbanan serta istri tercinta (Rosmaina, S.P) atas semangat dan pengertian yang diberikan. Penulis juga mengucapkan terima kasih kepada Yanti Rachmayanti dan Ms. Olga Artes yang telah membantu pelaksanaan penelitian. Akhirnya penulis mengucapkan semoga karya ilmiah ini bermanfaat. Bogor, April 2006 Zulfahmi RIWAYAT HIDUP Penulis dilahirkan di Pulau Tengah, Kampar-Riau pada tanggal 11 Nopember 1979 sebagai anak kedua dari pasangan Mahyudin dan Nurbayanis. Pada tahun 1998 penulis lulus dari Sekolah Menengah Atas Negeri 02 AirtirisKampar jurusan Ilmu Pengetahuan Alam dan pada tahun yang sama diterima di Institut Pertanian Bogor melalui Jalur Undangan Seleksi Masuk IPB (USMI). Penulis memilih Program Studi Teknologi Hasil Hutan, Fakultas Kehutanan dan lulus pada tahun 2002. Pada tahun 2003, penulis diterima di Program Magister (S2) Pascasarjana IPB pada Program Studi Ilmu Pengetahuan Kehutanan dengan Beasiswa dari Pemerintah Provinsi Riau dan lulus pada tahun 2006. DAFTAR ISI Halaman DAFTAR TABEL................................................................................................. ii DAFTAR GAMBAR ............................................................................................ iii PENDAHULUAN ................................................................................................. 1 Latar Belakang .......................................................................................... Tujuan Penelitian....................................................................................... Hipotesis ................................................................................................... Manfaat Penelitian..................................................................................... 1 3 3 3 TINJAUAN PUSTAKA........................................................................................ 4 Shorea acuminata Dyer, S. leprosula Miq, dan S. parvifolia Dyer ......... 4 Karakteristik DNA kloroplas dan Penggunaannya ................................... 6 Penanda Mikrosatelit ................................................................................ 7 Penelitian Tentang Variasi Genetika Jenis Shorea spp .............................11 BAHAN DAN METODE ....................................................................................13 Tempat dan Waktu Penelitian...................................................................13 Alat dan Bahan Penelitian.........................................................................13 Metode Penelitian......................................................................................13 Koleksi Sampel .............................................................................13 Ekstraksi DNA dan PCR-cpSSR (Kloroplas Mikrosatelit)..........15 Genescan dan Genotyping Hasil PCR...........................................16 Analisis Data .............................................................................................17 HASIL DAN PEMBAHASAN .............................................................................19 Haplotipe cpSSR.......................................................................................19 Variasi Haplotipe.......................................................................................21 Variasi Genetik di Dalam dan Antar Populasi ..........................................23 Pembagian Haplotipe Antar Jenis .............................................................29 Implikasi Terhadap Konservasi Genetika Shorea spp di Indonesia..........33 SIMPULAN ..........................................................................................................34 DAFTAR PUSTAKA ...........................................................................................35 DAFTAR TABEL i Halaman 1 Nilai keragaman genetik beberapa jenis Shorea menggunakan penanda isozim, RAPD, mikrosatelit dan AFLP .............................................................12 2 Koleksi sampel berdasarkan populasi dan jumlah individu per populasi .........15 3 Sekuen DNA pasangan primer yang digunakan untuk amplifikasi cpSSR ......17 4 Definisi haplo tipe dan ukuran fragmen cpSSR.................................................20 5 Perbedaan S. acuminata, S. leprosula dan S. parvifolia berdasarkan tipe mutasi ................................................................................................................21 6 Frekuensi haplotipe S. acuiminata, S. leprosula dan S. parvifolia pada setiap populasi .............................................................................................................22 7 Nilai keragaman genetika di dalam dan antar populasi pada S. acuminata, S. leprosula dan S. parvifolia ............................................................................23 8 Analisis keragaman molekuler (AMOVA) .......................................................24 DAFTAR GAMBAR ii Halaman 1 Distribusi Dipterocarpaceae di Indonesia. Jumlah total jenis dalam setiap pulau menurut Ashton (1982). ....................................................................... 4 2 Diagram model slippage strand mispairing (SSM) pada mutasi mikrosatelit (Eisen 1999) ............................................................................... 9 3 Bagan alur penelitian ......................................................................................14 4 Lokasi pengambilan sampel di lapangan ........................................................14 5 Lima primer yang berhasil diamplifikasi dengan PCR ...................................19 6 Hasil Genescan primer ccmp3 dan ccmp6 yang menunjukkan pola polimorfisme ...................................................................................................20 7 Distribusi geografis dan frekuensi haplotipe Shorea spp (S. acuminata, S. leprosula dan S. parvifolia) .........................................................................26 8 Dendogram UPGMA S. acuminata, S. leprosula dan S. parvifolia berdasarkan jarak genetik a Nei (1972)............................................................28 9 Dendogram UPGMA S. acuminata, S. leprosula dan S. parvifolia berdasarkan jarak genetika Gregorious dan Roberds (1986) ..........................28 10 Waktu pembungaan pada beberapa jenis Shorea seksi Mutica famili Dipterocarpaceae di semenanjung Malaysia (Ashton 1988)...........................31 11 Mekanisme penangkapan kloroplas (chloroplast capture) pada Eucalyptus spp (Jackson et al. 1999) ..............................................................32 DAFTAR LAMPIRAN iii Halaman 1 Hasil Genescan S. acuminata, S. leprosula dan S. parvifolia menggunakan dua primer yaitu ccmp3 dan ccmp6...................................................................42 iv PENDAHULUAN Latar Belakang Indonesia adalah salah satu negara dengan keanekaragaman jenis dipterokarp yang tinggi. Di sisi lain, laju deforestrasi hutan alam Indonesia adalah tinggi, diperkirakan mencapai 2.6 sampai 2.8 juta hektar per tahun (Kompas 2005), sehingga merupakan ancaman serius terhadap keberadaan jenis dipterokarp. Daerah-daerah di Sumatra dan Kalimantan yang di dominasi oleh jenis dipterokarp telah banyak mengalami kerusakan akibat penebangan illegal, kebakaran hutan, konversi lahan hutan menjadi lahan perkebunan, dan lain- lain sehingga perlu mendapat perhatian dan penanganan yang serius. Penebangan hutan memberikan dampak negatif terhadap struktur genetik pohon hutan. Murawski et al. (1996) telah melaporkan adanya peningkatan derajat selfing pada Shorea megistophylla setelah dilakukan penebangan pada hutan dipterokarp di Sri Lanka, sedangkan Obayashi et al. (2002) melaporkan bahwa terjadinya penurunan rata-rata outcrossing pada Shorea curtisii pada hutan bekas tebangan di Semananjung Malaysia. Dalam studi ini, tiga jenis Shorea yaitu Shorea leprosula, Shorea parvifolia dan Shorea acuminata akan diteliti. Ketiga jenis Shorea tersebut dipilih karena beberapa alasan, pertama ketiga jenis tersebut termasuk ke dalam kelompok meranti merah yang bernilai ekonomis tinggi dan penting secara ekologis. Kedua, mereka menyebar luas di Indonesia, yaitu di Sumatra dan Kalimantan. Ketiga, S. leprosula dan S. parvifolia merupakan jenis dipterokarp yang cepat pertumbuhannya dibandingkan dengan jenis dipterokarp lainnya. Ratarata riap diameter per tahun S. leprosula dan S. parvifolia masing- masing adalah 2.10 cm dan 1.87 cm (Suparna & Purnomo 2004) dan tinggi pohon S. leprosula dan S. parvifolia pada umur dua tahun berturut-turut adalah 4.64 m dan 4.58 m (Soekotjo & Wardhana 2005), sehingga jenis ini dapat dikembangkan untuk pembangunan hutan tanaman meranti di Sumatra dan Kalimantan. Keempat struktur genetika populasi Shorea spp di Indonesia belum banyak diteliti. Sampai saat ini informasi keragaman genetika Shorea spp masih sangat terbatas, antara lain telah diteliti oleh Sudarmonowati et al. (1998) menggunakan penanda isoenzim, Rimbawanto & Isoda (2000) dengan penanda mikrosatelit, dan Indrioko (2005) dengan penanda PCR-RFLP dan mikrosatelit sehingga masih diperlukan lagi penelitian yang lebih banyak, untuk mendapatkan informasi keragaman genetika yang lebih detail. Penggunaan metode penanda genetika dalam bidang kehutanan di Indonesia umumnya masih diarahkan untuk mendukung kegiatan konservasi sumber daya genetika dan pemuliaan pohon dari jenis-jenis unggulan, sedangkan untuk tujuan lain seperti melacak asal-usul kayu belum pernah dilakukan. Di era ekolabel, kayu yang berasal dari hutan yang dikelola secara lestari (sustainable forest management, SFM) merupakan produk yang sangat diinginkan oleh konsumen. Sertifikasi lacak balak (chain of custody) merupakan salah satu kegiatan utama sertifikasi ekolabel untuk memantau aliran kayu dari hutan ke tempat penimbunan sampai ke konsumen akhir. Sertifikasi lacak balak menuntut metode monitoring aliran kayu yang dapat diandalkan, sehingga kasus-kasus yang meragukan dapat dipecahkan. Penggunaan penanda molekuler seperti DNA merupakan salah satu metode yang dapat dikembangkan dan diterapkan di masa datang untuk sertifikasi lacak balak atau tujuan lain. Salah satu tujuan konservasi sumber daya genetika adalah mencegah kepunahan suatu jenis. Untuk menyusun strategi konservasi sumber daya genetika diperlukan informasi tentang sejarah kehidupan (evolusi) tanaman dan pengetahuan tentang genetika populasi yang mengukur tingkat variabilitas genetika pada tingkat jenis dan populasi. Oleh karena itu, perlu diketahui variabilitas DNA kloroplas, mitokondria dan nuklear tanaman tersebut. Analisis polimorfisme genom yang diturunkan secara uniparental mungkin sangat berguna untuk mengumpulkan informasi tentang sejarah evolusi jenis dan populasi. Dalam studi ini, DNA kloroplas dianalisis dengan menggunakan penanda mikrosatelit. DNA kloroplas dipilih sebagai penanda karena diturunkan secara uniparental (umumnya secara maternal pada kebanyakan Angiosperm), tidak mengalami rekombinasi, ukuran genomnya yang kecil dan strukturnya memiliki banyak informasi tentang evolusi (Birky 1995; Provan et al. 2001). Sedangkan alasan menggunakan penanda mikrosatelit disebabkan oleh penanda ini memiliki variabilitas yang tinggi dalam mendeteksi polimorfisme pada DNA kloroplas 2 dibandingkan dengan penanda lainnya seperti isoenzim, RAPD dan RFLP (Powell et al. 1995a; 1995b). Tujuan Penelitian Penelitian ini bertujuan untuk : 1. Mengetahui distribusi haplotipe DNA kloroplas S. acuminata, S. leprosula dan S. parvifolia 2. Menduga keragaman genetika DNA kloroplas di dalam dan antar populasi pada S. acuminata, S. leprosula dan S. parvifolia. Hipotesis Hipotesis yang diuj i dalam penelitian ini adalah: 1. Masing- masing jenis Shorea memiliki haplotipe spesifik sebagai pembeda antar jenis. 2. Variasi DNA kloroplas pada S. acuminata, S. leprosula dan S. parvifolia adalah rendah. 3. Adanya perbedaan DNA kloroplas yang spesifik antar populasi pada S. acuminata, S. leprosula dan S. parvifolia. Manfaat Penelitian Inventarisasi keragaman genetika pohon Shorea diperlukan sebagai informasi dasar untuk kegiatan konservasi sumber daya genetika, dan kegiatan perbaikan genetika pohon Shorea di masa datang. Di samping itu, data penelitian ini mungkin dapat digunakan sebagai penanda diagnostik DNA molekuler jenis Shorea yang diteliti untuk menunjang kegiatan sertifikasi produk hutan lestari. 3 TINJAUAN PUSTAKA Shorea acuminata Dyer, S. leprosula Miq, dan S. parvifolia Dyer Famili Dipterocarpaceae merupakan salah satu famili yang bernilai ekonomis tinggi dan penting secara ekologis di Asia Tenggara. Distribusi alami dipterokarp di Indonesia me nurut Ashton (1982) seperti terlihat pada Gambar 1. Di Kalimantan (termasuk Malaysia dan Brunai Darussalam) ditemukan sembilan genus (Anisoptera, Cotylelobium, Dipterocarpus, Dryobalanops, Hopea, Parashorea, Shorea, Vatica, dan Upuna) yang terdiri atas 267 jenis, Sumatra dengan delapan genus (Anisoptera, Cotylelobium, Dipterocarpus, Dryobalanops, Hopea, Parashorea, Shorea, dan Vatica) terdiri atas 106 jenis, Jawa dan Nusa Tenggara dengan lima genus (Shorea, Hopea, Dipterocarpus, Anisoptera, dan Vatica) terdiri atas 10 jenis, Sulawesi dengan empat genus (Shorea, Hopea, Anisoptera, dan Vatica) terdiri atas 7 jenis, Maluku dengan empat genus (Shorea, Hopea, Anisoptera, dan Vatica) terdiri atas 6 jenis dan Irian (termasuk Papua New Guinea) dengan tiga genus (Hopea, Anisoptera, and Vatica) terdiri atas 15 jenis. 267 106 7 6 15 10 3 Skala 1: 1.000.000 Gambar 1 Distribusi Dipterocarpaceae di Indonesia. Jumlah total jenis dalam setiap pulau menurut Ashton (1982). Berdasarkan sifat kayunya, Alrasjid et al. (1991) dan Newman et al. (1999) mengelompokkan meranti ke dalam empat kelompok, yaitu meranti merah, meranti putih, meranti kuning dan meranti balau. Kayu meranti termasuk ke dalam jenis kayu daun lebar yang ringan, tingkat keawetan yang rendah, dan sifat pengerjaannya relatif yang mudah. Kayu meranti banyak dipergunakan sebagai kayu pertukangan, kayu lapis, papan pertikel, peti pengepak, meubel, alat musik, bahan bangunan rumah dan perkapalan (Newman et al. 1999; Alrasjid et al. 1991) Shorea adalah pohon dengan ketinggian mencapai 60 m dan diameter batang bisa mencapai 180 cm. Menurut Alrasjid et al. (1991), pohon ini umumnya menduduki lapisan tajuk teratas (stratum A) tetapi ada pula yang menduduki lapisan tajuk stratum B. Sebagian besar jenis Shorea tergolong jenis toleran dan semi toleran, sangat sedikit diantara mereka yang tergolong jenis intoleran. Pohon Shorea tumbuh di tanah latosol, podsolik merah kuning dan podsolik kuning dengan tipe iklim A dan B, curah hujan diatas 2000 mm per tahun, basah dan kelembaban tinggi serta pada ketinggian mencapai 1750 m dari permukaan laut (Ashton 1982). Alrasjid et al. (1991) menyatakan bahwa species Shorea memiliki malai bunga yang tumbuh pada ujung ranting atau ketiak daun, tiap daun memiliki dua helai daun penumpu, lima belas atau lebih benang sari dengan bakal buah bersel tiga masing- masing berisi dua bakal biji. Buah Shorea berbentuk bulat telur sampai hampir bulat, berukuran beberapa milimeter dengan panjang mencapai 6 cm dan berbiji satu. Shorea mulai berbunga pada umur enam tahun atau lebih, musim berbuah sekitar bulan Oktober sampai April tergantung pada keadaan cuaca yang memerlukan musim panas tertentu sehingga kebanyakan dari jenis ini tidak berbuah setiap tahun. Shorea acuminata, S. leprosula dan S. parvifolia adalah anggota dari genus Shorea seksi Mutica dalam famili Dipterocarpaceae. Di Indonesia mereka dikenal berturut-turut sebagai: “meranti bunga, meranti tembaga dan meranti sarang punai” yang termasuk ke dalam kelompok kayu meranti merah. Jenis ini secara ekologis dan ekonomis penting di daerah Asia Tenggara. Distribusi mereka meliputi Thailand, Semenanjung Malaysia, Sumatra sampai ke Kalimantan dengan pengecualian S. acuminata tidak ditemukan di Thailand (Ashton 1982). 5 S. acuminata, S. leprosula dan S. parvifolia adalah jenis diploid (2n = 14) (Ashton 1982; Kajita et al. 1998), dan sistem reproduksi mereka adalah outcrossing dengan polinator utama adalah thrips dan kumbang yang dapat bermigrasi pada jarak yang tidak terlalu jauh (Bawa 1998). Lee et al. (2000a) telah melaporkan bahwa rata-rata nilai outcrossing S. leprosula pada hutan alam adalah 0.84. Beberapa faktor yang mempengaruhi outcrossing adalah waktu pembungaan, kerapatan atau jumlah pohon yang berbunga serta jumlah dan jenis polinator (Lee et al. 2000a; Bawa 1998). Ciri diagnostik secara morfologis untuk membedakan ketiga species tersebut (pada tanaman dewasa) adalah S. acuminata mempunyai daun dengan 7 sampai 10 pasang pertulangan sekunder (nerves), S. leprosula mempunyai 12 sampai 15 pasang pertulangan sekunder dan dibagian bawah daun ada domatia yang berwana krem, dan S. pavifolia mempunyai 9 sampai 13 pasang pertulangan sekunder, dan dibagian bawah daun ada petiole dan twigs yang berwarna coklat muda (Ashton 1982; Newman et al. 1999). Dalam studi filogenetika yang telah dilakukan oleh Indrioko (2005) menggunakan penanda PCR-RFLP berdasarkan cpDNA dengan 23 kombinasi primer dan enzim restriksi, ketiga jenis Shorea ini dapat dibedakan berdasarkan pola restriksi yang dihasilkan sebagai berikut: rbcL/Alu I (1 1 0 0 1 0 0 1) untuk S. parvifolia dan trnLF/Hinf I untuk S. leprosula (4 0 1 1 0) dan S. acuminata (2 0 1 1 0). Karakteristik DNA kloroplas dan penggunaannya. Informasi genetika pada tanaman tinggi tersebar pada tiga genom yaitu nuklear, kloroplas dan mitokondria. Gen dalam genom kloroplas dan mitokondria diketahui sebagai gen sitoplasmik dan gen organel. Ketiga genom DNA pewarisannya berbeda, DNA nuklear selalu diturunkan secara biparental, DNA kloroplas dalam banyak Angiospermae diturunkan secara maternal (tidak selalu) dan secara paternal dalam Gymnospermae (Hamrick dan Nason 2000) tetapi ada bukti yang menyatakan bahwa DNA kloroplas diturunkan secara biparental dalam satu sampai tiga genus (Birky 1995) dan ada juga yang diturunkan secara paternal dalam beberapa jenis. Dalam kayu daun jarum (conifer) umumnya diturunkan secara paternal (Murray et al. 2000). Sedangkan DNA mitokondria diturunkan 6 secara maternal tetapi dalam beberapa kelompok Gymnospermae seperti (Araucariaceae, Cupreassaceae, Taxodiaceae) diturunkan secara paternal (Birky 1995), dan diturunkan secara biparental juga telah diamati pada jenis Pinaceae dan Taxaceae. DNA kloroplas berbentuk sirkular, berukuran kecil sekitar 120 sampai 160 kilo pasang basa. Genom kloroplas dibagi ke dalam dua daerah, pertama daerah large single copy (LSC), dan kedua adalah daerah small single copy (SSC) yang dipisahkan oleh inverted repeat (IR) (Grivet et al. 2001). Panjang daerah LSC diperkirakan sekitar 89200 bp pada Quercus robur dan 86686 bp dalam tembakau (Grivet et al. 2001). DNA kloroplas menga ndung rRNA, tRNA dan sekitar 50 sampai 100 gen yang mengkodekan enzim untuk fotosintesis. Karakteristik DNA kloroplas adalah sebagai berikut: i) genom berukuran kecil dan secara struktur stabil, ii) Genom lebih konservatif dengan rata-rata subsitusi nukleotida yang rendah, iii) Genom tidak mengalami rekombinasi dan diturunkan secara uniparental (Clegg et al. 1994; Provan et al. 2001). DNA kloroplas telah digunakan untuk studi filogenetika pada beberapa tanaman, seperti studi filogenetika pada Dipterocarpaceae (Indrioko 2005; Kamiya et al. 2005; Dayandan et al. 1999; Kajita et al. 1999), studi ekologi dan sejarah evolusi tanaman (Heuertz et al. 2004; Vendramin et al. 1998) dan studi populasi genetika (Deguilloux et al. 2004a; Petit et al. 2002; Lian et al. 2003). Baru-baru ini DNA kloroplas telah digunakan sebagai alat untuk identifikasi asal geografis kayu, seperti yang telah dilakukan pada kayu Oak (Quercus patria (Matt.) Liebl) dan Quercus robur (Deguilloux et al. 2002; 2003; 2004b) dan red ceder (Thuja plicata) (White et al. 2000). Penanda mikrosatelit Mikrosatelit adalah sekuen DNA yang berulang dimana satu motif mengandung satu sampai enam pasang basa yang diulang secara tandem dalam sejumlah waktu (Navascues & Emerson 2005). Jika ulangan tersebut cukup panjang dan tidak terpotong-potong (uninterrupted), mereka sangat baik digunakan sebagai penanda genetik karena tingkat polimorfisme mereka yang tinggi (Hancock 1999; Powell et al. 1996). Dalam literatur, mereka sering disebut 7 sebagai simple sequence repeats (SSRs), short tandem repeat (STR), variable number tandem repeat (VNTR) dan simple sequence length polymorphism (SSLP). Banyaknya istilah ini, cenderung membingungkan terutama ketika melakukan stud i literatur, tetapi istilah mikrosatelit sekarang telah menjadi umum untuk menggambarkan motif DNA pendek yang berulang (Hancock 1999). Mikrosatelit mempunyai karakteristik sebagai berikut: tingkat polimorfisme yang tinggi, kodominan, dan diwariskan mengikuti hukum mendel (Powell et al. 1996; Hancock 1999). Bila satu primer yang spesifik telah didisain, lokus SSR dapat diamplifikasi dari sedikit sampel DNA dengan PCR (Ujino et al. 1998). Mikrosatelit telah diaplikasikan untuk: i) Identifikasi forensik (Balding 1999), bertujuan untuk mengkaitkan sampel darah, sperma, jaringan rambut atau daging dari kasus kriminal, ii) Diagnosis dan identifikasi penyakit, seperti deteksi kanker (Moxon et al. 1999), iii) Studi populasi genetika, untuk mengamati variasi dan membuat kesimpulan tentang struktur populasi, ha nyutan genetik (genetic drift), dan genetic bottlenecks, iv) Konservasi biologi, untuk mengamati perubahan dalam populasi, pengaruh fragmentasi dan interaksi populasi yang berbeda serta untuk identifikasi populasi yang baru terbentuk. Rata-rata mutasi mikrosatelit lebih tinggi (10-6 sampai 10-2 kejadian per lokus per generasi) dibandingkan dengan rata-rata mutasi pada gen yang mengkodekan loci (Li et al. 2002). Mutasi menghasilkan perubahan dalam jumlah unit ulangan dan itu diamati sebagai variasi panjang mikrosatelit. Ada dua jenis mekanisme yang terlibat untuk menerangkan tingginya rata-rata mutasi mikrosatelit. Pertama, rekombinasi diantara kromosom DNA homolog melalui unequal crossing over (UCO) atau dengan konversi gen yang menghasilkan ketidaksempurnaan susunan dan menyebabkan adanya peningkatan ulangan dalam mikrosatelit. Kedua, slippage strand mispairing (SSM) yang terjadi selama replikasi DNA seperti yang ditunjukkan pada Gambar 2. Peristiwa ini dimulai dengan slipnya DNA polimerase selama replikasi yang menyebabkan template dan untai DNA yang baru menjadi tidak sejajar sementara waktu, ketika replikasi dilanjutkan, untaian DNA harus disejajarkan kembali dan mutasi akan dihasilkan jika penjajaran ini tidak sempurna. Hilang atau majunya ulangan mikrosatelit 8 dapat keluar dari loops DNA ganda. (Schloetterer dan Tautz, 1992; Schloetterer 1998; Eisen 1999). Dari dua jenis mekanisme mutasi yang disebutkan diatas, banyak peneliti menyatakan bahwa SSM selama replikasi DNA adalah penyebab utama ketidakstabilan mikrosatelit (Eisen 1999). Rata-rata mutasi mikrosatelit dipengaruhi oleh sifat mikrosatelit, seperti: jumlah ulangan, motif ulangan sekuen, panjang unit ulangan, sekuen flanking, dan interuption dalam mikrosatelit, ratarata transkripsi dan rata-rata rekombinasi (Schloetterer 2000), GC content, suhu, metilasi dan siklus sel (Eisen 1999), posisi kromosom, seks dan genotipe (Li et al. 2002). Gambar 2 Diagram model slippage strand mispairing (SSM) pada mutasi mikrosatelit (Eisen 1999) Slippage strand mispairing (SSM) selama replikasi DNA dapat dikoreksi oleh exonucleolytic proofreading dan mismatch repair. Exonucleolytic proofreading adalah proses pengujian untaian DNA yang salah, ya ng dibuat oleh DNA polimerase selama sintesis DNA. Jika kesalahan ditemukan, exonuclease akan mendegradasi DNA tersebut dan kemudian akan mereplikasi kembali 9 untaian DNA yang baru, dengan back-up DNA polimerase. Kesalahan yang dibuat oleh DNA polimerase tidak akan menjadi mutasi semuanya, sebab kesalahan itu akan diperbaiki (dihapus) oleh proofreading. Exonucleolytic proofreading mendeteksi kesalahan dengan memonitor DNA yang telah direplikasi, apakah membentuk struktur DNA double helik yang normal dengan untaian templatenya. Struktur DNA yang tidak normal akan merangsang (trigger) aktivitas exonuclease. Proofreading dipengaruhi oleh GC content dan sekuen DNA. Mismatch repair berperan dalam mengenali dan memperbaiki kembali basa yang muncul karena salah dalam penggabungan. Mismatch repairs memainkan peranan kunci dalam meregulasi kestabilan mikrosatelit, perbedaan dalam perbaikan loops oleh mismatch repairs menyebabkan banyaknya variasi mikrosatelit di dalam dan diantara species (Eisen 1999). Ada beberapa permasalahan dalam menggunakan penanda mikrosatelit. Permasalahan ini dapat dikelompokkan ke dalam problem praktik dan problem data. Problem praktik meliputi: i) Pemilihan primer untuk mikrosatelit, banyak jenis primer yang telah didisain untuk analisis mikrosatelit pada tanaman. Primerprimer itu perlu diskrining dan dioptimasi sebelum diaplikasikan pada jenis tanaman tertentu tertentu, karena setiap tanaman mempunyai karakteristik spesifik yang berbeda satu sama lain. ii) Slippage selama proses amplifikasi, termopolimerase dapat slip sehingga menghasilkan produk yang berbeda dalam ukurannya. iii) Ukuran produk amplifikasi berbeda dari ukuran produk sebenarnya. Ketidakakuratan dalam identifikasi ale l mungkin juga disebabkan oleh Taq polimerase yang menambah nukleotida adenosin sampai ujung 3’ produk amplifikasi. Ginot et al. (1996) menyatakan untuk mengatasi permasalahan ini adalah dengan menambah polimerase pfu selama atau setelah proses PCR, atau dengan menggunakan polimerase DNA T4 setelah PCR. Homoplasi adalah salah satu problem data. Homoplasi didefinisikan ketika dua alel sama dalam keadaan, tetapi tidak sama secara keturunan. Homoplasi mungkin menyebabkan problem dalam analisis studi genetika populasi, dimana dapat mempengaruhi pengukuran keragaman genetika, aliran gen, jarak genetika, ukuran neighbourhood, metode penetapan dan analisis filogenetika (Estoup et al. 10 2002). Homoplasi dalam mikrosatelit kloroplas dianggap sebagai sebuah pembatas utama, ketika digunakan sebagai penanda genetika (Provan et al. 2001). Para peneliti secara umum telah menganggap bahwa tingkat homoplasi cukup rendah pada mikrosatelit menggunakan DNA kloroplas (Cuenca et al. 2003). Penelitian Tentang Variasi Genetika Jenis Shorea dan Manfaatnya Keragaman genetika adalah perlengkapan yang penting bagi pohon hutan untuk dapat bertahan dalam waktu lama. Tanpa keragaman genetika, pohon hutan sulit beradaptasi terhadap perubahan lingkungan sehingga mereka dapat punah, oleh karena itu keragaman ini sangat penting untuk dipelihara. Finkeldey (1998) menyatakan bahwa evolusi adalah perubahan struktur genetika populasi, paling sedikit terjadi pada satu gen lokus. Proses evolusi akan mengakibatkan terjadinya keragaman genetika pada organisme tidak terkecuali pada pohon hutan. Proses evolusi tersebut meliputi: mutasi (mutation), migrasi (migration), hanyutan genetika (genetic drift), seleksi (selection) dan sistem perkawinan (mating system) (Finkeldey 1998; Ayala 1976). Penanda genetik a telah menjadi alat yang penting untuk mengamati keragaman genetika tanaman. Isozim dan penanda DNA molekuler telah digunakan untuk mengamati keragaman genetika species Shorea. Nilai heterozigositas beberapa species Shorea menggunakan penanda isozim, RAPD, mikrosatelit dan AFLP dapat dilihat pada Tabel 1. Informasi keragaman genetika pohon hutan sangat diperlukan oleh para konservasionis untuk konservasi genetika sumber daya pohon, dan pemulia (breeder) sebagai dasar untuk pemuliaan pohon (Finkeldey 1998). Individu- individu yang mempunyai keragaman genetika yang tinggi dalam populasi dapat dimanfaatkan untuk tujuan pemuliaan. Pemuliaan bertujuan untuk mendapatkan individu unggul, bernilai ekonomis tinggi, tahan terhadap cekaman dan perubahan lingkungan serta memberikan hasil yang sangat baik. 11 Tabel 1 Nilai keragaman genetika beberapa jenis Shorea menggunakan penanda isozim, RAPD, mikrosatelit dan AFLP. Jenis Penanda He Sumber S. leprosula Isozim 0.410 Lee et al. (2000b) S. robusta Isozim 0.143 Suoheimo et al. (1999) S. cardofolia Isozim 0.651 Stacy et al. (2001) S. parvifolia Isozim 0.223 Sudarmonowati et al. (1998) S. leprosula RAPD 0.686 Isoda et al. (2001) S. leprosula RAPD 0.270 Prihatini et al. (2001) S. parvifolia mikrosatelit 0.780 Lee et al. (2004) S. ovalis mikrosatelit 0.640 Ng et al. (2004) S. curtisii mikrosatelit 0.640 Ujino et al. (1998) S. curtisii mikrosatelit 0.790 Obayashi et al. (2002) S. leprosula mikrosatelit 0.748 Lee et al. (2004) S. leprosula mikrosatelit 0.700 Ng et al. (2004) S. leprosula mikrosatelit 0.800 Nagamitsu et al. (2001) S. leprosula mikrosatelit 0.710 Rimbawanto & Isoda (2001) S. leprosula AFLP 0.161 Siregar et al. (2005) S. parvifolia AFLP 0.205 Siregar et al. (2005) 12 BAHAN DAN METODE Tempat dan Waktu Penelitian Penelitian ini dilaksanakan di Laboratorium Silvikultur, Departemen Silvikultur, Fakultas Kehutanan IPB dan Institut Genetika Hutan dan Pemuliaan Pohon Hutan Universitas Goettingen - Jerman dari Juni sampai Oktober 2005. Alat dan Bahan Penelitian Alat yang digunakan dalam penelitian ini adalah mesin PCR PTC-200 Peltier Thermal Cycler MJ Research, peralatan elektroporesis, lampu UV transiluminator, pH meter, sent rifius, pipet mikro, dan tabung mikro, sedangkan bahan yang digunakan adalah daun Shorea spp, nitrogen cair, Dneasy Plant 96 Kit untuk isolasi DNA dari Qiagen, HotStarTaq Master Mix Kit Qiagen, primer ccmp1 sampai ccmp10 (Weising dan Gardener 1999), peralatan elektroporesis, sentripugasi, DNA MWM XIV (100-1500 bp), air destilasi, agarose, larutan TAE 1X, dan etidium bromida. Metode Penelitian Koleksi Sampel Diagram alur penelitian dapat dilihat pada Gambar 3. Tiga jenis Shorea seksi Mutica (Shorea acuminata, Shorea leprosula dan Shorea parvifolia) diinvestigasi dalam studi ini. Jaringan daun (daun muda atau setengah tua) dari anakan atau tiang atau pohon ketiga jenis Shorea diambil dari hutan alam di Sumatra dan Kalimantan serta satu lokasi dari hutan tanaman di pulau Jawa. Lokasi koleksi sampel dapat dilihat pada Gambar 4, dan jumlah individu yang diambil per populasi disajikan pada Tabel 2. Jarak lapang antar individu yang dikoleksi sekitar 150 m. Sampel dari lapangan disimpan dalam kantong plastik yang berisi silika gel dengan perbandingan daun terhadap silika gel adalah 1: 5 sehingga daun menjadi kering dan tidak terserang jamur kemudian disimpan dalam freezer pada temperatur -60o C sampai ekstraksi DNA dilakukan. Sampel (Daun Meranti) Isolasi DNA Uji DNA Tidak Ya PCR dan elektroporesis Genescan dan Genotyping Analisis Data Gambar 3 Bagan Alur Penelitian Borneo Sumatra Sumalindo Berau Pasir Mayang Batu Ampar TNBT Asialog Java S ari Bumi Kusuma. Tering Nanjak Makmur Haurbentes Skala 1:300 km Gambar 4 Lokasi penga mbilan sampel di lapangan. 14 Tabel 2 Koleksi sampel berdasarkan populasi dan jumlah individu per populasi. Jenis Shorea acuminata Shorea leprosula Shorea parvifolia Nama populasi* Berau Pasir Mayang TNBT Nanjak Makmur Haurbentes Tering Sumalindo Sari Bumi Kusuma Pasir Mayang TNBT Asialog Nanjak Makmur Batu ampar Sumalindo Sari Bumi Kusuma Pasir Mayang TNBT Asialog Nanjak Makmur 19 Kode populasi ACU-BR ACU-PM ACU-TNBT ACU-NM LEP-HB LEP-TR LEP-SM LEP-SBK LEP-PM LEP-TNBT LEP-AS LEP-NM PAR-BA PAR-SM PAR-SBK PAR-PM PAR-TNBT PAR-AS PAR-NM N 7 6 7 7 6 6 5 5 5 6 2 5 5 6 7 5 6 10 7 113 Asal Kalimantan Sumatra Sumatra Sumatra Kalimantan Kalimantan Kalimantan Kalimantan Sumatra Sumatra Sumatra Sumatra Kalimantan Kalimantan Kalimantan Sumatra Sumatra Sumatra Sumatra Total Keterangan : N : Jumlah individu * : perkiraan geografis (lintang dan bujur) setiap populasi: 1. Hutan alam TNBT 01o 05' - 02o 06'S dan 103o 15' - 103o 33'E 2. Hutan alam Asialog 02o 02' - 02o 22'S dan 103o 15' - 103o 33'E 3. Hutan alam Pasir Mayang 00o 08' - 03o 09'S dan 101o 19' - 103o 20'E 4. Hutan alam Nanjak Makmur 10o 22S dan 101o 40'E o o 5. Arboretum Haurbentes 06 54' - 07 54'S dan 106o 41' - 107o 42'E 6. Hutan alam Sari Bumi Kusuma 01o 59' - 00o 36'S dan 111o 19' - 114o 42'E 7. Hutan alam Sumalindo 00o 55' - 00o 56'N dan 115o 19 - 116o 36'E 8. Hutan alam Berau 02o 05' - 02o 36'S dan 116o 49' - 117o 24'E 9. Hutan alam Batu ampar 00o 45' - 00o 50'N dan 116o 48' - 117o 00'E 10. Hutan alam Tering 00o 00' - 00o 10'N dan 115o 22' - 116o 38'E Ekstraksi DNA dan PCR-cpSSR (Kloroplas Mikrosatelit) Daun kering berukuran 2 x 1 cm diambil untuk diekstraksi DNA totalnya dengan menggunakan Dneasy 96 Plant DNA isolation Kit (Cat. No. 69181; Qiagen, Hilden). Metode ekstraksi dilakukan sesuai dengan instruksi perusahaan. Kualitas DNA hasil isolasi dielektroporesis dengan konsentrasi agarose 0.8% (w/v). Elektroporesis dilakukan menggunakan 1X larutan bufferTris-acetate (TAE) selama 30 sampai 80 menit pada tegangan 100 sampai 150 V. Kualitas 15 DNA diuji dengan membandingkan dengan DNA standar (Lambda DNA Marker, Cat. No 745782; Roche Mannheim) dan DNA standar Molecular Weight Standard XIV (100 bps ladder) (Cat. No. 1721933; Roche Mannheim). Sepuluh primer universal yang dinamakan consensus chloroplast microsatellite primer (ccmp) ccmp1 - ccmp10 (Weising & Gardener 1999) diuji untuk analisis DNA kloroplas. Sekuen DNA masing- masing primer dapat dilihat pada Table 3. Sebelum dilakukan amplifikasi, primer forward terlebih dahulu dilabel dengan pewarna fluorescence (Metabion) yaitu: 6-FAM/Biru (untuk ccmp2, ccmp4, ccmp6 dan ccmp9), HEX/Hijau (untuk ccmp1, ccmp3, ccmp7 dan ccmp10) dan NED/Kuning (ccmp5 dan ccmp8) Prosedur PCR mengikuti Indrioko (2005), yaitu denaturasi awal selama 15 menit pada suhu 95o C, diikuti 39 siklus : denaturasi selama 1 menit pada suhu 94o C, annealing selama 1 menit pada suhu 50o C, extension selama 1 menit pada suhu 72o C dan final extension selama 10 menit pada suhu 72o C. Volume reaksi PCR adalah 15 µl, terdiri atas: 2.0 µl DNA template (5-10 ng), 1.8 µl primer forward (5 pmol/µl) dan primer reverse (5 pmol/µl), 1.9 µl air bebas RNAse, dan 7.5 µl HotStarTaq Master Mix Kit (Qiagen, Hilden). Hasil PCR dielektroporesis pada gel agarose dengan konsentrasi 2.0% (w/v), setelah itu gel agarose direndam dalam 1.0% (v/v) larutan etidium bromida selama 20 menit pada temperatur ruangan, pola pita diamati dibawah lampu UV transiluminator dalam ruang gelap dan didokumentasikan dengan menggunakan kamera digital. Genescan dan Genotyping Hasil PCR Hasil amplifikasi dipisahkan dengan elektroporesis kapiler menggunakan Sekuenser ABI PRISM 3100 (Applied Biosystems) dengan polymer 3100 POP-4 TM (Applied Biosystem) dan standar GS500 ROX TM (Applied Biosystem). Alel- alel dianalisis menggunakan Genescan versi 3.7 (Applied Biosystem) dan genotyping mengunakan Genotyper versi 3.7 NT (Applied Biosystem). Bahan-bahan untuk Genescan (96 probes) terdiri atas: 1152 µl HiDi Formamide (Applied Biosystem) dan 1.5 µl standar GS 500 ROX TM (Applied Biosystems). Campuran tersebut didistribusikan secara merata ke dalam tube (12 µl setiap sampel), setelah itu 2 µl DNA hasil amplifikasi ditambahkan ke dalam 16 setiap tube. Sampel kemudian didenaturasi selama 2 menit pada 90o C dan disimpan dalam es sekitar 5 menit sampai analisis Genescan dilakukan. Tabel 3 Sekuen DNA pasangan primer yang diuji untuk amplifikasi cpSSR Lokus Lokasi Sekuen primer forward dan reverse (5'-3') cpSSR ccmp1 trnK intron Ulangan dalam Tembakau (T)10 CAGGTAAACTTCTCAACGGA CCGAAGTCAAAAGAGCGATT ccmp2 5' to trnS GATCCCGGACGTAATCCTG (A)11 ATCGTACCGAGGGGTTCGAAT ccmp3 trnG intron CAGGTAAACTTCTCAACGGA (T)11 CCGAAGTCAAAAGAGCGATT ccmp4 atpF intron AATGCTGAATCGA(CT)GACCTA (T)13 CCAAAATATT(GCT)GGAGGACTCT ccmp5 3'to rps2 TGTTCCAATATCTTCTTGTCATTT (C)7 (T)10 AGGTTCCATCGGAACAATTAT (T)5 C(A)11 ccmp6 ORF 77-ORF CGATGCATATGTAGAAAGCC (T)5 C(T)17 82 intergenic CATTACGTGCGACTATCTCC ccmp7 atpB-rbcL CAACATATACCACTGTCAAG (A)13 intergenic ACATCATTATTGTATACTCTTTC ccmp8 rpl20-rps12 TTGGCTACTCTAACCTTCCC (T)6 C(T)14 intergenic TTCTTTCTTATTTCGCAGDGAA ccmp9 ORF 74b-psbB GGATTTGTACATATAGGACA (T)11 intergenic CTCAACTCTAAGAAATACTTG ccmp10 rpl2 - rps 19 TTTTTTTTTAGTGAACGTGTCA (T)14 intergenic TTC GTC G(AGT)C GTA GTA AAT AG Sumber : Weising & Gardner (1999) Analisis Data Haplotipe cpSSR disimpulkan sebagai kombinasi dari ukuran individu alel yang ditemukan pada setiap lokus cpSSR yang dianalisis. Ukuran fragmen individu alel dalam pasang basa ditunjukkan oleh puncak gelombang tertinggi dari hasil genotyping. Pada sampel yang ditemukan fragmen cpSSR dikodekan dengan 1 dan sampel yang tidak ditemukan fragmen cpSSR dikodekan dengan 0 untuk keperluan analisis dengan program. Frekuensi haplotipe dan struktur genetika antar pulau dan antar populasi dalam pulau dihitung dengan menggunakan analisis keragaman molekuler 17 (AMOVA) menurut (Excoffier et al. 1992). Semua analisis tersebut dilakukan dengan menggunakan program ARLEQUIN versi 2.0 (Schneider et al. 2000). Pengukuran struktur genetika di dalam populasi (Hs) dan antar populasi (Gst) juga dihitung dengan menggunakan program POPGEN 32 (Yeh et al. 1999). Analisis diferensiasi populasi (δ) pada ketiga jenis Shorea juga dihitung dengan menggunakan program GSED versi 1.1k (Gillet 2005), dan analisis dendogram UPGMA berdasarkan jarak genetika Nei (1972) dan Gregorious & Roberds (1986) dilakukan dengan program NTSYSpc 2.01b (Rohlf et al. 1999). 18 HASIL DAN PEMBAHASAN Haplotipe Mikrosatelit Kloroplas Penelitian pendahuluan dilakukan menggunakan dua sampel per populasi dan sepuluh primer mikrosatelit kloroplas (cpSSR), yaitu ccmp1 sampai ccmp10 (Weising & Gardener 1999). Dari sepuluh primer yang diuji, lima primer (ccmp4, ccmp5, ccmp7, ccmp8 dan ccmp9) tidak menghasilkan amplifikasi. Lima primer (ccmp1, ccmp2, ccmp3, ccmp6 dan ccmp10) berhasil mengamplifikasi semua sampel, seperti terlihat pada Gambar 5. [a] [b] [d] [c] [e] Gambar 5 Lima primer yang berhasil diamplifikasi dengan PCR. Keterangan : a) Hasil amplifikasi PCR menggunakan primer ccmp1. b) Hasil amplifikasi PCR menggunakan primer ccmp2. c) Hasil amplifikasi PCR menggunakan primer ccmp3. d) Hasil amplifikasi PCR menggunakan primer ccmp6. e) Hasil amplifikasi PCR menggunakan primer ccmp10. Dari lima primer yang berhasil diamplifikasi dengan PCR, tiga primer (ccmp1, ccmp2 dan ccmp10) menunjukkan pola monomorfik dengan ukuran fragmen berturut-turut adalah 113, 150 dan 101 bp. Pada primer ccmp3 dan ccmp6 menunjukkan pola polimorfik, seperti terlihat pada Gambar 6. Hasil amplifikasi ccmp3 memberikan 4 tipe ukuran panjang fragmen (100, 101, 102 dan 104 bp) dan hasil ccmp6 memberikan 2 tipe ukuran panjang fragmen (97 dan 98 bp), dengan demikian didapatkan jumlah total 6 haplotipe seperti terlihat pada Table 4. 104 102 101 [a] 100 98 [b] 97 Gambar 6 Hasil GeneScan primer ccmp3 dan ccmp6 yang menunjukkan pola polimorfisme. Keterangan : a) Polimorfisme yang terdeteksi pada primer ccmp3, yaitu 104 bp, 102 bp, 101 bp dan 100 bp. b) Polimorfisme yang terdeteksi pada primer ccmp6, yaitu 98 bp dan 97 bp. Tabel 4 Definisi haplotipe dan ukuran fragmen cpSSR Haplotipe A B C D E F Ukuran amplifikasi fragmen cpSSR (bp) ccmp3 ccmp6 101 97 101 98 100 98 102 97 104 97 100 97 20 Variasi Haplotipe Berdasarkan hasil genescan DNA kloroplas diperoleh haplotipe umum masing- masing jenis Shorea yaitu haplotipe D untuk S. acuminata, haplotipe A untuk S. leprosula dan haplotipe C untuk S. parvifolia. Detail hasil genescan untuk S. acuminata, S. leprosula dan S. parvifolia dapat dilihat pada Lampiran 1. Ketiga jenis Shorea tersebut hanya dibedakan oleh 1-2 pasang basa seperti terlihat pada Tabel 5. Berdasarkan hasil studi ini, ada dua tipe mutasi yang menyebabkan perbedaan diantara mereka yaitu delesi dan insersi. Tabel 5 Perbedaan antara S. acuminata, S. leprosula dan S. parvifolia berdasarkan tipe mutasi Jenis S. acuminata vs S. leprosula S. acuminata vs S. parvifolia S. leprosula vs S. parvifolia Perbedaan Tipe mutasi 1 bp pada ccmp3 (102-101) 2 bp pada ccmp3 (102-100) 1 bp pada ccmp6 (97-98) 1 bp pada ccmp3 (101-100) 1 bp pada ccmp6 (97-98) Delesi Delesi Insersi Delesi Insersi Terjadinya delesi dan insersi basa pada ketiga jenis Shorea tersebut kemungkinan karena adanya seleksi alam melalui fluktuasi lingkungan yang ekstrim pada waktu lampau dan/atau waktu sekarang. Waktu terjadinya mutasi tersebut secara tepat sulit ditentukan, tetapi berdasarkan sifat DNA kloroplas yang konservatif dan kecepatan mutasi yang rendah yaitu 3.2 x 10-5 dan 7.9 x 10-5 (Provan et al. 1999) boleh jadi peristiwa mutasi terjadi pada masa lampau. Gen yang mengalami mutasi satu basa dapat mengakibatkan perubahan asam amino yang dihasilkan sehingga berdampak pada perubahan fenotipe tanaman di lapangan. Detail frekuensi haplotipe DNA kloroplas masing- masing jenis Shorea ditunjukkan pada Tabel 6. Variasi haplotipe dalam studi ini tergolong rendah, dimana Shorea acuminata memiliki variasi haplotipe yang lebih tinggi dibandingkan dengan S. leprosula dan S. parvifolia. S. acuminata memiliki enam haplotipe (A, B, C, D, E dan F), S. leprosula tiga haplotipe (A, C dan F) dan S. parvifolia juga tiga haplotipe (C, D dan F). Hasil studi genetika populasi oleh Indrioko (2005) yang menggunakan penanda PCR-RFLP dan mikrosatelit 21 berdasarkan DNA kloroplas, pada S. leprosula ditemukan hanya satu haplotipe, sedangkan pada S. parvifolia ditemukan tiga haplotipe. Variasi haplotipe DNA kloroplas yang rendah juga diamati pada jenis Oak (Petit et al. 2002); Tolmiea menziensis (Soltis et al. 1989); dan Lupinus texensis (Banks & Birky 1985). Petit et al. (2002) meneliti 12214 individu dari 2614 populasi hanya menemukan 32 haplotipe, sedangkan variasi DNA kloroplas yang cukup tinggi diamati pada common ash (Fraxinus excelsior L.) (Heuertz et al. 2001) dan Pinus pinaster (Vendramin et al. 1998). Tabel 6 Frekuensi haplotipe S. acuiminata, S. leprosula dan S. parvifolia pada setiap populasi Jenis N ACU-BR ACU-TNBT ACU-PM ACU-NM LEP-HB LEP-TNBT LEP-PM LEP-NM LEP-AS LEP-TR LEP-SBK LEP-SM PAR-BA PAR-AS PAR-PM PAR-TNBT PAR-NM PAR-SBK PAR-SM 7 7 6 7 6 6 5 5 2 6 5 5 5 10 5 6 5 7 6 A 0.714 0.143 0.000 0.000 1.000 1.000 0.800 1.000 1.000 0.833 1.000 0.800 0.000 0.000 0.000 0.000 0.000 0.000 0.000 B 0.143 0.143 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 Haplotipe C D 0.143 0.000 0.143 0.286 0.000 0.833 0.143 0.857 0.000 0.000 0.000 0.000 0.200 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 1.000 0.000 1.000 0.000 1.000 0.000 1.000 0.000 1.000 0.000 0.286 0.143 1.000 0.000 E 0.000 0.286 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 F 0.000 0.000 0.167 0.000 0.000 0.000 0.000 0.000 0.000 0.167 0.000 0.200 0.000 0.000 0.000 0.000 0.000 0.571 0.000 Keterangan : 1 2 : Jenis Shorea (ACU = S. acuminata, LEP = S. leprosula, PAR = S. parvifolia). :

Dokumen baru

Download (54 Halaman)
Gratis

Dokumen yang terkait

Kualitas Balok Laminasi dari Kayu Sengon (Paraserienthes falcataria (L) Nielsen) dan Kayu Meranti Merah (Shorea leprosula Miq.) dengan Perlakuan Jumlah Lapisan dan Berat Labur Perekat
2
43
80
Identifikasi Kemiripan Genetik Beberapa Genotipe Saccharum spp.Sumatera Utara denganVarietas Tebu Toleran Kekeringan (PS 864 dan PSJT 941) Menggunakan Penanda Random Amplified Polymorphism DNA
1
41
124
Induksi Tunas Pisang Barangan (Musa acuminata L.) Dengan Pemberian NAA dan BAP Berdasarkan Sumber Eksplan
1
78
54
Hubungan Genetik Empat Populasi Kelapa Genjah Berdasarkan Penanda RAPD (Random Amplified Polymorphic DNA)
0
27
73
Genom Kloroplas
0
15
4
RESPON PERTUMBUHAN SEMAI Shorea assamica Dyer TERHADAP TINGKAT NAUNGAN DAN PERLAKUAN BAHAN PENGHAMBAT TUMBUH (Growth Response of Shorea assamica Dyer Seedlings to Shading Leveland Growth Inhibitor Treatments)
0
0
9
PENGARUH ASAL POPULASI DAN KLON TERHADAP KERAGAMAN PERTUMBUHAN STEK PUCUK Shorea leprosula Miq (Effect of Population Sources and Clones to Growth Variation of Shorea leprosula Miq Shoot Cuttings)
0
0
10
BIOTEKNOLOGI PERIKANAN Struktur Sel, DNA dan RNA Replikasi DNA dan Sintesis Protein
0
0
53
Struktur Sel, DNA dan RNA Replikasi DNA dan Sintesis Protein
0
0
53
ANALISIS FITOKIMIA SENYAWA METABOLIT SEKUNDER EKTRAK KASAR ETANOL DAUN MERANTI MERAH (Shorea leprosula Miq.) DAN SIFAT ANTIBAKTERINYA TERHADAP Staphylococcus aureus DAN Eschericia coli
0
0
9
Keragaman Genetik DNA Mikrosatelit dan Hubungannya dengan Performa Bobot Badan pada Domba Lokal
0
1
13
Kualitas Balok Laminasi dari Kayu Sengon (Paraserienthes falcataria (L) Nielsen) dan Kayu Meranti Merah (Shorea leprosula Miq.) dengan Perlakuan Jumlah Lapisan dan Berat Labur Perekat
0
0
10
KUALITAS BALOK LAMINASI DARI KAYU SENGON (Paraserienthes falcataria (L) Nielsen) DAN KAYU MERANTI MERAH (Shorea leprosula Miq.) DENGAN PERLAKUAN JUMLAH LAPISAN DAN BERAT LABUR PEREKAT
0
0
10
Kualitas Balok Laminasi dari Kayu Sengon (Paraserienthes falcataria (L) Nielsen) dan Kayu Meranti Merah (Shorea leprosula Miq.) dengan Perlakuan Jumlah Lapisan dan Berat Labur Perekat
0
0
10
KUALITAS BALOK LAMINASI DARI KAYU SENGON (Paraserienthes falcataria (L) Nielsen) DAN KAYU MERANTI MERAH (Shorea leprosula Miq.) DENGAN PERLAKUAN JUMLAH LAPISAN DAN BERAT LABUR PEREKAT
0
1
10
Show more