Feedback

Analysis of land cover changes, genetic structure, and carbon biomass stock of pinus Merkusii Jungh Et De Vriese Strain Tapanuli In Its Natural Distribution In North Sumatra

Informasi dokumen
ABSTRACT ALFAN GUNAWAN AHMAD. Analysis of land cover changes, genetic structure, and carbon biomass stock of Pinus merkusii Jungh et de Vriese strain Tapanuli in Its Natural Distribution in North Sumatra. Under supervision of ULFAH JUNIARTI SIREGAR, HADI SUSILO ARIFIN, and CHAIRIL ANWAR SIREGAR. Pinus merkusii strain Tapanuli is currently considered as endangered because of declining population and habitat due to logging activity and land use changes. With recent development on carbon trade the natural populations of P. merkusii strain Tapanuli has the potential as carbon sink. The objective of the research were 1) To analyze the landcover changes in five locations of strain Tapanuli natural habitat, which occured in 1994, 2005, and 2011, 2) To analyze the genetic structure of those five natural populations using microsatellite markers 3) To formulate the allometric equation for carbon biomass estimation of strain Tapanuli. Five study locations in strain Tapanuli natural habitat were selected as follows: a) two protected forests, i.e. Dolok Tusam Timur and Dolok Tusam Barat, b) two open and cultivated area, i.e. Parinsoran and Lobugala village, and c). Mixed forests in Tolang hilly village. Analysis of land cover changes was based on Landsat imagery 7 ETM+ in 1994, 2005, and 2011. Microsatellite markers were generated from microsatellite primers developed previously on P. merkusii strain Aceh. Formulation of allometric equations was done using destructive sampling method combined with volumetric method. The results showed that 1) Land cover changes that occur in Tapanuli terrestrial ecosystem from 1994 to 2011 has led to increased extent of weeds-shrub land, and cause the site of natural populations of Tapanuli strain of P. merkusii into nutrient poor. The cumulative soil carbon stock in the five research sites are as follows: Dolok Tusam Timur 55,5 ton C/ha, Parinsoran 46,1 ton C/ha, Dolok Tusam Barat 65,8 ton C/ha, Lobugala 89 ton C/ha, dan Tolang 71,1 ton C/ha. 2) Heterozygosity levels of those populations were high, and Population of Parinsoran and Tolang into one group, Population of Lobugala into one grup. 3). The best allometric equation for estimation of biomass carbon content of P. merkusii strain Tapanuli as follows: allometric equation for above ground biomass is Y = 0,1900(DBH)2,2730; for below ground biomass is Y = 0,0283(DBH)2,4393 and allometric equation for total biomass estimation of P. merkusii strain Tapanuli is Y= 0,2451(DBH)2,2757, 3). Based on this equation the potential carbon estimated in five location of natural distribution of P. merkusii strain Tapanuli are as follows: Dolok Tusam Timur 187,8 ton C/ha, Parinsoran 48,9 ton C/ha, Dolok Tusam Barat 190,4 ton C/ha, Lobugala 93,2 ton C/ha, and Tolang 45,7 ton C/ha. Keyword: Tapanuli strain of Pinus merkusii, land cover changes, genetic structure, carbon biomassa, Diameter at Breast Height (DBH) RINGKASAN ALFAN GUNAWAN AHMAD. Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii Jungh. et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara. Dibawah bimbingan: ULFAH JUNIARTI SIREGAR, HADI SUSILO ARIFIN, dan CHAIRIL ANWAR SIREGAR. Pinus merkusii Jungh. et de Vriese adalah satu-satunya jenis pinus tropis di dunia yang penyebarannya mampu memasuki lintang selatan garis khatulistiwa. Di Indonesia, P. merkusii tersebar secara alami di tiga lokasi di Sumatera bagian Utara, yakni Aceh, Tapanuli, dan Kerinci. Pinus merkusii strain Tapanuli merupakan salah satu populasi alam tusam yang keberadaannya terus mendapatkan tekanan atau gangguan sehingga kelestariannya pun menjadi terancam. Karenanya, kegiatan pelestarian jenis P. merkusii strain Tapanuli pada ekosistem daratan Tapanuli merupakan kegiatan penting yang perlu diprioritaskan dan didukung oleh banyak pihak. Namun pada kenyataannya kegiatan pelestarian jenis P. merkusii strain Tapanuli sering terkendala dengan minimnya data dan informasi penting yang dapat digunakan sebagai acuan untuk menyusun rencana dan program. Sedikitnya ada 3 aspek penting yang perlu digali informasinya secara akurat dan aktual yakni aspek silvikultur, aspek genetik dan aspek biomassa karbon. Atas dasar inilah maka dilaksanakanlah penelitian dengan judul: ”Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii strain Tapanuli Jungh et de Vriese pada Sebaran Alaminya di Sumatera Utara”. Ada 3 tujuan dalam penelitian ini, yaitu: 1). Menganalisis karakteristik tutupan lahan, sifat kimia tanah, dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2). Menganalisis struktur populasi dan keragaman genetik tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit. 3). Menganalisis kandungan biomassa karbon tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan persamaan allometrik yang disusun berdasarkan metode destructive sampling. Analisis tutupan lahan dilakukan untuk mengetahui perubahan tutupan lahan, penggunaan lahan dan kondisi tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di ekosistem daratan Tapanuli. Analisis perubahan tutupan dilakukan melalui analisis citra Landsat 7 ETM+ (seri 7 Enhanced Thematic Mapper Plus) tahun 1994, 2005, dan 2011. Adapun analisis kondisi tapak tumbuh dilakukan berdasarkan hasil analisis sifat kimia tanah. Analisis genetik lima populasi alam P. merkusii strain Tapanuli yang tersebar di Tapanuli dilakukan dengan menggunakan penanda molekuler mikrosatellite. Sampel daun untuk analisis genetik diambil dari pohon Pinus merkusii yang tumbuh di 5 lokasi sebaran alam yang berbeda, yakni Kawasan Hutan Lindung Dolok Tusam Barat, areal perladangan di desa Parinsoran, Hutan Lindung Dolok Tusam Timur, areal perladangan di kampung Lobugala, dan areal perbukitan hutan campuran di desa Tolang – Kec. Aek Bilah – Kab. Tapanuli Selatan. Penyusunan persamaan allometrik dilakukan dengan modifikasi metode destructive sampling pada 36 pohon sampel dan metode volumetrik pada 8 pohon sampel. Sebaran kelas diameter pohon sampel ini ditentukan dengan mengacu pada sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam – Tapanuli. Metode destructive sampling mengacu pada metode yang dikembangkan oleh JIFPRO (2000), Siregar (2007) dan Siregar (2011). Berdasarkan hasil pengolahan dan analisis data maka ada 3 simpulan yang dihasilkan dari penelitian ini: a. Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui kondisi tutupan hutan di lima lokasi penelitian relatif stabil. Bahkan di lokasi Lobugala, tutupan hutannya meningkat. Selanjutnya berdasarkan analisis sifat kimia tanah dapat diketahui kandungan karbon tanah di lima lokasi penelitian berkisar antara 46,1- 89 ton C/ha. Kandungan karbon tanah tertinggi ditemukan di Lobugala, sedangkan yang terendah di Parinsoran. Adapun berdasarkan analisis struktur tegakan dapat diketahui bahwa kelima lokasi penelitian mengalami defisit permudaan alam P. merkusii strain Tapanuli. b. Berdasarkan hasil analisis genetik dapat diketahui nilai heterosigositas harapan (He) pada lima populasi alam P. merkusii strain Tapanuli berkisar antara 0,3779 hingga 0,4693. Nilai He tertinggi dimiliki oleh populasi alam P. merkusii strain Tapanuli yang tumbuh di Lobugala, sedangkan yang terendah dimiliki oleh populasi alam Dolok Tusam Barat. Namun demikian, berdasarkan nilai heterosigositas aktualnya, hanya populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang mengalami surplus heterosigositas. Selanjutnya berdasarkan kedekatan jarak genetiknya, kelima populasi alam P. merkusii strain Tapanuli mengelompok menjadi dua kelompok besar. Kelompok pertama terdiri atas populasi Dolok Tusam Timur dan Dolok Tusam Barat. Adapun kelompok kedua terdiri atas dua sub kelompok. Sub kelompok pertama terdiri atas populasi Parinsoran dan Tolang, sedangkan sub kelompok kedua hanya terdiri populasi Lobugala. c. Persamaan allometrik terbaik untuk pendugaan biomasa karbon P. merkusii strain Tapanuli menggunakan peubah bebas diameter setinggi dada (DBH) dengan model persamaan sebagai berikut: untuk pendugaan biomassa di bagian atas tanah adalah Y = 0,1900(DBH)2,2730 RMSE=0,177670; 2,4393 0,0283(DBH) untuk , pendugaan R² = 0,97980, R2adj=0,979317, biomassa akar adalah Y = 2 R² = 0,90240, R adj=0,900094 RMSE=0,436644; dan untuk pendugaan biomassa total adalah Y= 0,2451(DBH)2,2757 R² = 0,97840 R2adj= 0,977900 RMSE=0,183996. Stok karbon P. merkusii strain Tapanuli di 5 lokasi penelitian sbb: Dolok Tusam Timur 187,8 ton C/ha, Parinsoran 48,9 ton C/ha, Dolok Tusam Barat 190,4 ton C/ha, Lobugala 93,2 ton C/ha, dan Tolang 45,7 ton C/ha. Kata kunci: Pinus merkusii strain Tapanuli, tutupan lahan, keragaman genetik, biomassa karbon, Diameter at breast height (DBH) 1 PENDAHULUAN Latar Belakang Hutan menyerap dan menyimpan karbon lebih banyak dibanding ekosistem daratan lain dan memiliki peran penting didalam pencegahan (mitigasi) perubahan iklim. Namun ketika hutan ditebang habis atau terdegradasi maka karbon yang tersimpan tersebut akan terlepas ke atmosfer sebagai gas karbondioksida atau gas rumah kaca yang lain. Diperkirakan setiap tahun sebanyak 1-2 Milyar ton karbon dilepaskan ke atmosfer akibat deforestasi di kawasan tropis selama 20 tahun terakhir. Hal ini menjadikan deforestasi dan degradasi hutan sebagai sumber emisi terbesar gas rumah kaca pada sebagian besar negara tropis. Sebagai contoh, deforestasi di Afrika telah mendekati 70% total emisi gas rumah kaca dari semua sektor (ITTO 2011). Selain itu, deforestasi juga menyebabkan terjadinya perubahan kondisi ekosistem daratan pada skala bentang alam (lanskap) (Fitzsimmons 2001; Lira et al. 2012), dinamika nutrisi tanah hutan (Ellingson et al. 2000), struktur tegakan (Echeverria et al. 2012), kepadatan karbon (Fitzsimmons et al. 2001), hingga struktur genetik suatu jenis (Kangas 1990; Sebbenn et al. 2008). Hal ini menempatkan deforestasi sebagai bentuk gangguan yang paling mengancam kelestarian hutan dan kelangsungan hidup manusia di muka bumi ini (Myers 1996; WCFSD 1999). Pengurangan luas hutan akibat deforestasi dan bencana alam di muka bumi selama kurun waktu 1990-2000 adalah 14.2 juta ha/tahun, dan 15.2 juta ha/tahun untuk periode 2000 hingga 2005. Adapun laju afforestasi dan perluasan hutan alam selama periode 1990 hingga 2000 adalah 10,1 juta ha/tahun dan 8,8 juta ha/tahun untuk periode 2000-2005. Dengan demikan total bersih tutupan hutan yang hilang di muka bumi selama 15 tahun (1990-2005) adalah sebesar 72.9 juta hektar dengan rata-rata laju kehilangan hutan 4,9 juta ha/tahun (FAO 2010). Selanjutnya berdasarkan hasil survey Forest Watch Indonesia (2011), dapat diketahui bahwa dalam periode 2000-2009, hutan Indonesia mengalami deforestasi sebanyak 15.16 juta hektar. Pulau Sumatera menjadi penyumbang kedua deforestasi setelah Kalimantan, yakni sebesar 3.71 juta hektar. Laju 2 deforestasi nasional pada kurun waktu tersebut adalah 1.51 juta ha/tahun. Adapun laju deforestasi untuk pulau Sumatera sebesar 412 ribu ha/tahun. Laju deforestasi untuk Sumatera Utara antara tahun 2006-2009 adalah 44099.6 ha/tahun (Kemenhut 2010). Upaya pelestarian sisa sumberdaya hutan pun harus dapat dilakukan secara terencana, menyeluruh, dan terpadu sehingga mampu memenuhi berbagai kebutuhan hajat hidup manusia yang bersumber dari hutan. Upaya pelestarian sisa sumberdaya hutan selain dilakukan untuk mempertahankan keberadaan tegakan pohon, juga untuk mempertahankan fungsi sumberdaya hutan secara optimal dan berkesinambungan. Perhatian terhadap kelestarian keberadaan dan fungsi sumberdaya hutan inilah yang mendorong banyak pihak memberikan peluang metode dan pendanaan untuk kegiatan pelestarian tersebut. Skema Reducing Emission from Deforestation and Forest Degradation + (REDD+) merupakan salah satu peluang yang ditawarkan oleh negara maju untuk kegiatan pelestarian sumberdaya hutan yang merupakan upaya mitigasi untuk mengurangi pemanasan global dan perubahan iklim global melalui pengurangan emisi gas rumah kaca dari deforestasi dan degradasi hutan. Skema REDD+ ini merupakan salah satu hasil dari pertemuan para pihak (Conference of the Parties atau COP) ke 16 yang diselenggarakan oleh United Nation Framework Convention on Climate Change (UNFCCC) di Cancun, Mexico pada tahun 2010. Skema REDD+ memberikan peluang bagi negaranegara pemilik hutan tropis untuk mendapatkan insentif pendanaan sebagai bentuk kompensasi atas upayanya melakukan mitigasi perubahan iklim melalui pencegahan deforestasi dan degradasi hutan serta peningkatan serapan biomassa karbon melalui kegiatan konservasi (the role of conservation), pengelolaan hutan secara lestari (sustainable management of forest), dan peningkatan stok karbon di hutan negara berkembang (enhancement of forest carbon stocks in developing countries) (FCCC 2011). Melalui skema REDD+ diharapkan stok karbon yang terkandung di dalam hutan tropis dunia dapat tetap terjaga dengan baik sehingga emisi karbon akibat adanya deforestasi dapat berkurang. Bagi Indonesia, kesepakatan internasional para pihak tentang REDD+ tersebut harus dapat dipahami dan dioptimalkan dengan tepat. Pemerintah 3 Indonesia tidak boleh melihat skema REDD+ secara pragmatis saja yakni sebagai skema untuk mendapatkan kompensasi pendanaan dari negara maju atas partisipasi negara didalam kegiatan yang tercakup dalam REDD+. Lebih dari itu, secara substansional, pemerintah harus dapat melihat skema REDD+ sebagai salah satu bentuk metode keilmuan untuk pelestarian sisa sumberdaya hutan yang masih ada di negeri ini sehingga sumberdaya hutan tersebut mampu menjalankan fungsinya secara optimal dan berkesinambungan. Dengan demikian keterlibatan Indonesia di dalam melestarikan sisa sumberdaya hutan melalui pengurangan deforestasi dan degradasi hutan adalah keterlibatan secara aktif, profesional, dan bermartabat. Melalui mekanisme REDD+ tersebut, diharapkan sisa sumberdaya hutan yang masih ada di muka bumi mampu menjalankan fungsi konservasi secara menyeluruh, baik sebagai areal konservasi keanekaragaman hayati maupun sebagai areal konservasi biomassa karbon. Salah satu sisa sumberdaya hutan yang memiliki potensi sebagai kawasan konservasi keanekaragaman hayati dan konservasi biomassa karbon adalah kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat di Tapanuli Utara - Provinsi Sumatera Utara. Keberadaan P. merkusii strain Tapanuli yang merupakan jenis pohon daun jarum asli Tapanuli, menjadikan kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat sebagai kawasan yang bernilai konservasi tinggi. Adapun kondisi tegakan alam P. merkusii strain Tapanuli yang berdimensi besar (diameter mencapai > 120 cm, dan tinggi mencapai 40 m), menjadikan kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat sebagai kawasan hutan yang memiliki potensi tinggi sebagai kawasan konservasi biomassa karbon. Masyarakat mengenal P. merkusii strain Tapanuli dengan sebutan Tusam Tapanuli dan menamai kawasan hutan lindung tersebut dengan sebutan Dolok Tusam (Dolok dalam bahasa Batak artinya gunung, Tusam = Pinus). Ketersediaan data yang aktual dan akurat merupakan salah satu faktor penting agar upaya pelestarian P. merkusii strain Tapanuli dapat dilaksanakan secara optimal. Seiring dengan munculnya peluang mitigasi pemanasan global dan perubahan iklim global melalui pelestarian sumberdaya hutan maka data yang perlu disediakan tersebut sedikitnya meliputi tiga aspek yakni silvikultur, genetik, 4 dan biomassa karbon. Ketiga aspek inilah yang di dalam disertasi ini akan diulas lebih mendalam. Aspek silvikultur meliputi tutupan lahan, sifat kimia tanah, dan struktur tegakan. Aspek genetik mencakup struktur populasi dan keragaman genetik. Adapun aspek biomassa karbon menganalisis kandungan biomassa karbon berdasarkan persamaan allometrik yang dibentuk melalui metode destructive sampling. Melalui pembahasan ketiga aspek ini maka karakteristik tegakan alam P. merkusii strain Tapanuli yang tumbuh pada sebaran alaminya di Tapanuli – Sumatera Utara dapat tergambarkan dengan jelas, aktual, dan akurat. Tujuan Penelitian Tujuan penelitian ini adalah: 1. Menganalisis karakteristik tutupan lahan, sifat kimia tanah, dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2. Menganalisis struktur populasi dan keragaman genetik tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit. 3. Menganalisis kandungan biomassa karbon tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan persamaan allometrik yang disusun berdasarkan metode destructive sampling. Untuk mencapai ketiga tujuan di atas maka ada 3 sub-topik penelitian yang dilakukan sebagai berikut: 1. Analisis perubahan tutupan lahan, sifat kimiawi tanah, dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2. Analisis struktur populasi dan keragaman genetik tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit. 3. Analisis kandungan biomassa karbon tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan 5 menggunakan persamaan allometrik yang disusun berdasarkan metode destructive sampling. Manfaat Penelitian Manfaat penelitian ini adalah: 1. Memberikan data-data dasar (database) tentang struktur tegakan P. merkusii strain Tapanuli disertai kondisi biofisik dan kimiawi tanah, perubahan tutupan lahan serta proses regenerasi alamiah merupakan informasi penting yang diperlukan untuk perencanaan dan pelaksanaan pelestarian P. merkusii strain Tapanuli. 2. Status keragaman genetik dan struktur populasi alam P. merkusii strain Tapanuli merupakan informasi penting yang diperlukan untuk kegiatan pemuliaan dan pelestarian P. merkusii strain Tapanuli. 3. Hasil pendugaan kandungan karbon serta persamaan allometrik yang dapat digunakan sebagai salah satu metode praktis untuk pendugaan kandungan biomassa karbon P. merkusii strain Tapanuli dalam dalam rangka persiapan pelaksanaan program Reduction Emission from Deforestation and Forest Degradation in Indonesia (REDDI) di kawasan hutan lindung dan konservasi. Perumusan masalah Merujuk pada hasil-hasil penelitian terdahulu, dapat diketahui bahwa populasi alam P. merkusii strain Tapanuli merupakan salah satu strain P. merkusii yang saat ini sedang terancam kelestariannya. Rendahnya nilai Heterosigositas harapan (He = 0,206) pada populasi alam P. merkusii strain Tapanuli secara tidak langsung menunjukkan adanya gangguan terhadap populasi alam P. merkusii strain Tapanuli sehingga penyebaran dan luas daerah sebarannya semakin menyempit. Hal ini menjadikan populasi alam P. merkusii strain Tapanuli tersebut diisi oleh individu-individu pohon yang secara genetik seragam (Munawar 2002; Siregar & Hattemer 1999). Selain dari indikator genetik, peringatan bahwa populasi alam P. merkusii strain Tapanuli saat ini sedang terancam kelestariannya juga muncul dari The International Union for Conservation of Nature and Natural Resources (IUCN) yang memasukkan Pinus merkusii Junghn et de Vriese ke dalam kategori 6 Vulnerable dengan kode B1+2cde ver 2.3 dalam Red List of Threatened Species tahun 2012. Menurut IUCN (2012), kategori ini menunjukkan bahwa perkiraan luas areal yang ditumbuhi oleh P. merkusii saat ini tidak lebih dari 2000 Km2 atau jangkauan areal ditemukannya P. merkusii diperkirakan tidak lebih dari 20.000 Km2. Kondisi ini terjadi antara lain karena: 1). Kondisi habitat yang terfragmentasi, 2). Terjadinya penurunan kualitas tegakan secara terus menerus, yang antara lain disebabkan oleh menurunnya kualitas tempat tumbuh, menurunnya jumlah lokasi atau sub populasi, dan menurunnya jumlah pohon induk. Sehubungan dengan hal ini, maka upaya pelestarian populasi alam P. merkusii strain Tapanuli merupakan agenda mendesak yang perlu dilakukan dan didukung banyak pihak. Dalam upaya pelestarian populasi alam P. merkusii strain Tapanuli tersebut maka ada tiga hal menarik yang sekaligus menjadi pertanyaan dalam rumusan masalah penelitian ini, yakni: a. Ekosistem daratan Tapanuli hingga sekarang terus mengalami perubahan bentuk bentang alam akibat adanya perubahan tutupan lahan sebagai dampak dari perubahan penggunaan lahan yang dilakukan oleh manusia. Selain menyebabkan perubahan tutupan hutan, perubahan tutupan lahan yang terjadi pada ekosistem daratan Tapanuli juga akan mempengaruhi sifat kimia tanah dan struktur tegakan populasi alam P. merkusii strain Tapanuli. Atas dasar inilah maka perlu diketahui bagaimanakah karakter tutupan lahan, sifat kimia tanah, dan struktur tegakan alam P. merkusii strain tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. b. Saat ini ada tiga model penyebaran populasi alam P. merkusii strain Tapanuli yang dapat dijumpai di lapangan. Pertama, populasi alam P. merkusii strain Tapanuli yang tumbuh dan menyebar di dalam kawasan hutan lindung Dolok Tusam dengan kondisi tutupan lahan berupa hutan. Kedua, populasi alam P. merkusii strain Tapanuli yang tumbuh dan menyebar di areal perladangan dengan kondisi tutupan lahan terbuka. Ketiga, populasi alam P. merkusii strain Tapanuli yang tumbuh bersamaan dengan jenis pohon daun lebar dengan kondisi tutupan lahan tertutup. Bagaimanakah keragaman genetik dan 7 pola kekerabatan genetik diantara lima populasi alam P. merkusii strain Tapanuli yang tersebar di ekosistem daratan Tapanuli ? c. Populasi alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat terdiri atas tegakan alam dengan diameter besar sehingga kawasan hutan lindung tersebut memiliki potensi besar sebagai penyimpan biomassa karbon. Bagaimanakah model persamaan allometrik yang dapat digunakan untuk menduga kandungan biomassa karbon pada tegakan alam P. merkusii strain Tapanuli? Dan berapakah simpanan biomassa karbon pada lima lokasi yang menjadi sebaran alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara? Hipotesis Ada 3 hipotesis yang akan dijawab melalui penelitian ini, yakni: 1. Perubahan tutupan lahan pada ekosistem daratan Tapanuli akan menyebabkan terjadinya keragaman sifat kimia tanah dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2. Populasi alam P. merkusii strain Tapanuli yang tumbuh pada tapak tumbuh dengan kondisi tutupan lahan yang sama akan memiliki struktur genetik yang sama sehingga berada pada kelompok (cluster) yang sama. 3. Populasi alam P. merkusii strain Tapanuli yang secara genetik berada dalam satu kelompok yang sama akan memiliki kandungan biomassa karbon yang relatif sama juga. Nilai Kebaruan Ada 3 nilai kebaruan dalam penelitian ini, yaitu: 1. Mendapatkan faktor-faktor yang mempengaruhi sifat kimia tanah dan karakter struktur tegakan P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara 2. Diketahuinya nilai keragaman genetik dan pola pengelompokan diantara lima populasi alam P. merkusii strain Tapanuli yang tersebar di ekosistem daratan Tapanuli – Sumatera Utara 8 3. Terbentuknya model persamaan allometrik yang akurat dan praktis untuk pendugaan stok biomassa karbon pada populasi alami P. merkusii strain Tapanuli yang tersebar di Tapanuli – Sumatera Utara. Kerangka Pemikiran Sustainable Forest Management Reducing Emission from Deforestation and Forest Degradation + Perubahan Tutupan Lahan ekosistem daratan yang menjadi sebaran alam Pinus merkusii strain Tapanuli di Tapanuli - Sumut Aspek Silvikultur  Tutupan hutan  Sifat kimia tanah  Struktur tegakan Aspek Genetik Aspek Biomassa Karbon  Struktur populasi  Analisis keragaman genetik dengan menggunakan penanda molekuler mikrosatellite  Analisis cluster  Analisis model persamaan allometrik yang disusun dengan metode destructive sampling  Cadangan biomassa karbon pada populasi alami P. merkusii strain Tapanuli Database untuk konservasi P. merkusii strain Tapanuli Gambar 1 Kerangka penelitian “Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii Jungh et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara”. 9 TINJAUAN PUSTAKA Perkembangan Pengelolaan Hutan Lestari Permasalahan yang muncul di sekitar pengelolaan sumberdaya alam, termasuk di dalamnya sumberdaya hutan, akan senantiasa bergulir dan terus berkembang dari waktu ke waktu. Macam dan kualitas permasalahan ini akan semakin meningkat sejalan dengan perkembangan kebutuhan dan tuntutan manusia terhadap manfaat sumberdaya hutan sebagai akibat dari terus meningkatnya jumlah penduduk, kualitas hidup manusia serta kemajuan ilmu pengetahuan dan teknologi yang sangat pesat (Suhendang et al. 1996). Ketika manusia di muka bumi ini menjadikan kayu sebagai kebutuhan utama yang dapat terpenuhi dari hutan maka ketika itu pulalah kayu menjadi fokus utama tentang kelestarian pengelolaan sumberdaya hutan. Namun pada saat manusia di muka bumi ini sudah bisa merasakan bahwa oksigen, air, dan jasa lingkungan yang membuat hidup mereka nyaman tersebut harus dipenuhi dari hutan maka pada saat itu pula fokus kelestarian pengelolaan sumberdaya hutan pun berkembang. Selain mendapat tuntutan untuk memenuhi kebutuhan kayu, sumberdaya hutan juga dituntut untuk dapat memenuhi kebutuhan non kayu untuk kenyamanan kehidupan manusia. Pergeseran paradigma tentang pengelolaan hutan lestari tersebut juga dirasakan oleh International Tropical Timber Organization (ITTO) melalui beberapa kali revisinya tentang konsep Sustainable Forest Management (SFM). Pada awalnya di tahun 1990, ITTO mencanangkan konsep SFM yang berbasiskan kelestarian hasil kayu (Sustained yield and single-use management for timber). Namun dalam perkembangannya, ITTO menyempurnakan konsep SFM dengan memasukkan beberapa aspek selain kayu, antara lain: petunjuk dan pembentukan manajemen hutan tanaman tropis (ITTO, 1993), petunjuk tentang konservasi keanekaragaman hayati (ITTO 1993), petunjuk tentang pengelolaan api di hutan tropika (ITTO 1997), petunjuk untuk restorasi, pengelolaan, dan rehabilitasi untuk hutan tropika sekunder dan terdegradasi (ITTO 2002), petunjuk untuk konservasi dan keberlanjutan pemakaian keanekaragaman hayati di hutan produksi kayu tropis (ITTO 2009). Melalui serangkaian revisi tersebut pada tahun 2011, ITTO 10 mendefinisikan SFM secara umum sebagai suatu cara menggunakan sistem biologis yang tidak merugikan kapasitas mereka untuk memenuhi kebutuhan generasi mendatang. Keberlanjutan telah menjadi prioritas politik secara global, dan untuk hutan, pengelolaan hutan lestari telah berkembang menjadi alat penting. Sekilas Tentang REDD+ Sejak diputuskan pertama kali sebagai hasil resmi dari Converence of Parties (COP) ke 13 di Bali, istilah Reduction Emission from Deforestation and Forest Degradation (REDD) kini semakin sering didiskusikan oleh berbagai pihak dari beragam latar belakang pengetahuan. Hasil kesepakatan internasional itu pun kini juga menjadi pembicaraan tingkat nasional dan lokal. Bahkan cakupan pembahasannya bertambah sehingga istilah REDD kini berubah menjadi Reducing emissions from deforestation and forest degradation, and enhancing forest carbon stocks in developing countries (REDD+) (Angelsen 2009). Hasil rumusan para pihak di Bali mengatakan bahwa baik deforestasi maupun degradasi hutan merupakan sumber utama emisi dan bahwa dalam beberapa kasus degradasi hutan (misalnya tanah lahan gambut) dapat menimbulkan tingkat emisi yang tinggi. Disepakati bahwa diskusi dan kegiatan metodologi dalam Konvensi dengan demikian harus menangani kedua sumber itu bersama-sama, meskipun para pihak terus menyatakan besarnya kesulitan untuk mendefinisikan ‘degradasi’ hutan.’ Isu-isu ilmu pengetahuan dan hukum dengan definisi yang tepat dan dapat dipercaya mengenai hutan dan degradasi hutan juga merupakan hal yang sangat penting bagi masyarakat adat dan organisasi organisasi sosial. Secara khusus, definisi degradasi hutan dapat memberikan implikasi besar mengenai bagaimana kebijakan REDD berdampak pada hak dan kesejahteraan masyarakat adat dan komunitas lokal, dan bagaimana pemanfaatan hutan tradisional ditangani sesuai dengan sistem pemantauan dan verifikasi REDD nasional. Perluasan cakupan REDD menjadi REDD+ diputuskan dalam pertemuan SBSTA bulan Juni tahun 2009 di Bonn – Jerman. Keputusan tersebut ditetapkan dalam UNFCCC Decision 2/CP.13-11 yang antara lain berbunyi: .. policy approaches and positive incentives on issues relating to reducing emissions from 11 deforestation and forest degradation in developing countries; and the role of conservation, sustainable management of forests and enhancement of forest carbon stocks in developing countries. Sejak keputusan ini maka REDD+ menjadi istilah payung untuk aksi lokal, nasional maupun global dalam rangka penurunan emisi dari deforestasi dan degradasi hutan, dan peningkatan cadangan karbon hutan di negara berkembang. Simbol plus menandakan peningkatan cadangan karbon hutan, juga merujuk pada rehabilitasi dan regenerasi hutan, pengurangan degradasi, pengurangan emisi, peningkatan serapan karbon, pergerakan karbon, atau hanya sebatas penyerapan karbon dari atmosfer dan menyimpan di dalam pool karbon hutan (Angelsen 2009). Tinjauan Umum tentang Pinus merkusii Pinus merkusii merupakan jenis Pinus tropika alami dari Asia Tenggara, meliputi Myanmar, Thailand, Laos, Kamboja, Vietnam dan Indonesia. P. merkusii adalah satu-satunya jenis pinus yang tumbuh sampai di sebelah selatan garis khatulistiwa hingga 2o6’ LS (Cooling 1968; Soekotjo 1978). Sebaran alami P. merkusii di Indonesia berada pada 3 wilayah yang berbeda di Sumatera, yaitu Aceh, Tapanuli, dan Kerinci. Iklim di ketiga tempat ini termasuk tipe B menurut klasifikasi iklim Schmidt dan Fergusson, dengan curah hujan 1.2002.500 mm/tahun. Suhu udara maksimum bulanan 20-28oC, sedangkan suhu udara minimum 15-28oC (Fandeli 1977). Berdasarkan taksonominya, klasifikasi P. merkusii sebagai berikut: Divisi : Spermatophyta Sub division : Gymnospermae Kelas : Coniferae Ordo : Pinales Famili : Pinaceae Genus : Pinus Species : Pinus merkusii Jungh et de Vriese Menurut Dallimore dan Jackson (1948), P. merkusii Jungh et de Vriese sama dengan P. finlaysoniana Wallich, P. latteri Mason, P. merkiana Gordon dan P. 12 sumatrana Jungh. Cooling (1968) mengatakan bahwa tusam mempunyai toleransi yang luas terhadap iklim dan dapat tumbuh pada daerah-daerah yang mempunyai masa 6 bulan kering sampai ke daerah-daerah basah. Jenis pinus ini ditemukan dari dekat permukaan laut sampai kira-kira 1000 meter. Di Sumatera, tegakan alam bisa juga tumbuh antara 500 sampai 2000 meter dan mungkin lebih tinggi. Iklim dan tanah sangat bervariasi menurut lokasi. Di Sumatera, tanah pada umumnya berasal dari bahan volkanik dan iklimnya basah dengan musim kering yang pendek dan curah hujan 1500 sampai 2500 mm (Lamb & Cooling 1967). Pohon P. merkusii berbatang utama tunggal (monopodial), yaitu terdiri atas batang utama yang tinggi, lurus, dan meruncing ke atas. Cabang sekundernya kecil dan banyak sekali cabang yang tersusun melingkar (verticillate) yang nampak memencar luas. Batangnya tidak mempunyai saluran xylem (xylem), dan sebagai gantinya adalah trakeida (tracheid). Kayunya mempunyai saluran getah (Suhaendi 1988). Ekologi Lanskap Habitat Alami P. merkusii strain Tapanuli Ekologi lanskap merupakan suatu cabang ilmu yang relatif baru dan memiliki peranan penting sebagai dasar untuk pengelolaan suatu ekosistem secara optimal dan berkesinambungan. Arifin et al. (2009) menyatakan bahwa secara garis besar ekologi lanskap mempelajari dasar-dasar tentang struktur, fungsi, dan perubahan-perubahan serta aplikasinya, yaitu penggunaan dasar-dasar tersebut dalam formulasi dan pemecahan masalah-masalah. Struktur merupakan salah satu aspek ekologi yang mengkaji tentang hubungan spasial antara ekosistemekosistem yang berbeda atau kehadiran elemen-elemen lebih khusus, distribusi energi, material, dan spesies dalam hubungannya terhadap ukuran, bentuk, jumlah, jenis dan konfigurasi ekosistem. Adapun fungsi menunjukkan interaksi antara elemen spasial, yaitu aliran energi, material dan spesies dalam komponen ekosistem. Proses interaksi yang terjadi dari waktu ke waktu menyebabkan kondisi struktur dan fungsi mosaik ekologis di dalam suatu lanskap atau ekosistem mengalami perubahan-perubahan. Seiring dengan kemajuan ilmu pengetahuan, kini berbagai ilmuwan lintas kepakaran mulai memasukkan ekologi lanskap sebagai salah satu perangkat penting untuk pengelolaan sumberdaya hayati yang berkelanjutan di muka bumi 13 ini. Terkait dengan hal ini, berbagai data ekologis pada suatu ekosistem merupakan informasi penting untuk pengelolaan populasi alami suatu jenis tumbuhan atau satwa secara optimal dan berkelanjutan (Arifin & Nakagoshi 2011; Saroinsong et al. 2007). Populasi alami P. merkusii strain Tapanuli pertama kali ditemukan oleh Dr Junghuhn pada tahun 1841 di hutan alam Dolok Suanon – Tapanuli, Sumatera Utara. Sejak saat itu pemerintah kolonial Belanda segera mengukuhkan Suaka Alam Dolok Saut seluas 39 Ha di Tapanuli. Hutan alam Tusam di Tapanuli tersebar secara berkelompok dalam luasan yang tidak layak diusahakan serta bercampur dengan hutan alam lainnya di gunung-gunung. Bahkan di Dolok Tusam, jenis tusam tersebut banyak dicampur dengan kemenyan. Penduduk di sekitar hutan menanami areal hutan tusam dengan kemenyan tanpa merusak pohon yang ada (Harahap 2000a). Dolok Tusam yang merupakan salah satu ekosistem alami P. merkusii strain Tapanuli terletak di Kabupaten Tapanuli Utara – Provinsi Sumatera Utara. Dolok Tusam merupakan areal yang akan ditunjuk menjadi cagar alam berada di dekat Kampung Lobu Gala, dengan ketinggian 1200 – 1300 mdpl. Tanahnya termasuk satuan dari kompleks podsolik merah kuning, latosol, dan litosol, dengan bahan induk batuan beku endapan dan metamorf, termasuk fisiografi pegunungan patahan. Geologi termasuk efusiva liparit dan permo-karbon (Kemenhut 1984 b). Curah hujan sekitar 2088 mm per tahun dan digolongkan pada tipe curah hujan B menurut klasifikasi Schmidt dan Ferguson di Siborong-borong (Harahap 2000b). Pinus merkusii strain Tapanuli memiliki sifat morfologi yang relatif lebih bagus dibanding strain Aceh, antara lain batangnya lurus, percabangan ramping, bebas cabangnya tinggi, dan getahnya banyak. Karakteristik inilah yang menjadikan P. merkusii strain Tapanuli diminati oleh banyak pihak sehingga hal ini memicu dan memacu peningkatan permintaan kayu tusam Tapanuli dari waktu ke waktu. Hasil pengamatan empiris di pos kehutanan di Simarjarunjung Kabupaten Simalungun, setiap hari rata-rata 10 truk tronton dengan kapasitas 2025 m3 kayu tusam lewat. Truk-truk tersebut membawa kayu tusam dari Tapanuli Utara dan sekitarnya dengan tujuan industri pengolahan kayu di Pematang Siantar, Tebing Tinggi, dan Medan (Harahap & Aswandi 2008). Fenomena 14 pembalakan ini telah mengakibatkan terjadinya perubahan kondisi lanskap ekosistem alami P. merkusii strain Tapanuli. Karenanya, perlu segera diantisipasi agar kondisi lanskap ekologinya mengalami perbaikan sehingga dinamika pertumbuhan tegakan hutannya (khususnya P. merkusii strain Tapanuli) dapat kembali tumbuh dengan sehat dan normal. Perkembangan Penelitian tentang Keragaman Genetika Pinus merkusii Kegiatan penelitian tentang keragaman genetik P. merkusii di Indonesia sudah sejak lama dilakukan oleh Suhaendi (1988) yang memulai penelitian keragaman genetik secara konvensional. (1988) melakukan pendugaan Di dalam penelitiannya, Suhaendi parameter-parameter genetika-ekologi dari beberapa sifat kuantitatif dalam hutan tanaman P. merkusii Jungh et de Vriese strain Tapanuli dan strain Aceh. Hasil penelitian Suhaendi (1988) menunjukkan bahwa dari 12 sifat pohon yang diamati, diketahui ada 7 sifat pohon dalam setiap strain yang dikendalikan secara kuat oleh faktor genetik, yakni: diameter batang, bentuk batang, tebal kulit batang, produksi getah, berat jenis, diameter serat dan lebar lumen sel serat kayu. Pengendalian genetik yang kuat juga terdapat pada tinggi batang bebas cabang dalam strain Tapanuli, dan pada tinggi pohon total serta kadar selulosa kayu dalam strain Aceh. Penelitian dengan topik yang sama juga dilakukan oleh Harahap (2000b), yang melakukan penelitian tentang keragaman sifat dan data ekologi populasi alam P. merkusii di Aceh, Tapanuli, dan Kerinci. Hasil penelitian ini menunjukkan bahwa pada lokasi tempat tumbuh yang berbeda terdapat perbedaan sangat nyata pada beberapa sifat pohon berikut: panjang serat, tebal dinding serat, panjang daun, berat kering daun, panjang kerucut, dan tebal kulit. Perbedaan lokasi memberikan pengaruh nyata terhadap sifat berat jenis kayu. Adapun untuk sifat diameter lumen, diameter serat, jumlah biji, dan diameter kerucut, tidak berbeda nyata pada lokasi tempat tumbuh yang berbeda. Seiring dengan kemajuan teknologi biomolekuler, penelitian keragaman genetik dengan penanda morfologi seperti yang dilakukan Suhaendi (1988) dan Harahap (2000b) mulai beralih ke penanda biokimia. Salah satunya menggunakan isozim. Analisis isozim untuk mengetahui besarnya keragaman genetik Tusam telah dilakukan oleh Kartikawati (1996 dan 1998) dan Indrioko (1996). Hasil 15 penelitian tersebut menunjukkan bahwa dari 8 sistem enzim yang digunakan ternyata hanya 3 sistem enzim dengan 7 (tujuh) loci yang polimorfik untuk tusam yaitu Esterase (EST) dengan Est-1, Est-2, Est-3 loci; Glutamate Oxaloacetate Transaminase (GOT) dengan Got-1, Got-2 loci; dan Shikimate dehydrogenase (ShDH) dengan Shd-1 dan Shd-2 loci (Munawar 2002). Obyek penelitian Kartikawati (1996) dan Indrioko (1996) tersebut adalah hutan tanaman P. merkusii yang ada di Jawa. Hasil penelitiannya menunjukkan bahwa Tusam yang sudah berkembang luas di Jawa ternyata hanya berasal dari sebagian provenans yang ada di Aceh. Hasil penelitian Harahap (2000b) tentang keragaman sifat dan data ekologi populasi alami P. merkusii serta hasil uji asal benih P. merkusii di Sumatera Utara lebih mempertegas lagi bahwa tusam yang telah berkembang luas selama ini adalah berasal dari populasi Aceh. Adapun tusam yang berasal dari populasi Tapanuli dan Kerinci belum dibudidayakan dalam skala luas, antara lain disebabkan oleh keterbatasan ketersediaan benih. Kartikawati dan Na’im (1999) kembali melakukan uji keragaman genetik dengan menggunakan penanda isozim. Di dalam penelitiannya mereka menguji keragaman genetik dari tiga populasi P. merkusii yang berbeda yakni populasi alami P. merkusii dari hutan alam di Aceh, populasi P. merkusii dari hutan tanaman di Jawa, ( populasi P. merkusii dari kebun benih di Jember, Jawa Timur) . Ada 3 (tiga) sistem enzim yang digunakan dalam penelitian mereka yakni Esterase (EST), Glutamate Oxaloacetate Transaminase (GOT) dan Shikimate Dehydrogenase (ShDH). Hasil penelitian ini menunjukkan bahwa populasi alami Aceh memiliki keragaman genetik tertinggi (nilai He=0.304) dibanding populasi hutan tanaman (nilai He = 0.276) dan kebun benih (nilai He = 0.266). Analisis keragaman genetik P. merkusii dengan menggunakan penanda genetik isozym kembali dilakukan oleh Siregar dan Hattemer (1999). Penelitian ini menguji keragaman genetik dari dua populasi alam P. merkusii di Sumatera dan satu populasi hutan tanaman di Jawa. Sampel yang diuji keragaman genetiknya berupa biji. Ada delapan lokus isoenzym yang digunakan untuk penelitian ini yakni: GOT-B, GOT-C, GOT-D, PGM-A, PGM-B, SKDH-A, NDH-A, dam FHD-A. Hasil analisis penelitian ini menunjukkan bahwa nilai beberapa parameter genetik antara populasi alami P. merkusii Aceh dengan hutan 16 tanaman di Jawa relatif sama. Namun demikian, nilai beberapa parameter genetik hutan tanaman P. merkusii di Pulau Jawa lebih tinggi dibanding populasi alaminya di Aceh. Selain itu, hasil penelitian ini juga menujukkan bahwa nilai keragaman genetik P. merkusii yang ada di Indonesia lebih tinggi dibandingkan dengan P. merkusii yang ada di Thailand (Szmidt et al. 1996). Penelitian tentang analisis keragaman genetik dengan penanda genetik isozim juga dilakukan oleh Munawar (2002). Di dalam penelitiannya, Munawar (2002) melakukan studi keragaman genetik Tusam (P. merkusii Jungh. et de Vriese) di hutan alam Tapanuli dan Kerinci. Hasil penelitian tersebut menunjukkan bahwa provenansi Kerinci memiliki nilai Heterozigositas harapan (He) paling kecil (0.042) dibanding populasi alam Tapanuli (0.206), Aceh (0.304) dan Jawa (0.276). Keragaman genetik populasi alam Tapanuli lebih rendah dibanding poopulasi Aceh dan Jawa. Fenomena ini terjadi antara lain karena populasi alami P. merkusii di Kerinci sudah terpecah-pecah berupa kumpulan individu-individu dalam jumlah dan luasan yang sempit sehingga terjadi seleksi mundur (dysgenic selection) dan telah banyak terjadi kawin kerabat (inbreeding) (Munawar 2002). Penggunaan penanda genetik mikrosatelit untuk menganalisis keragaman genetik P. merkusii di Indonesia pertama kali dilakukan oleh Nurtjahjaningsih et al. (2005). Di dalam penelitiannya, Nurtjahjaningsih et al. (2005) mencoba mengembangkan penanda genetik mikrosatelit untuk mendapatkan informasi genetik dari kebun benih P. merkusii yang ada di Pulau Jawa. Hasil penelitian tersebut menunjukkan bahwa dari 10 primer yang dikembangkan dari P. merkusii, 5 diantaranya bersifat kodominan dan polimorfik. Jumlah alel per lokus berkisar antara 3 sampai 6 dan nilai heterosigositas harapan berkisar antara 0.389 sampai 0.728. Kelima penanda mikrosatelite tersebut dapat digunakan untuk analisis genetik populasi dan pola perkawinan. Tinjauan Tentang Mikrosatelit Mikrosatelit atau yang juga dikenal dengan Short Tandem Repeats (STRs) atau Variable Number of Tandem Repeats (VNTR) merupakan untaian basa nukleotida 1-6 pasang basa yang berulang dan tersebar di dalam genom, baik 17 genom inti maupun genom organel. Tipe pengulangan basa dari mono-, di-, tri-, tetra-, dan penta-nukleotida. Mikrosatelit genom organel terdiri mikrosatelit kloroplas (cpSSRs) dan mikrosatelit mitokondrion (mtSSRs) dengan tipe mononukleotida. Mikrosatelit yang berasal dari genom organel ini banyak digunakan untuk studi pewarisan karena sifat dari genom organel yang hanya diturunkan secara uniparental. Mikrosatelit telah banyak dipergunakan untuk meneliti berbagai tanaman dan ada sekitar 8000 konten penulisan jurnal tentang mikrosatelit (Zane et al. 2002). Mikrosatelit memiliki keunggulan dalam berbagai studi genetika karena pola pewarisan mengikuti hukum Mendel, tingkatan polimorfik tinggi, bersifat kodominan, keakuratan yang tinggi dan berlimpah di genom. Marka ini banyak digunakan untuk studi genetik populasi, ekologi, pemuliaan tanaman dan aliran gen (gene flow). Penanda mikrosatelit dipilih karena merupakan penanda kodominan yang mampu mengidentifikasi genotipe homozigot dan heterozigot dalam populasi, memiliki reproducibility yang tinggi, tingkat polimorfisme tinggi, multialelik, dan terdistribusi merata dalam genom (Karhu 2001 dan Weising et al. 2005 ). Pada pinus lain di daerah temperate penggunaan mikrosatelit telah umum digunakan, namun pada P.merkusii baru pada tahun 2005 dikembangkan (Nurtjahjaningsih et al.2005). Hasil penelitian menemukan sepuluh lokus yang mampu diisolasi dimana lima lokus bersifat polimorfik dan kodominan, dua lokus bersifat monomorfik, dua lokus bersifat multiband dan satu lokus tidak mampu mengamplifikasi. Selanjutnya Nurtjahjaningsih et al. (2005) merekomendasikan penggunaan lima primer (pm01, pm05,pm07, pm09a dan pm12) untuk deteksi mikrosatelit pada P. merkusii. Pendugaan Kandungan Biomassa Karbon Pinus merkusii strain Tapanuli Berbagai bentuk tekanan terhadap ekosistem hutan yang menjadi habitat alami populasi P. merkusii strain Tapanuli selain berpengaruh terhadap struktur genetik jenis P. merkusii juga berpengaruh terhadap kondisi pertumbuhan tegakannya. Biomassa merupakan salah satu parameter yang dapat digunakan untuk mengetahui besarnya kondisi pertumbuhan suatu jenis tumbuhan di dalam suatu ekosistem. Hal ini mengacu pada IPCC (2003) yang mengartikan biomassa 18 sebagai total berat atau volume organisme dalam suatu area atau volume tertentu. Pengertian ini diperkuat oleh Brown (1997), yang mendefinisikan biomassa sebagai total jumlah materi hidup di atas permukaan suatu pohon dan dinyatakan dengan satuan ton berat kering per satuan luas. Mengingat sebagian besar komponen biomassa tumbuhan terdiri atas karbon dan seiring dengan menguatnya upaya mitigasi perubahan iklim global maka istilah biomassa karbon kini menjadi lebih populer dibanding istilah biomassa. Pendugaan biomassa tegakan dan pohon telah diakui sebagai salah satu tahapan penting dalam rangka penilaian stok karbon hutan sesuai dengan Protokol Kyoto untuk pengurangan gas rumah kaca (Brown 2002; Korner 2005; Pili et al, 2006). Salah satu pendekatan untuk mengkuantifikasi simpanan biomassa karbon adalah melalui penelaahan terhadap perubahan-perubahan yang berasal dari plot inventarisasi hutan jangka panjang. Model regresi digunakan untuk mengkonversi data inventarisasi tersebut menjadi nilai dugaan biomassa bagian atas (above ground biomass) (Chave et al. 2005). Aplikasi persamaan allometrik yang dikombinasikan dengan data inventarisasi hutan merupakan suatu pendekatan yang cukup efektif untuk menghitung besarnya biomassa hutan dan simpanan karbon hutan pada suatu skala regional (Xiang et al. 2011). Pinus merkusii strain Tapanuli merupakan tusam yang memiliki morfologi dan beberapa sifat pohon lebih baik dibanding tusam Aceh yang selama ini telah banyak dibudidayakan. De Veer dan Govers (1953) ; Soerianegara dan Djamhuri (1979) diacu dalam Suhaendi (1988) dan Harahap (2000b) telah mencatat beberapa keunggulan sifat pohon tusam Tapanuli tersebut, yakni: bentuk batang lurus dan ramping, daun tebal dan berwarna hijau tua dan mengkilap, sistem percabangan: cabang-cabang lebih kecil, membentuk sudut lancip terhadap batang; ruas batang lebih panjang dan jaraknya lebih teratur, kulit batang tipis dan berwarna muda, beralur dangkal, umumnya licin; produksi getah lebih banyak. Beberapa keunggulan sifat pohon tersebut secara tidak langsung mengindikasikan bahwa pertumbuhan P. merkusii strain Tapanuli lebih unggul dibanding pertumbuhan P. merkusii strain Aceh sehingga jumlah biomassa karbonnya pun lebih besar. Saat ini belum ada penelitian yang secara khusus melakukan penghitungan biomassa karbon P. merkusii strain Tapanuli, serta mendapatkan 19 persamaan allometrik yang selanjutnya dapat digunakan untuk pendugaan kandungan biomassa karbonnya. Beberapa penelitian yang telah berhasil mendapatkan persamaan allometrik untuk pendugaan kandungan biomassa karbon dari P. merkusii dilakukan pada hutan tanaman di Jawa yang merupakan P. merkusii strain Aceh. Hasil penelitian Basuki et al. (2004) menunjukkan bahwa tegakan pinus umur 16 tahun dengan kerapatan 1200 pohon/ha dapat mengandung 126.8 C-organik/ha atau setara dengan penyerapan 464.9 ton CO2/ha. Persamaan allometrik untuk pendugaan kandungan biomassa karbon P. merkusii telah dihasilkan Siregar (2007) di Jawa Barat yakni: Y = 0.0936 X 2.4323 untuk biomasa Pinus merkusii di atas tanah Y = 0.0103 X 2.6036 untuk biomasa Pinus merkusii di bawah tanah Y = 0.1031X2.4587 untuk biomasa total Pinus merkusii Inisial X menunjukkan diameter batang Pinus merkusii yang diukur pada ketinggian 1,3 meter (setinggi dada orang dewasa). Ancaman Kelestarian Pinus merkusii Pinus merkusii strain Tapanuli merupakan satu dari tiga strain P. merkusii yang memiliki nilai ekonomi kayu relatif tinggi karena bentuk kayunya yang relatif lebih lurus, percabangan ramping, kulit batang tipis, dan getah lebih sedikit. Hal inilah yang menyebabkan jenis P. merkusii strain Tapanuli diburu oleh para penebang liar. Hasil pengamatan sepintas di pos kehutanan di Simarjarunjung Kabupaten Simalungun, setiap hari rata-rata 10 truk tronton dengan kapasitas 2025 m3 kayu tusam lewat. Truk-truk tersebut membawa kayu tusam dari Tapanuli Utara dan sekitarnya dengan tujuan industri pengolahan kayu di Pematang Siantar, Tebing Tinggi, dan Medan (Harahap & Aswandi 2008). Selain ancaman dari kegiatan penebangan, kelestarian P. merkusii juga mendapat ancaman dari faktor alami, seperti serangan hama, penyakit, atau kebakaran. Di Indonesia tanaman ini diserang oleh beberapa hama diantaranya adalah Melionia basalis (Geometridae, Lepidoptera), Eumeta variagatus (Psehidae, Lepidoptera), Dyorictria rubella (Pyralidae, Lepidoptera) dan juga Coptotermes traviens (Husaeni 1996). Resiko terhadap munculnya serangan hama, penyakit, atau kebakaran tersebut semakin meningkat seiring dengan terjadinya fenomena perubahan iklim global. Munculnya jenis hama baru akibat pengaruh perubahan iklim global tersebut ditengarai kuat telah terjadi di wilayah 20 ekosistem hutan tropis, seperti hama kutu lilin yang menyerang tegakan hutan tanaman Pinus (P. merkusii) di Pulau Jawa (Rahmatsyah & Haneda 2007). Permasalahan pelestarian Pinus merkusii Sedikitnya ada 2 permasalahan pelestarian P. merkusii yang sering dijumpai di lapangan yakni keterbatasaan ketersediaan anakan alami di lapangan dan masih terbatasnya teknologi perbenihan P. merkusii strain Tapanuli. Permudaan alami P. merkusii strain Tapanuli sulit didapatkan pada tegakan yang tertutup. Akan tetapi permudaan alami banyak ditemui pada daerah yang terbuka seperti pada bekas tanah longsor (Yafid et al. 2005). Sementara itu teknologi perbenihan P. merkusii strain Tapanuli dan Kerinci relatif belum berkembang dibandingkan P. merkusii strain Aceh yang telah diteliti hasil persilangan terkendali dan dibangun tegakan kebun benihnya (Harahap 2000c; Hendrati et al. 1997). Keterbatasan teknologi perbenihan tersebut kemungkinan besar terkait dengan adanya gejala ketidaksesuaian diri secara genetik (genetic self incompatibility akibat pengaruh dari pembentukan strobili jantan dan strobili betina pada waktu yang berbeda pada satu pohon yang sama (Burley 1976; Harahap & Mukti 1976). 21 METODOLOGI Waktu dan Tempat Penelitian Penelitian dilaksanakan selama sembilan bulan (Agustus 2011 – Mei 2012). Penelitian ini dilaksanakan di lima lokasi yang menjadi sebaran populasi alam P. merkusii strain Tapanuli, seperti pada Tabel 1. Adapun posisi lokasi penelitian di dalam peta Sumatera Utara disajikan pada Gambar 2. Tabel 1 Lokasi sebaran populasi alam P. merkusii strain Tapanuli Sebaran Populasi Kawasan hutan lindung Dolok Tusam Timur Areal perladangan milik penduduk Kawasan hutan lindung Dolok Tusam Barat Areal perladangan milik penduduk Hutan campuran di perbukitan Lokasi Kecamatan Garoga, Kabupaten Tapanuli Utara Desa Parinsoran, Kecamatan Garoga, Kabupaten. Tapanuli Utara Kecamatan Pangaribuan, Kabupaten Tapanuli Utara Kampung Lobugala, Desa Pansurnatolu, Kecamatan Pangaribuan, Kabupaten Tapanuli Utara Desa Tolang, Kecamatan Aek Bilah, Kabupaten Tapanuli Selatan Gambar 2 Posisi lokasi penelitian di wilayah Kecamatan Pangaribuan dan Kecamatan Garoga – Tapanuli Utara serta Kecamatan Aek Bilah – Kabupaten Tapanuli Selatan. 22 Kondisi Umum Lokasi Penelitian Kelima lokasi penelitian merupakan sebaran alam P. merkusii strain Tapanuli yang terletak di kawasan perbukitan dengan kondisi topografi berat dengan ketinggian tempat berkisar antara 800 – 1300 mdpl. Posisi geografis kelima lokasi yang diteliti berada diantara 99o07’00” – 99o27’00” Bujur Timur dan 1o47’00” – 2o07’00” Lintang Utara. Secara lebih terperinci informasi mengenai kondisi ekologis kelima lokasi sebaran alam P. merkusii strain Tapanuli yang diteliti disajikan pada Tabel 2. Tabel 2 Posisi geografis, ketinggian tempat, dan kelerengan lima lokasi sebaran alam P. merkusii strain Tapanuli pada ekosistem daratan Tapanuli yang diteliti No. LOKASI Koordinat geografis Ketinggian Lintang Utara Bujur Timur (mdpl) 1. DOLOK TUSAM TIMUR 2. PARINSORAN 01o59'29,8" 099o15'10,0" Kelerengan Klasifikasi 1096 25 - 45% atau lebih curam - sangat curam o o 1031 8-25% landai - agak curam o o 1269 15 - 45% atau lebih agak curam - sangat curam o o 02 00'41,2" 099 15'34,4" 3. DOLOK TUSAM BARAT Satuan 01 57'16,2" 099 15'50,1" 4. LOBUGALA 01 56'49,2" 099 14'39,4" 1175 8-25% landai - agak curam 5. TOLANG 01o54'30,3" 099o25'02,2" 1059 25 - 45% atau lebih curam - sangat curam Pada Tabel 2 dapat diketahui urutan lokasi sebaran alam P. merkusii strain Tapanuli dari yang tertinggi hingga yang terendah sebagai berikut: Dolok Tusam Barat, Lobugala, Dolok Tusam Timur, Tolang, dan Parinsoran. Adapun berdasarkan kondisi topografinya, sebagian besar lokasi sebaran alam P. merkusii strain Tapanuli berada pada lokasi dengan kelerengan agak curam hingga sangat curam. Hanya di Parinsoran dan Lobugala, populasi alam P. merkusii strain Tapanuli berada pada kelerangan landai hingga agak curam. Berdasarkan hitungan jarak datar yang diukur dari software Geographical Information System (GIS) dapat diketahui jarak datar antar lokasi penelitian (Tabel 3). Tabel 3 Jarak antar lokasi penelitian Lokasi Dolok Tusam timur Parinsoran Dolok Tusam Barat Lobugala Tolang Dolok Tusam timur ***** 2.3 4.2 5.1 20.5 Jarak datar (km) Parinsoran Dolok Tusam Barat Lobugala Tolang ***** 6.3 7.3 20.9 ***** 19.7 ***** ***** 2.3 17.5 23 Sub-topik Penelitian 1: Analisis Perubahan Tutupan Lahan, Sifat Kimiawi Tanah, dan Struktur Tegakan Populasi Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara Bahan dan Alat Bahan utama penelitian ini adalah citra Landsat 7 ETM+ (Enhanced Thematic Mapper) liputan tahun 1994, 2005, dan 2011 dan peta Rupa Bumi Indonesia (RBI) provinsi Sumatera Utara. Bahan lain berupa bahan tulis menulis dan beberapa software yang terkait, yakni: software ERDAS Imagine dan ArcView GIS. Adapun peralatan yang diperlukan untuk penelitian ini adalah: komputer, kompas, GPS, ring tanah untuk pengambilan contoh tanah, kamera digital, tally sheet. Metode 1. Analisis tutupan lahan pada ekosistem hutan Tapanuli – Sumatera Utara Perubahan tutupan lahan dianalisis dengan menggunakan pengolahan citra satelit (Image Processing) elit dan analisa spasial. Sumber data untuk menganalisis perubahan tutupan lahan yaitu citra Landsat tahun 1994, 2005, dan 2011. Jenis citra yang digunakan adalah citra Landsat 7 ETM+ (seri 7 Enhanced Thematic Mapper Plus) yang memiliki resolusi menengah (1 pixel = 30 x 30 m) dengan daerah liputan cukup luas bila dibandingkan dengan citra SPOT-5 dan Quickbird. Klasifikasi penutupan lahan secara digital dilakukan dengan menggunakan metode maximum likelihood classification (MLC). Tahapan pengolahan data citra dan analisis perubahan tutupan lahan adalah sebagai berikut : a. Persiapan Citra Satelit dibuat dalam format image (img) dan dibuat dalam bentuk Citra Komposit (layer stack) dengan kombinasi Band 542. Band 542 umum digunakan untuk klasifikasi lahan untuk penentuan tutupan lahan dan penggunanaan lahan karena menggambarkan perbedaan lahan bervegetasi dan non vegetasi dengan lebih jelas. 24 b. Cropping Area Citra Satelit dipotong (cropping) sesuai dengan batas area yang akan diklasifikasi melalui metode Subset Image. c. Klasifikasi Citra Klasifikasi citra menggunakan gabungan tiga metode yaitu Unsupervised Classification, Supervised Classification (Maximum Likelihood) (Richards 1986), dan Visual Interpretation. Tiga metode tersebut lebih menghasilkan hasil klasifikasi citra yang mendekati kondisi lapangan atau hasil groundcheck. Pada kelas penggunaan lahan yang sulit dipisahkan berdasarkan karakteristik pixel-nya dilakukan deliniasi manual sesuai metode interpretasi visual (penafsiran visual). Kelebihan dari teknik interpretasi visual ini dibandingkan dengan interpretasi otomatis adalah dasar interpretasi tidak semata-mata kepada nilai kecerahan, tetapi konteks keruangan pada daerah yang dikaji juga ikut dipertimbangkan (Lillesand & Kiefer 1990). Dalam interpretasi manual ini peranan interpreter dalam mengontrol hasil klasifikasi menjadi sangat dominan, sehingga hasil klasifikasi yang diperoleh relatif lebih masuk akal. d. Mengidentifikasi dan analisis obyek atau tipe vegetasi dari dengan menggunakan informasi spasial seperti ukuran, bentuk, tekstur, pola, bayangan asosiasi dan situs sesuai dengan konteks keruangan. Hasil identifikasi dan analisis obyek akan menentukan klasifikasi penutupan lahan yang terbagi menjadi lima kelas. e. Konversi Format Raster ke Vektor Proses ini untuk memudahkan dalam analisis spasial menggunakan Geographic Information System (GIS) f. Membuat antar waktu tampilan visual peta perubahan tutupan lahan analisis spasial pada masing-masing lokasi atau plot penelitian (5 lokasi). Selanjutnya untuk mendapatkan luas perubahan tutupan lahan dibuat matrik perubahan tutupan lahan antar waktu (1994, 2005dan 2011). 25 2. Analisis sifat kimia tanah dan struktur tegakan pada tapak tumbuh Pinus merkusii strain Tapanuli Kondisi tapak tumbuh dianalisis melalui analisis sifat kimia tanah pada lima lokasi sebaran alam P. merkusii strain Tapanuli. Contoh tanah diambil dari 4 lapisan kedalaman tanah yakni: 0-5 cm, 5-10 cm, 10- 20 cm, 20-30 cm pada setiap kluster plot penelitian dengan menggunakan ring tanah. Plot pengamatan untuk analisis struktur tegakan berbentuk kluster plot yang penempatannya menggunakan metode purposive sampling. Setiap lokasi diwakili oleh 1 kluster plot yang terdiri atas 4 sub plot berbentuk lingkaran dengan luas masing-masing sub plot 0.1 ha sehingga luas per kluster plot adalah 0.4 ha. Kluster plot yang berbentuk lingkaran ini dipilih dengan pertimbangan kemudahan dan kepraktisan penggunaannya di lapangan. Penggunaan kluster plot ini diturunkan dari metode Forest Health Monitoring (FHM) yang membagi habis permukaan bumi dengan bentuk heksagon. Setiap heksagon memiliki luas 2400 hektar sehingga intensitas sampling untuk setiap kluster plot adalah 0.016 % (Mangold 1997) seperti disajikan pada Gambar 3. Parameter yang diamati adalah diameter dan tinggi tegakan P. merkusii strain Tapanuli. Gambar 3 Bentuk Permanen Sampel Plot (PSP) mengacu pada metode Forest Health Monitoring (FHM) (Mangold 1997). 26 Setiap kluster plot terdiri atas 4 annular-plot dan 4 sub-plot. Annular-plot dan sub-plot nomor 1 berada di pusat, sedang annular-plot dan sub-plot lainnya berada pada azimuth tertentu dari annular-plot dan sub-plot nomor 1. Posisi annular-plot dan sub-plot nomor 2 berada pada azimuth 360o dari posisi annularplot dan sub-plot nomor 1. Posisi annular-plot dan sub-plot nomor 3 berada pada azimuth 120o dari posisi annular-plot dan sub-plot nomor 1. Posisi annular-plot dan sub-plot nomor 4 berada pada azimuth 240o dari posisi annular-plot dan subplot nomor 1. Antara titik pusat annular plot 1 dengan titik pusat annular plot yang lain berjarak 36.6 m. Setiap annular-plot memiliki luas 0.1 ha sehingga luas dalam 1 kluster plot adalah 0.4 m. Adapun total luas lingkaran kluster (di dalam dan di luar plot) menjadi 1 ha. Di dalam setiap sub-plot terdapat mikroplot dengan radius 2.07 m pada jarak 3.66 m dan azimuth 90o dari titik pusat sub-plot. Sub-topik Penelitian 2: Analisis Genetik Populasi Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara dengan Menggunakan Penanda Molekuler Mikrosatelit Bahan dan alat Bahan yang digunakan dalam penelitian ini adalah daun tanaman Pinus merkusii strain Tapanuli. Untuk proses ekstraksi, bahan kimia yang digunakan adalah buffer ekstrak, PVP 2%, Chloroform IAA, phenol, isopropanol dingin, NaCl, Etanol 95%, buffer TE, aquabidest, H2O, primer mikrosatelit, Qiagen Taq polymerase, agarose, buffer TAE 1x, blue juice 10x, marker, Etidium bromida. Acrilamide, APS, Temed, Formalin, NaOH, NH4OH, Asetat 1%, Amonia, AgNO3. Sedangkan alat yang digunakan adalah sarung tangan karet, gunting, tube 1.5 ml, tube 0.2 ml spidol permanen, mortar, pestel, pipet mikro, tips, rak tube, vortex, mesin sentrifugasi, waterbath, freezer, timbangan analitik, desikator, mesin PCR, bak elektroforesis, cetakan agar, microwave, gelas ukur, ultraviolet transilluminator, alat foto DNA. 27 Metode 1. Pengambilan Sampel Unit sampel untuk analisis genetik ini adalah populasi. Di dalam penelitian ini ada 5 populasi alam P. merkusii strain Tapanuli yang menyebar pada lokasi yang berbeda tetapi masih di dalam ekosistem hutan Tapanuli. Informasi kelima lokasi sebaran disajikan pada Tabel 1. Jumlah pohon yang dijadikan sampel untuk setiap lokasi populasi alam diupayakan mencapai 24-30 individu pohon, sedangkan sampel yang diambil untuk analisis genetika ini berupa daun. Prosedur pengambilan sampel di lapangan adalah sebagai berikut: a. Daun diambil dari setiap individu pohon sebanyak 2 – 5 pucuk daun. b. Daun tersebut selanjutnya dimasukkan ke dalam plastik klips yang berisi silika gel. c. Dalam satu lokasi diharapkan dapat dijumpai 24 - 30 d. Setiap pohon yang daunnya diambil diukur tinggi, diameter dan letak geografisnya dengan menggunakan alat ukur e. Jarak antar pohon sampel dalam satu populasi minimal 30 meter f. Data mengenai tinggi, diameter dan letak geografis, serta pemetaan pohon induk maupun anakan dicatat kedalam lembar data (datasheet). 2. Ekstraksi DNA Metode yang digunakan untuk ekstraksi DNA ini adalah metode CTAB (Cetyl Trimethyl Ammonium Bromide) yang telah dimodifikasi. Daun dipotong dengan ukuran 2 X 2 cm, kemudian digerus dengan menambahkan nitrogen cair di dalam pestel/mortar yang bersih. Hasil gerusan kemudian dimasukkan ke dalam tabung mikro 2 ml dan ditambahkan larutan buffer ekstrak sebanyak 500 – 700 µl. Agar daun hasil gerusan tercampur dengan larutan penyangga dan PVP 2% secara merata maka tabung yang berisi hasil gerusan tersebut di vortex. Setelah itu diinkubasi dalam dalam water bath selama 45 menit – 1 jam sambil dibolak-balik setiap 15 menit. Suhu optimal yang digunakan dalam proses inkubasi berkisar antara 65-700C. Apabila proses inkubasi melebihi suhu optimal maka DNA yang ada dalam tube akan rusak. Setelah proses inkubasi, tabung mikro tersebut diangkat dan didinginkan selama 15 menit kemudian ditambahkan kloroform sebanyak 500 µl dan fenol 28 sebanyak 10 µl, lalu sentrifugasi pada kecepatan 13000 rpm selama 2 menit. Hasil sentrifugasi (supernatan) akan terpisah menjadi dua fase yaitu bagian atas merupakan fase air yang berisi asam nukleat dan bagian bawah yaitu fase organik yang berisi pelarut organik. Fase air menggunakan pipet mikro dipisahkan dari fase organik dengan lalu dipindahkan kedalam tabung mikro baru. Kemudian ditambahkan chloroform 500 µl dan fenol 10 µl sebanyak dua kali secara berulang yang bertujuan untuk memperoleh DNA yang memiliki tingkat kemurnian tinggi. Supernatan yang telah terpisah dari fase organik, ditambahkan isoproponal dingin sebanyak 500 µl dan NaCl atau NaOAc sebanyak 500 µl dan 300 µl. Campuran ini disimpan dalam freezer selama 45 menit – 1 jam. Hasil pengendapan tersebut disentrifuge pada kecepatan 13000 rpm selama 2 menit kemudian cairan dalam tabung mikro dibuang. Hasil pengendapan akan berupa pelet DNA. Pelet DNA ini kemudian ditambahkan etanol 100% sebanyak 300 µl dan disentrifuge selama 2 menit pada kecepatan 13000 rpm, kemudian cairan etanol tersebut dibuang. Setelah itu pelet DNA yang tersisa dalam tabung mikro dikeringkan dalam desikator dengan posisi terbalik selama 10 menit lalu ditambahkan larutan TE sebanyak 20 µl difortex kemudian disimpan didalam freezer. Selama proses pengeringan pelet DNA, disiapkan agarose 1% (0.33 gram agarose dalam 33 ml TAE). Untuk proses elektroforesis, diambil 3 µl DNA ditambahkan 2 µl blue juice 10 X dan kemudian di running pada tegangan 100 selama ± 30 menit. DNA akan bergerak kearah positif (anoda). Hasil elektroforesis kemudian direndam dalam larutan etidium Bromide (ETBR) 10 µl per 200 ml aquades selama 3 – 5 menit dan selanjutnya dilihat pada UV transiluminator. 3. Seleksi Primer Primer adalah rantai pendek DNA yang dihasilkan secara buatan biasanya antara 10 – 25 nukleotida. Primer berfungsi sebagai titik mula terjadinya sintesis oleh enzim yang disebut DNA polymerase yang diperoleh dari bakteri Thermus aquaticus. Enzim ini biasa disebut juga Taq DNA polymerase. Enzim ini sesuai untuk proses amplifikasi karena dapat bertahan pada suhu tinggi hingga 950C 29 meskipun suhu optimum bagi aktifitas enzim adalah 720C. Setelah terjadi annealing selanjutnya dilakukan perbanyakan fragmen DNA melalui proses ekstensi pada suhu 720C. Seleksi primer dimaksudkan untuk mencari primer acak yang menghasilkan penanda polimorfik, karena tidak semua primer nukleotida dapat menghasilkan produk amplifikasi (primer positif) dan dari primer positif tidak semuanya menghasilkan fragmen DNA polimorfik. Proses penyeleksian primer yang digunakan dalam metoda mikrosatellite mengikuti primer yang pernah diuji oleh Nurtjahjaningsih et al. (2005), karena belum ada penelitian pendahuluan terhadap jenis P. merkusii alami yang dapat mengamplifikasi DNA tanaman ini. Dalam penelitian ini digunakan 7 primer yang dipilih dari hasil temuan mikrosatelit pada P. merkusii di hutan tanaman (Nurtjahjaningsih et al. 2005). Informasi tentang ketujuh primer mikrosatelit tersebut tersaji pada Tabel 4. Tabel 4 Karakteristik primer mikrosatelit dari Pinus merkusii di hutan tanaman, di Pulau Jawa (Nurtjahjaningsih et al. 2005) No Lokus Ukuran Produk (bp) Suhu annealing (oC) Motif Pengulangan Sekuen primer (5'-3') Nomor Akses ke Bank Gen 1. pm01 111-117 56 (TG)12 F: AGAGAAGGCACGATTTTGTC R: TCCCACTAATCACTTTGAAAG AB201535 2. pm04 92 56 (TG)10 F: CTCTAAGTAGGACAAGGCCT R: CATAATCCAAGGAGTCAAGG AB201536 3. pm05 112-118 52 (TG)9 F: GAGTCTAATTGCAAACCCCA R: TGGAGATCTACCACTTTTTC AB201537 4. pm07 284-309 52 (AC)8 (AT)4 F: GAATCTAAGCATATGAAATGAG R: CTTGTTAATGCTACTAGTTATG AB201538 5. pm08 132 59 (AT)2 (GT)11 F: GCTTCAATCTATTGACCCCAT R: TAAAGGGGCAGCTGCTACAACCAATGG AB201539 6. pm09a 81-99 52 (AT)5 (GT)18(AT)2 F: CCTTCTCATTTCGATATGCAC R: ATTAAAGGTTATATGGGGCT AB201540 7. pm12 181-193 59 (GT)5 CT(GT)5(AT)5 F: GAACAATCATTGCGGGTCCCG R: TATGCTGCGTTTATATGTATAAGTGTC AB201541 4. PCR (Polymerase Chain Reaction) Proses PCR membutuhkan 4 komponen utama yaitu H2O, HotStar Mix, primer dan DNA. DNA hasil proses ektraksi sebelum dilakukan proses amplifikasi PCR harus dilakukan pengenceran dengan menggunakan aquabidest. Besarnya perbandingan antara DNA dengan aquabidest tergantung dari tebal dan tipisnya DNA hasil ekstraksi. Untuk proses PCR, DNA 1.5 µl dicampurkan dengan HotStar Mix 7.5 µl, Nuclease-free water 2.5 µl dan primer 1.5 µl) disentrifugasi selama 5-10 detik 30 kemudian dimasukkan kedalam mesin PCR. Tahapan serta suhu PCR seperti disajikan dalam Tabel 5. Tabel 5 Tahapan dalam proses PCR Metode Mikrosatelit Tahapan Suhu (0C) Waktu (menit) 95 95 53 72 72 2 1 2 2 5 Pre- Denaturation Denaturation Annealing Extention Final Extention Jumlah siklus 1 35 1 Pengujian polimorfisme dilakukan dengan melihat pita hasil PCR yang divisualisasi berdasarkan hasil elektroforesis. Hasil pengujian ini dikatakan polimorfisme jika pola pita yang dihasilkan mempunyai sekurang-kurangnya lebih dari satu variasi, sedang hasil pengujian dikatakan monomorfik jika tidak memperlihatkan adanya variasi pada pola pita hasil elektroforesis. 5. Analisis Data Hasil PCR yang telah dielektroforesis difoto dan dianalisis dengan melakukan skoring pita yang muncul. Pada metode RAPD pola pita yang muncul diterjemahkan kedalam data biner berdasarkan ada atau tidak adanya pita, sedangkan untuk data mikrosatelit dihitung berdasarkan banyaknya alel yang ditemukan sesuai panjang basa. Hasil perhitungan pita-pita DNA tersebut kemudian dianalisis untuk mengetahui keragaman dalam populasi maupun antar populasi. Parameter keragaman genetik yang dihitung dalam penelitian ini adalah (Finkelday 2005) : a. Persentase Lokus Polimorfik (PLP) Suatu lokus gen dikatakan polimorfik jika sekurang-kurangnya ada dua varian yang berbeda (alel). Sedang untuk monomorfik tidak memperlihatkan variasi genetik. Persentase lokus polimorfik dihitung dengan rumus; Persentase Lokus Polimorfik (PLP) =  ( LP) X 100%  ( LP)   ( LM ) dimana Σ (LP) ; jumlah lokus polimorfik Σ(LM) ; jumlah lokus monomorfik b. Jumlah alel yang teramati (na) =  Alel  Lokus 31 c. Jumlah alel yang efektif (ne) = 1  pi 2 i dimana, pi2 ; frekuensi genetik tipe ke i d. Heterozigositas harapan (He) = 1 –  pi 2 i dimana ; pi2 = frekuensi genetik tipe ke i ( HT  HS ) e. Diferensiasi genetik (Gst) = HT dimana; HT = keragaman populasi total, HS = keragaman populasi tunggal Parameter keragaman genetik yang diukur seperti jumlah alel yang diamati (na), jumlah alel yang efektif (ne), jumlah lokus polimorfik, persen lokus polimorfik (PLP) dan heterozigitas harapan (He), diolah dengan software Pop Gene 1.32. Jarak genetika antara populasi dihitung menggunakan koefisien Dice dan pembuatan dendogram menggunakan unweighted pair-group method arithmetic (UPGMA) berdasarkan jarak genetik Nei dengan perangkat lunak numerikcal taxonomy and multivariate system (NTSYS) versi 1.80. Sub-topik Penelitian 3: Analisis Kandungan Biomassa Karbon Tegakan Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli –Sumatera Utara Bahan dan Alat Bahan utama yang diperlukan untuk penelitian ini adalah tegakan populasi alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam – Tapanuli Utara – Sumatera Utara. Bahan lain yang dibutuhkan untuk penelitian ini adalah tally sheet, tali plastik, dan bahan-bahan yang dibutuhkan untuk kegiatan survey vegetasi di lapangan. Adapun alat-alat yang diperlukan untuk penelitian pada ini meliputi peralatan survey (GPS, kompas, meteran, haga hypsometer, phy band, kamera digital), bor kayu, peralatan untuk pencatatan data (pensil, pulpen, alas tulis, penghapus), dan peralatan untuk analisis data (komputer, kalkulator, beberapa software). 32 Metode Penyusunan model persamaan alometrik untuk pendugaan kandungan biomassa karbon pada populasi alam P. merkusii strain Tapanuli ini menggunakan metode destructive sampling (pembongkaran dan pengukuran biomassa sampel), yang urutan tahapannya sebagai berikut: 1. Pemilihan lokasi penelitian Lokasi penelitian untuk pendugaan kandungan biomassa karbon P. merkusii strain Tapanuli dipusatkan di dalam kawasan hutan lindung Dolok Tusam – Tapanuli Utara. Kegiatan pembuatan plot inventory untuk pendataan struktur tegakan P. merkusii strain Tapanuli yang akan diduga kandungan biomassa karbonnya dilakukan di dalam dan di luar kawasan hutan lindung Dolok Tusam – Tapanuli Utara. Adapun untuk kegiatan destructive sampling dilakukan di luar kawasan hutan lindung Dolok Tusam – Tapanuli Utara. 2. Penilaian struktur tegakan populasi alam P. merkusii strain Tapanuli Penilaian struktur tegakan ini bertujuan untuk mengetahui struktur kelas diameter pohon P. merkusii strain Tapanuli yang tersebar di dalam populasi alaminya tersebut. Data tentang struktur kelas diameter ini penting untuk menentukan jumlah dan lokasi pohon yang akan dijadikan sebagai sampel yang akan dibongkar dan diukur dalam metode destructive sampling. 3. Pelaksanaan destructive sampling Destructive sampling merupakan metode pengukuran kandungan biomassa pohon dengan cara memanen dan mengukur kandungan biomassa pada semua bagian pohonnya, meliputi bagian atas tanah dan bagian bawah tanah. Penyusunan persamaan allometrik dilakukan dengan metode destructive sampling pada 36 pohon sampel (rentang diameter 13-82 cm) dan metode volumetrik pada 8 pohon sampel (diameter 75.0 cm, 79.5 cm, 86.0 cm, 95.0 cm, 104.0 cm, 110.9 cm, 115.5 cm, 120.6 cm). Sebaran kelas diameter pohon sampel ini ditentukan dengan mengacu pada sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam – Tapanuli. Metode destructive sampling mengacu pada metode yang dikembangkan oleh Japan International Forestry Promotion & Cooperation Center (JIFPRO 2000), Siregar 33 (2007) dan Siregar (2011) yang secara umum tahapan kegiatannya sebagai berikut: a. Penentuan pohon P. merkusii strain Tapanuli yang dipilih sebagai sampel, b. Sebelum ditebang, terlebih dahulu diukur diameter batang dan tinggi total batangnya, c. Penebangan sampel pohon P. merkusii strain Tapanuli terpilih, d. Pemisahan dan penimbangan berat segar dari setiap bagian pohon (batang, cabang, ranting, daun, buah, dan akar. e. Pembagian bagian batang sampel pohon P. merkusii strain Tapanuli yang telah ditebang menjadi beberapa sortimen, f. Pengukuran berat segar dari setiap sortimen batang yang ditebang tersebut, g. Pengambilan sampel kayu dari setiap bagian pohon P. merkusii strain Tapanuli yang telah ditebang tersebut sebanyak 250 gram, h. Mengeringkan sampel daun, ranting, dan buah dengan menggunakan oven pada suhu 85oC selama 2 hari. i. Mengeringkan sampel batang dan cabang dengan menggunakan oven pada suhu 85oC selama 4 hari. j. Penghitungan berat kering total (JIFPRO 2000): BKT = (BKS x BST)/ BSS, dengan keterangan: BKT: Berat Kering Total (Kg), BKS: Berart Kering Sampel (gram), BST: Berat Segar Total (Kg), BSS: Berat Segar Sampel (gram), k. Menyusun persamaan allometrik P. merkusii strain Tapanuli dengan menggunakan bantuan software Microsoft Office Excel (2007), dan software statistik (JMP) serta formula persamaan allometrik lokal sebagai berikut: Y = a(DBH)b; Y= a(DBH x Tinggi Total)b; Y= a(DBHxKerapatan jenis kayu)b; Y=a(DBHxTinggi TotalxKerapatan jenis kayu)b, Keterangan: Y= biomassa (Kg), DBH= Diameter setinggi dada (cm), a dan b = nilai koefisien persamaan; l. Uji perbandingan persamaan allometrik hasil penelitian ini dengan persamaan allometrik lain yang sudah ada, m. Pemilihan model terbaik persamaan allometrik berdasarkan nilai parameter statistik berikut: Koefisien Determinasi (R2), Koefisien Determinasi yang 34 disesuaikan (R2 adjusted), nilai Root Mean Square Error (RMSE) dan pengujian keberartian model regresi. Model yang dipih adalah model dengan nilai RMSE terkecil, R2 dan R2 Adjusted yang terbesar dan pengujian keberartian persamaan regresi. Persamaan allometrik yang terpilih selanjutnya dibandingkan dengan persamaan allometrik yang sudah ada. 35 HASIL DAN PEMBAHASAN Sub-topik Penelitian 1 Analisis Perubahan Tutupan Lahan, Sifat Kimia Tanah, dan Struktur Tegakan Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara Hasil Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli Tutupan lahan (land cover) secara garis besar diartikan sebagai tutupan kondisi biofisik dari permukaan bumi (FAO 2005). Berdasarkan hasil analisis citra landsat 7 ETM+ tahun 1994, 2005, dan 2011, diketahui ada lima bentuk tutupan lahan di sekitar lokasi penelitian yakni 1). Hutan, 2). Ilalang-semak, 3). Kebun, 4). Ladang, dan 5). Padi-ladang. Sebaran dari kelima bentuk tutupan lahan yang ada di setiap lokasi penelitian pada tiga waktu yang berbeda yakni 1994, 2005, dan 2011 disajikan pada Gambar 4. Kelima bentuk tutupan lahan inilah yang selanjutnya dianalisis komposisinya, kecenderungan perubahannya, dan hubungannya dengan sifat kimia tanah dan kondisi struktur tegakannya. Adapun peta perubahan tutupan lahan di lima lokasi penelitian yang dihasilkan dari analisis citra landsat 7 ETM+ tahun 1994, 2005, dan 2011 disajikan pada Gambar 5. Persentase luas antar kelas tutupan lahan di lima lokasi penelitian pada tiga tahun yang berbeda disajikan pada Gambar 6, sedangkan data luas setiap tipe tutupan lahannya disajikan pada Lampiran 1. Dari lima lokasi penelitian, hanya Lobugala yang memiliki luas hutan yang terkecil yakni kurang dari 300 ha baik pada tahun 1994, tahun 2005 maupun tahun 2011. Di Lobugala, tutupan lahan terbesar berupa padi-ladang dengan luasan sebesar 1169 ha di tahun 1994, 1097 ha di tahun 2005 dan 1.135 ha di tahun 2011. Luasan padi-ladang mencapai sekitar 50% pada tiga tahun yang berbeda yaitu 49.68 % - 51.15% (Gambar 5). Pada empat lokasi selain di Lobugala yaitu Parinsoran, Dolok Tusam Timur, Dolok Tusam Barat dan Tolang, hutan menempati area terluas diantara kelas tutupan lahan lainnya. Luasan hutan dari tahun ke tahun relatif stabil di keempat lokasi tersebut. Dalam periode waktu antara tahun 1994, 2005 dan 2011, luas 36 hutan pada empat lokasi penelitian semuanya berkurang namun tidak terlalu nyata. Seperti di Parinsoran, luas hutan pada tahun 1994 sebesar 2020 ha kemudian berkurang menjadi 2011 ha pada tahun 2005 dan di tahun 2011 berkurang lagi menjadi 2004 ha. 2.500,00 1994 2005 2011 Luas (ha) 2.000,00 1.500,00 1.000,00 500,00 0,00 A Tutupan Lahan Gambar 4 Perubahan Tutupan Lahan di lima lokasi penelitian (Keterangan : A = Dolok Tusam Timur, B = Parinsoran, C = Lobugala, D = Dolok Tusam Barat, E = Tolang) pada tahun 1994,2005, 2011. 37 1994 2005 2011 DTT PAR DTB LOB TOL = Hutan Gambar 5 = Ilalang-semak = Kebun = Ladang = Padi-ladang Sebaran spasial tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994. 2005, dan 2011. (Keterangan: DTT=Dolok Tusam Timur, PAR=Parinsoran, DTB=Dolok Tusam Barat, LOB=Lobugala, TOL=Tolang). 38 1994 2005 4,24% 3,72% 2,38% 1,63% 2,38% 3,76% 1,23% 4,21% 2011 3,52% 2,27% 4,55% 1,94% DTT 88,02% 88,42% 87,71% PAR 31,23% 33,29% 40,52% 40,52% 11,73% 10,19% 11,11% 0,59% 1,59% 7,18% 6,48% 6,24% 8,23% DTB 39,83% 8,99% 13,86% 16,47% 32,89% 4,95% 9,13% 10,55% 5,08% 5,15% 7,89% 5,39% 8,72% 5,55% 72,27% 12,67% LOB 72,11% 72,27% 12,85% 12,85% 6,51% 5,56% 8,79% 11,03% 51,15% 48,02% 49,68% 18,63% 5,66% 4,51% 8,82% 9,39% 9,06% 14,67% 12,78% 13,84% 0,68% 0,99% 1,94% 71,60% 71,80% = Hutan Gambar 6 20,07% 18,58% 4,03% TOL 11,84% 11,74% = Ilalang-semak = Kebun = Ladang 70,22% = Padi-ladang Komposisi tutupan lahan pada lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994. 2005, dan 2011. (Keterangan: DTT=Dolok Tusam Timur, PAR=Parinsoran, DTB=Dolok Tusam Barat, LOB=Lobugala, TOL=Tolang). 39 Berdasarkan Gambar 6, komposisi penutupan lahan di lima lokasi penelitian nampak beragam. Ada tiga lokasi penelitian yang lebih dari 50% tutupan lahannya berupa hutan, yakni Dolok Tusam Timur, Dolok Tusam Barat, dan Tolang. Adapun 2 lokasi yang lain yaitu Parinsoran dan Lobugala, tutupan lahannya didominasi non-hutan meliputi kebun, padi-ladang, dan ladang. Lahan yang ditutupi oleh ilalang-semak juga ditemukan di semua lokasi penelitian dengan persentase komposisi yang berbeda. Secara berturutan persentase tutupan lahan ilalang-semak di tahun 2011 yaitu Dolok Tusam Barat (8.72%), Parinsoran (7.18%), Lobugala (5.56%), Tolang (1.94%), dan Dolok Tusam Timur (1.94%). Penurunan persentase tutupan hutan paling tinggi terjadi di perbukitan hutan campuran di Desa Tolang – Kec. Aek Bilah – Kabupaten Tapanuli Selatan, yakni sebesar 1.58% kemudian disusul Dolok Tusam Timur (turun 0.71%), Parinsoran (turun 0.69%), dan Dolok Tusam Barat (turun 0.16%). Adapun tutupan hutan di lokasi Lobugala meningkat sebesar 0.18% atau 4.14 ha. Hampir di semua lokasi penelitian ditemukan adanya peningkatan luas tutupan lahan berupa ilalang-semak selama kurun waktu 1994 hingga 2011. Hanya di lokasi Lobugala yang ditemukan adanya penurunan luas tutupan ilalangsemak yakni sebesar 0.95%. Adapun peningkatan luas tutupan ilalang-semak di empat lokasi yang lain sebagai berikut: Parinsoran (5.59%), Dolok Tusam Barat (3.33%), Tolang (1.26%), dan Dolok Tusam Timur (0.71%). Berdasarkan komposisi tutupan lahan seperti pada Gambar 6, dari tahun 1994 hingga 2011 secara keseluruhan ditemukan bahwa hampir di semua lokasi penelitian terjadi penurunan persentase luas tutupan lahan hutan yang tidak terlalu besar yaitu berkisar dari 0.16% - 1.58%. Perubahan tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli Perubahan tutupan lahan pada lokasi penelitian terjadi secara fluktuatif selama kurun waktu 1994, 2005, dan 2011. Secara lebih rinci perubahan tutupan lahan di lokasi penelitian sebagai berikut: a. Dolok Tusam Timur Di Dolok Tusam Timur, selama rentang waktu 1994-2011 telah terjadi penurunan luas tutupan hutan dengan laju 0.96 ha/tahun, tutupan lahan ladang 40 menurun dengan laju 0.32 ha/tahun, dan tutupan lahan berupa kebun menurun dengan laju 0.14 ha/tahun. Sebaliknya tutupan lahan ilalang-semak bertambah luas dengan laju 0.96 ha/tahun dan tutupan lahan padi-ladang juga meningkat dengan laju 0.46 ha/tahun. Berdasarkan laju perubahan tutupan lahan ini, ternyata laju peningkatan luas tutupan padi-ladang sebesar 0.46 ha/tahun sama dengan laju penurunan tutupan ladang sebesar 0.32 ha/tahun ditambah dengan laju penurunan luas tutupan untuk kebun sebesar 0.14 ha/tahun. Hal ini menunjukkan adanya pergeseran pola penggunaan lahan dari ladang dan kebun ke padi-ladang di areal sebaran P. merkusii strain Tapanuli di Dolok Tusam Timur selama kurun waktu 1994 hingga 2011. Selain itu, laju penurunan luas tutupan hutan ternyata sama dengan laju peningkatan luas tutupan lahan ilalang-semak yakni 0.96 ha/tahun. Hal ini menunjukkan bahwa perubahan lahan menjadi ilalang-semak merupakan salah satu bentuk gangguan terhadap kawasan hutan lindung Dolok Tusam Timur. Secara tidak langsung kondisi ini juga menunjukkan bahwa kegiatan pengelolaan lahan untuk kebun, ladang, dan padi-ladang selama 17 tahun di Dolok Tusam Timur tidak merubah tutupan hutan. b. Parinsoran Di Parinsoran, secara umum dapat diketahui bahwa pada tahun 2011 tutupan hutan dan ladang mengalami penurunan luas masing-masing sebesar 1.72% dan 45.39% dibanding pada tahun 1994. Adapun tutupan kebun dan padi-ladang serta tutupan ilalang-semak pada tahun 2011 mengalami penambahan luas masing-masing sebesar 8.99%, 5.31% dan 352.76%. Selama periode 1994-2011, tutupan hutan berkurang dengan laju 0.4 ha/tahun dan tutupan ladang mengalami penurunan dengan laju 10.04 ha/tahun. Adapun tutupan padi-ladang mengalami peningkatan luas dengan rata-rata laju 2.23 ha/tahun dan tutupan lahan kebun juga mengalami peningkatan luas dengan laju 1.23 ha/tahun. Selain itu, pada periode 1994-2011 ditemukan juga tutupan ilalang–semak dengan laju 7.52 ha/tahun. Hasil analisis perubahan pola tutupan lahan yang terjadi di lokasi Parinsoran antara tahun 1994, 2005, dan 2011, secara umum dapat diketahui bahwa lahan yang berubah menjadi ilalang-semak ditemukan pada areal perladangan dan hutan di tahun 2011. Laju pertambahan lahan yang menjadi ilalang-semak sebesar 7.52 41 ha/tahun diperkirakan berasal dari alih fungsi hutan ke non hutan dengan laju 0.94 ha/tahun dan adanya areal perladangan yang tidak dikelola lagi dengan laju 6.58 ha/tahun. Penambahan luas areal padi-ladang dengan laju 2.23 ha/tahun dan kebun dengan laju 1.23 ha/tahun diperkirakan juga berasal dari alih fungsi ladang. Hal ini terjadi kemungkinan terkait dengan peningkatan kebutuhan masyarakat terhadap pangan dan hasil kebun. c. Dolok Tusam Barat Di Dolok Tusam Barat, secara garis besar dapat diketahui bahwa tutupan hutan, kebun, dan padi-ladang di seputar kawasan hutan lindung Dolok Tusam Barat mengalami penurunan luas. Adapun tutupan lahan berupa ladang dan ilalang-semak mengalami peningkatan luas. Selama 17 tahun (1994-2011) tutupan hutan menurun dengan laju 0.21 ha/tahun, tutupan kebun juga menurun dengan laju 3.76 ha/tahun. Selain itu, tutupan padi-ladang juga mengalami penurunan luas dengan laju 1.72 ha/tahun. Sebaliknya, tutupan ilalang-semak mengalami peningkatan luas dengan laju 4.48 ha/tahun dan tutupan ladang juga mengalami peningkatan luas dengan laju 1.2 ha/tahun. Berdasarkan laju perubahan tutupan lahan ini, maka secara garis besar dapat diketahui pergeseran tutupan hutan yang terjadi di Dolok Tusam Barat antara 1994 hingga 2011 terdiri atas 3 pola yakni: kebun menjadi ladang, padi-ladang menjadi ladang, dan padi-ladang menjadi ilalang-semak. Pola pergeseran tutupan lahan ini secara umum terjadi pada areal budidaya pertanian yang berada di luar kawasan hutan lindung Dolok Tusam Barat. d. Lobugala Berdasarkan hasil analisis citra landsat 7 ETM+ seperti disajikan pada Gambar 5, dapat diketahui bahwa tutupan padi-ladang (warna biru muda) lebih mendominasi dibanding tutupan untuk kebun (hijau muda) dan ladang (coklat muda). Berdasarkan data perubahan luas tutupan lahan seperti tercantum pada Lampiran 1, secara umum dapat diketahui bahwa selama periode 1994 hingga 2011 terjadi perubahan pola tutupan lahan dari padi-ladang ke ladang dan kebun. Hal ini nampak dari adanya pola kecenderungan meningkatnya tutupan ladang dan kebun, sementara di sisi lain tutupan padi-ladang cenderung menurun. Demikian juga tutupan ilalang-semak pun ikut menurun. Selama periode 1994- 42 2011, tutupan ladang dan kebun masing-masing meningkat dengan laju 1.94 ha/tahun dan 1.08 ha/tahun. Adapun tutupan padi-ladang dan tutupan ilalangsemak masing-masing turun dengan laju 1.98 ha/tahun dan 1.28 ha/tahun. Mencermati pola tutupan lahan yang tercermin dari perubahan warna pada Gambar 5, secara umum dapat diketahui ada beberapa pola perubahan tutupan lahan yakni a). dari tutupan ilalang-semak menjadi padi-ladang, b). dari kebun menjadi ilalang-semak terus menjadi ladang, c). dari lahan ladang menjadi kebun, d). dari lahan padi-ladang menjadi ladang, dan e). dari padi-ladang menjadi ilalang-semak. Beragamnya pola perubahan tutupan lahan dan banyaknya jumlah patch dalam peta tutupan lahan secara tidak langsung menunjukkan bahwa lokasi Lobugala merupakan areal sebaran P. merkusii strain Tapanuli yang terdiri atas beberapa sub ekosistem. e. Tolang Berdasarkan perubahan warna pada Gambar 6, secara garis besar dapat diketahui beberapa pola perubahan tutupan lahan yang terjadi di lokasi Tolang – Kec. Aek Bilah – Tapanuli Selatan, sebagai berikut: a). Dari hutan menjadi lahan ilalang-semak, b). Dari hutan menjadi padi-ladang, c). Dari hutan menjadi ladang, d). Dari ladang menjadi ilalang-semak, dan d). Dari kebun menjadi padi-ladang. Selanjutnya berdasarkan data perubahan tutupan lahan yang terjadi di lokasi Tolang antara tahun 1994 hingga 2011 dapat diketahui bahwa ada 2 bentuk tutupan lahan yang mendapat tekanan, yaitu tutupan kebun dan hutan. Kuatnya tekanan inilah yang menjadikan tutupan kebun dan tutupan hutan mengalami penurunan luas pada periode 1994 - 2011 masing-masing dengan laju 2.53 ha/tahun dan 2.12 ha/tahun. Berdasarkan data luas tutupan lahan di desa Tolang seperti tercantum pada Lampiran 1, dapat diketahui bahwa jumlah patch untuk setiap bentuk tutupan lahan sebagian besar mengalami peningkatan antara tahun 1994, 2005, dan 2011. Banyaknya jumlah patch tersebut secara tidak langsung menggambarkan tingkat fragmentasi lahan yang terjadi pada sebaran alam P. merkusii strain Tapanuli di areal perbukitan Tolang. Mengacu pada data di Gambar 5 dan Lampiran 1 dapat diketahui juga adanya 3 bentuk tutupan lahan yang mengalami peningkatan luas selama periode 43 1994 – 2011, yaitu: a). Tutupan padi-ladang mengalami peningkatan luas sebesar 37,25 ha (40.44%), dengan laju peningkatan luas sebesar 2.19 ha/tahun, b). Tutupan ladang mengalami peningkatan luas sebesar 13.17 ha atau 6.54% , dengan laju peningkatan luas 0.77 ha/tahun, c). Tutupan ilalang-semak mengalami peningkatan luas sebanyak 28.69 ha dengan laju peningkatan sebesar 1.69 ha/tahun. Karakteristik kimiawi tapak tumbuh P. merkusii strain Tapanuli Tapak tumbuh merupakan salah satu faktor yang ikut mempengaruhi keberhasilan pertumbuhan suatu jenis pohon pada suatu tempat. Analisis terhadap sifat kimia tanah merupakan salah satu cara untuk menilai kualitas tapak tumbuh. Beberapa sifat kimia tanah yang dianalisis untuk penilaian kualitas kelima tapak tumbuh populasi alam P. merkusii strain Tapanuli sebagai berikut: pH tanah, persentase C organik, persentase N, C-N rasio, P potensial, K potensial, P tersedia, K tersedia, Kation-kation yang dapat dipertukarkan, Kapasitas Tukar Kation, dan Kejenuhan Basa. a. pH tanah Nilai pH tanah adalah sifat kimia tanah yang menunjukkan besarnya kandungan ion H+ di dalam tanah dan berguna sebagai indikator tingkat kemasaman atau alkalinitas tanah. Semakin tinggi kandungan ion H+ di dalam tanah maka semakin kecil nilai pH nya dan semakin masam tanah tersebut. Nilai pH tanah ditentukan berdasarkan kandungan ion H+ dan OH- yang memiliki hubungan berbanding terbalik (Pritchett 1979; Tan 1994). Hasil analisis pH tanah pada kelima tapak tumbuh P. merkusii strain Tapanuli yang diteliti ditampilkan pada Tabel 6. Berdasarkan data pada Tabel 6, dapat diketahui bahwa semua tapak tumbuh populasi alam P. merkusii strain Tapanuli berada pada kategori masam hingga sangat masam. 44 Tabel 6 No 1 2 3 4 5 Nilai pH tanah pada kelima tapak tumbuh P. merkusii strain Tapanuli di Tapanuli - Sumatera Utara. Kedalaman tanah (cm) 0 - 05 Dolok Tusam Timur 05-10 10-20 20-30 Rata-rata 0 - 05 Parinsoran 05-10 10-20 20-30 Rata-rata 0 - 05 Dolok Tusam Barat 05-10 10-20 20-30 Rata-rata 0 - 05 Lobugala 05-10 10-20 20-30 Rata-rata 0 - 05 Tolang 05-10 10-20 20-30 Rata-rata Lokasi pH H2 O 3.9 4.3 4.5 4.5 4.3 Kriteria sangat masam sangat masam masam masam sangat masam 4.8 4.7 4.7 4.4 masam masam masam sangat masam 4.7 masam 4.3 4.6 4.7 5.0 sangat masam masam masam masam 4.7 masam 5.0 5.0 4.8 4.8 masam masam masam masam 4.9 masam 4.4 4.4 4.5 4.6 sangat masam sangat masam masam masam 4.5 masam b. Persentase C organik, Persentase N, dan C-N rasio Persentase C organik adalah sifat kimia tanah yang menunjukkan besarnya bahan organik yang terkandung di dalam tanah. Kandungan bahan organik penting untuk diketahui karena menjadi salah satu faktor yang menentukan kesuburan tanah. Melalui proses dekomposisi bahan organik, berbagai unsur hara 45 yang diperlukan untuk pertumbuhan tanaman dapat tersedia di dalam tanah (Foth 1999). Hasil analisis % C organik, % N, dan C/N pada lima tapak P. merkusii strain Tapanuli yang tumbuh di kawasan Tapanuli – Sumatera Utara disajikan pada Tabel 7. Berdasarkan data pada Tabel 6 dapat diketahui bahwa sebagian besar lokasi penelitian memiliki persentase C organik tinggi. Hanya ada satu lokasi yang persentase C organiknya rendah yakni Parinsoran. Tabel 7 Persentase C organik, % N, dan C/N pada lima tapak tumbuh P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara Kedalaman tanah No Lokasi %C Kriteria %N Kriteria C/N Kriteria 0 - 05 5.6 sangat tinggi 0.4 sedang 14.0 sedang 05-10 3.3 tinggi 0.2 rendah 15.0 sedang 10-20 2.0 sedang 0.2 rendah 13.0 sedang (cm) 1 2 3 4 5 Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 20-30 0.6 sangat rendah 0.1 rendah 12.0 Rata-rata 2.9 sedang 0.2 rendah 13.5 sedang 0 - 05 2.1 sedang 0.2 rendah 10.1 rendah 05-10 1.7 rendah 0.1 rendah 13.2 sedang 10-20 2.2 sedang 0.2 rendah 10.3 rendah sedang 20-30 1.0 rendah 0.1 rendah 10.4 Rata-rata 1.8 rendah 0.2 rendah 11.0 rendah 0 - 05 5.8 sangat tinggi 0.3 sedang 19.3 tinggi 05-10 3.5 tinggi 0.3 sedang 13.9 sedang 10-20 2.8 sedang 0.2 rendah 12.0 sedang sedang 20-30 2.0 rendah 0.2 rendah 9.6 rendah Rata-rata 3.5 tinggi 0.2 rendah 13.7 sedang 0 - 05 7.4 sangat tinggi 0.4 sedang 16.7 tinggi 05-10 6.3 sangat tinggi 0.5 sedang 11.9 sedang 10-20 3.7 tinggi 0.3 sedang 10.9 rendah 20-30 1.9 rendah 0.2 rendah 11.3 Rata-rata 4.8 tinggi 0.4 sedang 12.7 sedang 0 - 05 4.8 tinggi 0.3 sedang 14.7 sedang 05-10 4.4 tinggi 0.3 sedang 14.1 sedang 10-20 2.8 sedang 0.2 rendah 14.9 sedang 20-30 1.4 rendah 0.1 rendah 10.8 rendah Rata-rata 3.4 tinggi 0.2 rendah 13.6 sedang sedang Persentase N merupakan sifat kimia tanah yang menunjukkan ketersediaan unsur N di dalam tanah. Adapun C-N rasio menggambarkan kesetimbangan hubungan antara unsur C dan N di dalam tanah. Proses dekomposisi bahan 46 organik di dalam tanah dapat dilihat dari nilai C-N rasionya. Semakin tinggi nilai C-N rasio tanah maka bahan organik yang ada di dalam tanah tersebut semakin lama terdekomposisi. Sebaliknya semakin rendah nilai C-N rasio tanah maka proses dekomposisi bahan organik tersebut semakin cepat (Foth 1999). Mengacu data pada Tabel 6, dapat diketahui bahwa rata-rata persentase N untuk semua lokasi penelitian termasuk kategori sedang. Adapun untuk nisbah C/N, hasil analisis menunjukkan bahwa rata-rata nisbah C/N di semua lokasi masuk dalam kriteria sedang. Selanjutnya berdasarkan nilai kandungan % C organik tersebut, maka dapat diketahui stok karbon tanah di lima lokasi penelitian seperti disajikan pada Tabel 8. Rata-rata stok karbon dari kelima lokasi penelitian berkisar antara 46.1 ton C/ha (Parinsoran) sampai dengan 89.0 ton C/ha (Lobugala). Tabel 8 Stok karbon tanah pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli yang tersebar di Kabupaten Tapanuli Utara dan Kabupaten Tapanuli Selatan – Sumatera Utara No Lokasi Kedalaman (cm) pH %C %N C/N KTK Bulk Density (gram/cm3) Stok Karbon (Ton C /ha) 1. Dolok Tusam Timur 0-5 3.90 5.61 0.41 14.00 11.00 0.570 16.0 5-10 10-20 20-30 4.30 4.50 4.50 3.34 1.95 0.58 0.23 0.15 0.05 15.00 13.00 12.00 2.66 2.14 2.23 0.794 0.966 1.259 rata-rata 4.30 2.87 0.21 13.50 4.50 0.897 0-5 5-10 10-20 20-30 4.80 4.70 4.70 4.40 2.12 1.72 2.16 1.04 0.21 0.13 0.21 0.10 10.00 13.00 10.00 10.00 6.84 2.64 2.24 2.78 0.737 0.815 0.964 1.005 rata-rata 4.70 1.76 0.16 11.00 3.60 0.880 13.3 18.8 7.30 55,40 (kumulatif) 7.8 7.0 20.8 10.4 46,10 (kumulatif) 0-5 4.30 5.79 0.30 19.00 2.35 0.516 14.9 5-10 10-20 20-30 4.60 4.70 5.00 3.48 2.76 2.02 0.25 0.23 0.21 14.00 12.00 10.00 2.16 1.55 1.05 0.733 0.793 0.804 rata-rata 4.70 3.51 0.25 13.71 1.80 0.712 0-5 5-10 10-20 20-30 5.00 5.00 4.80 4.80 7.36 6.29 3.72 1.92 0.44 0.53 0.34 0.17 17.00 12.00 11.00 11.00 7.28 5.25 2.84 2.31 0.608 0.655 0.779 0.888 rata-rata 4.90 4.82 0.37 12.71 4.40 0.732 0-5 5-10 10-20 20-30 4.40 4.40 4.50 4.60 4.84 4.38 2.84 1.41 0.33 0.31 0.19 0.13 15.00 14.00 15.00 11.00 4.88 4.14 2.27 2.65 0.741 0.797 0.787 0.947 rata-rata 4.50 3.37 0.24 13.65 3.50 0.818 12.8 21.9 16.3 65,80 (kumulatif) 22.4 20.6 29.0 17.0 89,00 (kumulatif) 17.9 17.5 22.3 13.4 71,10 (kumulatif) 2. Parinsoran 3. Dolok Tusam Barat 4. 5. Lobugala Tolang 47 c. P-potensial P-potensial adalah jumlah total unsur hara P di dalam tanah yang tidak semua kandungannya dapat diserap oleh akar tanaman. Dalam proses biogeokimia tanah, kandungan P-potensial dalam tanah merupakan substrat yang akan digunakan dalam proses mineralisasi sehingga unsur hara P dapat tersedia bagi akar tanaman. Semakin besar kandungan P-potensial dalam tanah maka semakin besar peluang kandungan P-tersedia dalam tanah tersebut (Foth 1999). Tabel 9 menyajikan kandungan P-potensial di lima lokasi penelitian. Tabel 9 Kandungan P-potensial pada tapak tumbuh di lima lokasi sebaran alam P. merkusii strain Tapanuli – Sumatera Utara No 1 2 3 4 5 Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Kedalaman tanah (cm) 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata P2O5 (mg/100g) Kriteria 18.0 13.0 13.0 9.0 rendah rendah rendah sangat rendah 13.3 6.0 4.0 2.0 1.0 rendah sangat rendah sangat rendah sangat rendah sangat rendah 3.3 11.0 9.0 8.0 9.0 sangat rendah rendah sangat rendah sangat rendah sangat rendah 9.3 10.0 8.0 5.0 3.0 sangat rendah rendah sangat rendah sangat rendah sangat rendah 6.5 14.0 13.0 11.0 10.0 sangat rendah rendah rendah rendah rendah 12.0 rendah 48 Hasil analisis sifat kimia tanah menunjukkan bahwa kandungan P-potensial di kelima lokasi yang diteliti termasuk ke dalam kategori rendah dan sangat rendah. Kandungan P-potensial tertinggi ditemukan pada lokasi Dolok Tusam Timur. Secara lebih rinci, kandungan P-potensial di lima lokasi yang diteliti disajikan pada Tabel 9. Kandungan P-potensial di semua lokasi penelitian cenderung mengalami penurunan seiring dengan peningkatan kedalaman tanah. Semakin dalam tanah, kandungan P-potensial akan semakin sedikit. d. K-potensial Kalium (K) termasuk salah satu unsur hara makro yang penting bagi pertumbuhan tanaman, antara lain sebagai pengaktif dari sejumlah besar enzim yang penting untuk proses fotosintesis dan respirasi (Salisbury & Ross 1995). Kalium ditemukan dalam jumlah banyak di dalam tanah, tetapi hanya sebagian kecil yang dapat digunakan oleh tanaman, yaitu yang larut di dalam air atau yang dapat dipertukarkan (dalam koloid tanah). Kalium dalam bentuk yang tidak tersedia bagi tanaman (K-potensial) terdapat dalam mineral-mineral primer tanah seperti Feldspars dan Micas (Foth 1999). Dalam proses biogeokimia, kandungan K-potensial mencerminkan jumlah total unsur hara K dalam tanah yang dapat dimineralisasi menjadi unsur hara K tersedia sehingga akar tanaman dapat menyerapnya. Semakin besar kandungan K-potensial dalam tanah maka peluang kandungan unsur hara K tersedia juga semakin besar. Berdasarkan hasil analisis sifat kimia tanah seperti disajikan pada Tabel 10, dapat diketahui bahwa ada 2 lokasi sebaran alam P. merkusii strain Tapanuli yang memiliki kandungan K-potensial tinggi yakni Dolok Tusam Timur dan Parinsoran. Adapun kandungan K-potensial di Dolok Tusam Barat dan Lobugala masing-masing termasuk ke dalam kategori sedang. Kandungan K-potensial terendah ditemukan di lokasi Tolang. 49 Tabel 10 Kandungan K-potensial pada tapak tumbuh di lima lokasi sebaran alam P. merkusii strain Tapanuli – Sumatera Utara No 1 2 3 4 5 Kedalaman tanah (cm) 0 - 05 Dolok Tusam Timur 05-10 10-20 20-30 Rata-rata 0 - 05 Parinsoran 05-10 10-20 20-30 Rata-rata 0 - 05 Dolok Tusam Barat 05-10 10-20 20-30 Rata-rata 0 - 05 Lobugala 05-10 10-20 20-30 Rata-rata 0 - 05 Tolang 05-10 10-20 20-30 Rata-rata Lokasi K2O (mg/100 g) Kriteria 57.0 47.0 50.0 76.0 tinggi tinggi tinggi sangat tinggi 57.5 tinggi 50.0 40.0 37.0 44.0 tinggi sedang sedang tinggi 42.8 tinggi 31.0 27.0 28.0 31.0 sedang sedang sedang sedang 29.3 sedang 35.0 26.0 25.0 28.0 sedang sedang sedang sedang 28.5 sedang 14.0 12.0 10.0 6.0 rendah rendah rendah sangat rendah 10.5 rendah e. P-tersedia Phospor merupakan unsur hara esensial yang sering menjadi unsur pembatas dalam pertumbuhan tanaman karena rendahnya larutan P di dalam tanah yang dapat langsung diserap oleh akar tanaman (Foth 1999). Oleh karena itu, kandungan unsur hara P dalam bentuk yang tersedia bagi tanaman merupakan salah satu faktor yang menentukan tingkat kesuburan tanah pada suatu areal tanam. Kandungan P-tersedia hasil analisis tanah pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli disajikan pada Tabel 11. Kandungan 50 rata-rata P-tersedia di lima lokasi penelitian berkisar antara sedang sampai sangat rendah. Tabel 11 Kandungan P-tersedia pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara No 1 2 3 4 5 Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Kedalaman tanah (cm) Bray 1 P2O5 (ppm) Kriteria 0 - 05 21.1 sangat tinggi 05-10 13.1 tinggi 10-20 5.5 rendah 20-30 2.8 sangat rendah Rata-rata 10.6 sedang 0 - 05 6.4 rendah 05-10 5.9 rendah 10-20 3.2 sangat rendah 20-30 1.8 sangat rendah Rata-rata 4.3 sangat rendah 0 - 05 8.5 sedang 05-10 3.4 sangat rendah 10-20 3.2 sangat rendah 20-30 2.7 sangat rendah Rata-rata 4.5 sangat rendah 0 - 05 4.9 rendah 05-10 4.2 rendah 10-20 3.0 sangat rendah 20-30 2.6 sangat rendah Rata-rata 3.7 sangat rendah 0 - 05 7.2 rendah 05-10 6.7 rendah 10-20 4.6 rendah 20-30 5.2 rendah Rata-rata 5.9 rendah f. K-tersedia Kalium (K) merupakan salah satu unsur hara esensial yang konsentrasinya di dalam jaringan tanaman pada umumnya berkisar antara 1 sampai 5%. Tanaman menyerap kalium dalam bentuk ion K+. Kalium di dalam tanah ditemukan dalam beberapa bentuk, antara lain: feldspar orthoclase dan microcline [KalSi3O8], muscovite [KAl3Si3O10(OH)2], biotite [K(MgFe)3AlSi3O10(OH)2], dan phlogopite 51 [KMg2Al2Si3O10(OH)2], akan tetapi hanya sebagian kecil saja yang tersedia bagi akar tanaman (Tisdale et al. 1985). Sumber K-tersedia bagi tanaman berasal dari K yang dapat dipertukarkan (diikat oleh koloid liat atau humus) dan K dalam larutan (bentuk ion K+) (Foth 1990). Berdasarkan hasil analisis sifat kimia tanah (Tabel 12) dapat diketahui bahwa kandungan K-tersedia untuk semua tapak populasi alam P. merkusii strain Tapanuli tergolong sangat tinggi. Tabel 12 Kandungan K-tersedia pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Morgan Kedalaman tanah No Lokasi K2O (ppm) Kriteria (cm) 1 2 3 4 5 Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 198.0 78.0 76.0 63.0 sangat tinggi sangat tinggi sangat tinggi sangat tinggi 103.8 196.0 131.0 147.0 89.0 sangat tinggi sangat tinggi sangat tinggi sangat tinggi sangat tinggi 140.8 sangat tinggi 96.0 47.0 46.0 48.0 sangat tinggi tinggi tinggi tinggi 59.3 sangat tinggi 168.0 103.0 72.0 56.0 sangat tinggi sangat tinggi sangat tinggi sangat tinggi 99.8 sangat tinggi 127.0 113.0 78.0 47.0 91.3 sangat tinggi sangat tinggi sangat tinggi tinggi sangat tinggi g. Kation-Kation yang dapat dipertukarkan (exchangable cations) Pertukaran antara kation-kation yang ada di dalam larutan tanah dengan kation lain yang terjerap pada bahan-bahan yang bermuatan negatif seperti koloid liat atau koloid organik merupakan peristiwa penting yang erat kaitannya dengan 52 kesuburan tanah. Kation-kation yang dapat ditukarkan dalam proses pertukaran kation tersebut merupakan sumber unsur hara bagi tanaman. Ada 4 kation yang sering ditemukan di dalam jerapan koloid tanah, yaitu Ca2+, Mg2+, K+, dan Na+ (Foth 1990). Hasil analisis kimia tanah mengenai kandungan kation-kation yang dapat dipertukarkan (exchangable cations) pada kelima lokasi penelitian disajikan pada Tabel 13 dan 14. Kandungan kation-kation yang dapat dipertukarkan (Ca2+,Mg2+ K+, dan Na+ ) berada pada kriteria rendah dan sangat rendah. Tabel 13 Kandungan kation-kation Ca2+, Mg2+ pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara Kedalaman tanah No 1 Lokasi Dolok Tusam Timur (cm) 0 - 05 05-10 2 3 4 5 Parinsoran Dolok Tusam Barat Lobugala Tolang Jenis kation Ca Kriteria Mg (cmolc/kg) 0.48 sangat rendah 0.49 rendah (cmolc/kg) Kriteria 0.33 sangat rendah 0.18 sangat rendah 10-20 0.33 sangat rendah 0.18 sangat rendah 20-30 0.33 0.37 sangat rendah Rata-rata sangat rendah 0.18 0.26 sangat rendah 0 - 05 2.00 sangat rendah 0.56 rendah 05-10 0.44 sangat rendah 0.22 sangat rendah 10-20 0.35 sangat rendah 0.14 sangat rendah 20-30 0.67 sangat rendah 0.08 sangat rendah Rata-rata 0.87 sangat rendah 0.25 sangat rendah 0 - 05 0.4 sangat rendah 0.12 sangat rendah 05-10 0.6 sangat rendah 0.12 sangat rendah 10-20 0.5 sangat rendah 0.06 sangat rendah 20-30 0.3 sangat rendah 0.08 sangat rendah Rata-rata 0.46 sangat rendah 0.10 sangat rendah 0 - 05 0.33 rendah 0.11 rendah 05-10 0.20 rendah 0.23 rendah 10-20 0.14 rendah 0.20 rendah 20-30 0.11 rendah 0.12 sangat rendah Rata-rata 0.20 rendah 0.17 rendah 0 - 05 0.7 sangat rendah 0.45 rendah 05-10 0.9 sangat rendah 0.26 sangat rendah 10-20 0.4 sangat rendah 0.27 sangat rendah 20-30 0.7 sangat rendah 0.2 sangat rendah Rata-rata 0.67 sangat rendah 0.30 sangat rendah sangat rendah 53 Tabel 14 Kandungan kation-kation K+, Na+ pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara Kedalaman tanah No 1 2 3 4 5 K Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Jenis kation Kriteria Na Kriteria (cm) (cmolc/kg) (cmolc/kg) 0 - 05 0.38 rendah 0.24 rendah 05-10 0.15 rendah 0.10 rendah 10-20 0.15 rendah 0.10 rendah 20-30 0.12 rendah 0.10 rendah Rata-rata 0.20 rendah 0.14 rendah 0 - 05 0.38 rendah 0.24 rendah 05-10 0.25 rendah 0.24 rendah 10-20 0.29 rendah 0.14 sangat rendah 20-30 0.17 rendah 0.14 sangat rendah Rata-rata 0.27 0.19 rendah 0 - 05 0.19 rendah 0.13 rendah 05-10 0.09 sangat rendah 0.18 rendah 10-20 0.09 sangat rendah 0.13 rendah 20-30 0.09 sangat rendah 0.11 rendah Rata-rata 0.12 rendah 0.14 rendah 0 - 05 0.3 rendah 0.11 rendah 05-10 0.2 rendah 0.23 rendah 10-20 0.1 rendah 0.2 rendah 20-30 0.1 rendah 0.12 sangat rendah Rata-rata 0.20 rendah 0.17 rendah 0 - 05 0.3 rendah 0.13 rendah 05-10 0.2 rendah 0.05 sangat rendah 10-20 0.2 sangat rendah 0.08 sangat rendah 20-30 0.1 sangat rendah 0.1 sangat rendah Rata-rata 0.18 rendah 0.09 sangat rendah rendah h. Kapasitas Tukar Kation (KTK) Pertukaran antara kation-kation yang ada di dalam larutan tanah dengan kation lain yang terjerap pada bahan-bahan yang bermuatan negatif seperti koloid liat atau koloid organik merupakan peristiwa penting yang erat kaitannya dengan kesuburan tanah. Kation-kation yang dapat ditukarkan dalam proses pertukaran kation tersebut merupakan sumber unsur hara bagi tanaman. Ada 4 kation yang sering ditemukan di dalam jerapan koloid tanah, yaitu Ca2+, Mg2+, K+, dan Na+ 54 (Foth 1990). Hasil analisis kapasitas tukar kation (KTK) tanah pada lokasi penelitian disajikan pada Tabel 15. Rata-rata KTK di semua lokasi termasuk dalam kriteria sangat rendah. Tabel 15 Kandungan KTK pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara No 1 2 3 4 5 Kriteria Kedalaman tanah KTK (cm) (cmolc/kg) 0 - 05 11.03 rendah 05-10 2.66 sangat rendah 10-20 2.14 sangat rendah 20-30 2.23 sangat rendah Rata-rata 4.5 sangat rendah 0 - 05 6.84 rendah 05-10 2.64 sangat rendah 10-20 2.24 sangat rendah 20-30 2.78 sangat rendah Rata-rata 3.6 sangat rendah 0 - 05 2.35 sangat rendah 05-10 2.16 sangat rendah 10-20 1.55 sangat rendah 20-30 1.05 sangat rendah Rata-rata 1.8 sangat rendah 0 - 05 7.28 rendah 05-10 5.25 rendah 10-20 2.84 sangat rendah 20-30 2.31 sangat rendah Rata-rata 4.4 sangat rendah 0 - 05 4.88 sangat rendah 05-10 4.14 sangat rendah 10-20 2.27 sangat rendah 20-30 2.65 sangat rendah Rata-rata 3.5 sangat rendah Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 55 i. Kejenuhan Basa (%) Persentase kejenuhan basa merupakan salah satu sifat kimia tanah yang memiliki kaitan erat dengan tingkat kemasaman tanah, ketersediaan hara, dan kesuburan tanah. Kejenuhan basa menunjukkan persentase dari kapasitas tukar kation total yang ditempati oleh kation-kation basa seperti kalsium, magnesium, kalium, dan natrium (Tisdale et al. 1985). Berdasarkan hasil analisis kimia tanah dapat diketahui bahwa persentase kejenuhan basa (KB) di lima lokasi penelitian berkisar antara rendah dan sedang seperti disajikan pada Tabel 16. Tabel 16 Kandungan Kejenuhan Basa pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara No 1 2 3 4 5 Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Kedalaman tanah KB Kriteria (cm) (%) 0 - 05 14 sangat rendah 05-10 29 rendah 10-20 36 rendah 20-30 33 rendah Rata-rata 28.0 rendah 0 - 05 46 sedang 05-10 44 sedang 10-20 41 sedang 20-30 38 sedang Rata-rata 42.3 sedang 0 - 05 37 sedang 05-10 44 sedang 10-20 49 sedang 20-30 59 tinggi Rata-rata 47.3 sedang 0 - 05 60 tinggi 05-10 52 tinggi 10-20 40 sedang 20-30 38 sedang Rata-rata 47.5 sedang 0 - 05 32 rendah 05-10 35 rendah 10-20 39 sedang 20-30 40 sedang Rata-rata 36.5 sedang 56 Analisis struktur tegakan alam P. merkusii strain Tapanuli Hasil inventarisasi tegakan untuk setiap plot pada masing-masing lokasi dibedakan menjadi dua kategori yaitu tanaman pinus dan non pinus. Dimensi pohon yang diukur untuk setiap plot adalah diameter dan tinggi. Hasil penelitian di Dolok Tusam Timur menunjukkan bahwa untuk vegetasi non pinus didominasi oleh kelas diameter dibawah 30 cm. Sedangkan untuk vegetasi pinus didominasi oleh kelas diameter 20 – 70 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Dolok Tusam Timur disajikan pada Gambar 7. 70 60 Jumlah 50 40 30 Non Pinus 20 Pinus 10 0 Kelas Diameter (cm) Gambar 7 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Dolok Tusam Timur. Hasil penelitian di Parinsoran menunjukkan bahwa untuk vegetasi non pinus didominasi oleh kelas diameter dibawah 10 cm. Sedangkan untuk vegetasi pinus didominasi oleh kelas diameter 20 – 30 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Parinsoran disajikan pada Gambar 8. 57 40 35 30 Jumlah 25 20 Non Pinus 15 Pinus 10 5 0 Kelas Diameter (cm) Gambar 8 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Parinsoran. Kelas diameter pohon non pinus yang mendominasi di Dolok Tusam Barat adalah diameter di bawah 30 cm. Sedangkan untuk vegetasi pinus didominasi oleh kelas diameter di atas 40 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Parinsoran disajikan pada Gambar 9. 60 50 Jumlah 40 30 Non Pinus 20 Pinus 10 0 Kelas Diameter (cm) Gambar 9 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Dolok Tusam Barat 58 Kelas diameter pohon dibawah 30 cm adalah yang mendominasi plot penelitian di Lobugala untuk kategori jenis non pinus. Sedangkan untuk vegetasi pinus, yang mendominasi adalah kelas diameter diatas 30 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Lobugala disajikan pada Gambar 10. 100 90 80 Jumlah 70 60 50 40 Non Pinus 30 Pinus 20 10 0 Kelas Diameter (cm) Gambar 10 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Lobugala Hasil analisis terhadap sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non pinus pada plot penelitian di lokasi Tolang disajikan pada Gambar 11. Kelas diameter pohon yang mendominasi plot penelitian di Lobugala untuk kategori jenis non pinus adalah diameter dibawah 30 cm. Sedangkan untuk vegetasi pinus, yang mendominasi adalah kelas diameter diatas 30 cm. 59 70 60 Jumlah 50 40 30 Non Pinus 20 Pinus 10 0 Kelas Diameter (cm) Gambar 11 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Tolang Mengacu pada Gambar 7-11 dapat diketahui bahwa secara umum kurva sebaran kelas diameter mengikuti pola sebaran J terbalik dengan komposisi kelas diameter kecil (0-30 cm) didominasi oleh jenis non pinus dan untuk kelas diameter besar didominasi oleh jenis P. merkusii strain Tapanuli. Populasi alam P. merkusii strain Tapanuli yang tumbuh di lima lokasi sebaran alaminya memiliki kerapatan tegakan yang berbeda-beda. Gambar 12 Persentase luas bidang dasar Pinus merkusii strain Tapanuli dan luas bidang dasar non pinus 60 Kerapatan tegakan tertinggi ditemukan pada populasi alam P. merkusii strain Tapanuli yang tumbuh pada kawasan hutan lindung Dolok Tusam Timur yakni 117 individu/hektar. Adapun kelimpahan individu jenis non pinus jauh lebih banyak dibanding kelimpahan jenis P. merkusii strain Tapanuli. Namun mengingat jenis P. merkusii strain Tapanuli mendominasi kelas diameter besar maka wajar jika luas bidang dasar P. merkusii strain Tapanuli mendominasi tapak tumbuhnya. Dominasi P. merkusii strain Tapanuli pada tapak tumbuhnya disajikan pada Gambar 12. Hasil analisis tahapan perkembangan pohon untuk lolasi Dolok Tusam Timur, Parinsoran, Dolok Tusam Barat, Lobugala dan Tolang secara berturutturut disajikan pada Gambar 13, Gambar 14, Gambar 15, Gambar 16 dan Gambar Jumlah 17. 50 45 40 35 30 25 20 15 10 5 0 Non Pinus Pinus Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 13 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Dolok Tusam Timur Perkembangan pohon P. merkusii strain Tapanuli di Dolok Tusam Timur menunjukkan dominansi kelas pohon. Kelas pancang, tiang, dan semai relatif rendah. Perkembangan pohon kelas pancang, tiang dan semai terlihat sangat rendah dibandingkan kelas pohon. Hal ini memberikan gambaran tahapan perkembangan pohon yang relatif tidak seimbang dan kurang mewakili sesuai tingkat pertumbuhannya (Gambar 13). 61 70 60 Jumlah 50 40 Non Pinus 30 Pinus 20 10 0 Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 14 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Parinsoran Tingkat perkembangan pohon P. merkusii strain Tapanuli pada sebaran di Parinsoran didominasi oleh kelas pohon. Kemudian berturut-turut kelas tiang, pancang dan semai. Grafik ini juga menunjukkan tingkat perkembangan pohon yang tidak merata (Gambar 14). Gambaran yang sama juga terlihat di daerah Dolok Tusam Barat, namun sebaliknya tingkat perkembangan pohon didominasi Jumlah oleh kelas semai (Gambar 15). 100 90 80 70 60 50 40 30 20 10 0 Non Pinus Pinus Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 15 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Dolok Tusam Barat 62 100 90 80 Jumlah 70 60 50 Non Pinus 40 Pinus 30 20 10 0 Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 16 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lobugala Pada Gambar 16. tingkat perkembangan pohon P. merkusii strain Tapanuli di daerah Lobugala didominasi oleh kelas pohon sementara kelas tiang, pancang dan semai relatif sangat sedikit. Kondisi yang relatif sama juga terlihat di daerah Tolang (Gambar 17). Hal ini menunjukkan tingkat perkembangan P. merkusii strain Tapanuli di kedua wilayah tersebut juga tidak merata. 70 60 Jumlah 50 40 Non Pinus 30 Pinus 20 10 0 Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 17 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Tolang Populasi alam P. merkusii strain Tapanuli secara umum memiliki problem regenerasi. Kelima lokasi yang diteliti ternyata didominasi oleh kelas pohon tanpa didukung oleh ketersediaan permudaan yang mencukupi dan mewakili semua 63 tingkatan pertumbuhan. Hanya lokasi Dolok Tusam Barat saja yang memiliki permudaan pada tingkat semai namun dengan jumlah yang sangat sedikit yakni hanya 250 semai/ha. Semai P. merkusii strain Tapanuli banyak ditemukan pada lantai hutan yang relatif bersih dari serasah dan pada longsoran tanah di tebingtebing di hutan. Sebaliknya pada lantai hutan yang dipenuhi oleh serasah, tidak ditemukan semai P. merkusii strain Tapanuli. Pembahasan Perubahan penutupan dan penggunaan lahan telah diidentifikasi sebagai salah satu penentu utama terjadinya perubahan global yang memberikan dampak besar terhadap ekosistem, biogeokimia global, perubahan iklim, dan kerentanan manusia (Foley et al. 2005). Perubahan tutupan lahan selalu memiliki peran utama di dalam ilmu perubahan lahan (Turner et al. 2007). Perubahan lahan dapat mempengaruhi sifat biologi, kimia, dan fisik tanah (Ross et al. 1999; Chen et al. 2000; Parfitt et al. 2003) yang arah dan besarnya perubahan tergantung pada sejarah pola penggunaan lahan, kondisi iklim, jenis tanah, dan jenis vegetasi (Guo & Gifford 2002). Perubahan tutupan lahan juga mempengaruhi kondisi komunitas hutan (Turner et al. 2003). Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui bahwa kondisi tutupan hutan di semua lokasi penelitian antara tahun 1994 hingga 2011 relatif dalam keadaan stabil. Kestabilan kondisi hutan ini antara lain nampak dari bentuk tutupan hutan pada peta tutupan lahan (Gambar 5) yang relatif tetap dan tidak mengalami fragmentasi selama 17 tahun. Hal ini antara lain nampak dari rendahnya persentase penurunan tutupan hutan yang terjadi antara 1994 hingga 2011 di lokasi penelitian. Bahkan di lokasi Lobugala, tutupan hutannya mengalami peningkatan persentase luas. Kestabilan kondisi hutan ini terjadi baik di lokasi yang masuk ke dalam kawasan hutan lindung (Dolok Tusam Timur dan Dolok Tusam Barat) dan lokasi yang berada di luar kawasan hutan negara (Parinsoran, Lobugala, dan Tolang). Berdasarkan dominasi luas bidang dasar, maka keberadaan tegakan alam P. merkusii strain Tapanuli memiliki peran penting di dalam menciptakan kondisi hutan yang stabil. Hampir di semua lokasi penelitian, luas bidang dasar tegakan 64 alam P. merkusii strain Tapanuli mendominasi luas tapak tumbuhnya. Hanya di perbukitan desa Tolang – Kec. Aek Bilah, luas bidang dasar tegakan alam P. merkusii strain Tapanuli kurang dari 50%. Namun kondisi hutan di perbukitan desa Tolang tersebut masih tetap stabil dikarenakan hutan campurannya relatif tidak terganggu. Mengacu pada data hasil inventarisasi tegakan, dapat diketahui bahwa struktur tegakan alam P. merkusii strain Tapanuli didominasi oleh pohonpohon dengan kelas diameter besar. Hal inilah yang menjadikan tegakan alam P. merkusii strain Tapanuli memiliki luas bidang dasar yang mampu mendominasi tapak tumbuhnya. Selain menyebabkan terjadinya kondisi tutupan hutan yang stabil, dominasi tegakan alam P. merkusii strain Tapanuli juga menyebabkan terjadinya penumpukan seresah pada lantai hutan. Hal ini terkait dengan sifat daun P. merkusii strain Tapanuli yang lambat mengalami proses dekomposisi. Indikasi lambatnya proses dekomposisi serasah ini juga nampak dari nilai C/N yang tergolong sedang hingga tinggi hampir di semua lokasi tapak tumbuh yang diteliti. Tebalnya serasah dan bahan organik pada lantai hutan tersebut juga menyebabkan terhambatnya proses regenerasi alam P. merkusii strain Tapanuli yang ada di dalam hutan. Hal ini nampak dari sedikitnya jumlah semai P. merkusii strain Tapanuli yang berhasil ditemukan dalam kegiatan analisis struktur tegakan. Rendahnya jumlah semai P. merkusii strain Tapanuli yang berhasil ditemukan tersebut disinyalir karena biji-biji yang jatuh secara alami tidak langsung menyentuh permukaan tanah, tetapi tersangkut di dalam seresah. Akibatnya bijibiji tersebut tidak mampu berkecambah. Hasil pengamatan di lapangan dapat diketahui bahwa semai alam P. merkusii strain Tapanuli bermunculan pada tebing-tebing yang mengalami longsor. Longsoran tanah yang umumnya berupa lapisan permukaan tanah yang terbuka menjadi media tumbuh yang optimal bagi biji P. merkusii strain Tapanuli untuk berkecambah. Berdasarkan hasil analisis perubahan lahan dapat diketahui juga bahwa tutupan lahan berupa ilalang-semak cenderung mengalami peningkatan pada sebagian besar lokasi penelitian. Hanya di Lobugala lahan yang ditutupi ilalangsemak mengalami penurunan luas. Meningkatnya lahan yang ditutupi ilalangsemak inilah yang diduga kuat memberikan dampak negatif terhadap kualitas 65 tapak tumbuh. Hal ini antara lain terkait dengan sifat ilalang-semak yang memarginalkan lahan. Pada umumnya lahan-lahan yang ditutupi oleh ilalangsemak akan mengalami penurunan kualitas tanahnya, baik secara kimiawi, fisika, maupun biologis. Secara kimiawi lahan-lahan yang ditutupi oleh ilalang-semak akan memiliki tingkat kesuburan tanah yang rendah dikarenakan terjadinya defisiensi unsur hara di dalam tanah. Secara fisik, pada umumnya lahan-lahan yang ditutupi oleh ilalang-semak akan menjadi lebih padat. Adapun secara biologi, lahan-lahan yang ditutupi oleh ilalang-semak akan menjadi lahan-lahan yang lebih tandus karena tidak optimalnya proses biogeokimia di dalam tanah. Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui bahwa sebagian besar lokasi penelitian mengalami peningkatan luas lahan yang ditutupi ilalang-semak. Hanya lokasi Lobugala yang mengalami penurunan luas lahan ilalang-semak. Parinsoran menempati urutan pertama lokasi yang mengalami peningkatan luas lahan tertinggi yakni 5.59% antara tahun 1994 hingga 2011. Keberadaan ilalang-semak ini akan semakin menjadikan tapak tumbuh lima populasi alam P. merkusii strain Tapanuli semakin miskin hara. Ilalang-semak tersebut muncul sebagai dampak adanya lahan-lahan yang tidak terolah dengan baik dan berkesinambungan. Ilalang-semak juga menyebabkan terhambatnya regenerasi alam P. merkusii strain Tapanuli. Lahan yang tertutupi oleh ilalang-semak akan menyebabkan lantai hutannya tertutup sehingga menghambat terjadinya biji-biji P. merkusii strain Tapanuli yang jatuh ke lantai hutan langsung menyentuh tanah. Kondisi inilah yang barangkali menjadi sebab tidak ditemukannya semai P. merkusii pada plot penelitian yang berlokasi di areal terbuka. Selain ilalang-semak, penambahan luas tutupan lahan ladang juga dapat menyebabkan terjadinya hambatan regenerasi alami P. merkusii strain Tapanuli. Hal ini terkait dengan teknik dan sistem berladang yang dilakukan oleh masyarakat. Secara garis besar masyarakat setempat memulai kegiatan perladangan dengan cara membuka lahan melalui pembakaran. Sebenarnya kegiatan pembakaran dalam pembukaan ladang tersebut dapat merangsang terjadinya perkecambahan biji P. merkusii strain Tapanuli yang ada di lantai hutan atau yang tersangkut di semak-semak. Namun karena setelah kegiatan 66 pembakaran tersebut dilakukan pembersihan lahan (land clearing) maka biji-biji P. merkusii strain Tapanuli yang kemungkinan sudah siap berkecambah kembali menjadi dorman atau rusak tersapu oleh alat pembersih lahan ke bagian tepi lahan yang dibuka untuk ladang. Kondisi inilah yang barangkali menyebabkan pertumbuhan dan perkembangan P. merkusii strain Tapanuli pada areal terbuka menyebar secara individual dan tidak beraturan pada tepi areal perladangan. Berdasarkan hasil analisis sifat kimia tanah, dapat diketahui bahwa kelima lokasi sebaran alam P. merkusii strain Tapanuli yang diteliti memiliki sifat kimia yang relatif sama. Secara keseluruhan kelima lokasi yang diteliti memiliki sifatsifat kimia tanah yang mirip dengan ciri-ciri kimia tanah podsolik merah kuning yang memiliki tingkat kesuburan tanah rendah. Nilai pH tanah adalah sifat kimia tanah yang menunjukkan besarnya kandungan ion H+ di dalam tanah dan berguna sebagai indikator tingkat kemasaman atau alkalinitas tanah. Semakin tinggi kandungan ion H+ di dalam tanah maka semakin kecil nilai pH nya dan semakin masam tanah tersebut. Nilai pH tanah ditentukan berdasarkan kandungan ion H+ dan OH- yang memiliki hubungan berbanding terbalik (Pritchett 1979; Tan 1993). Namun demikian berdasarkan kandungan %C organiknya, ternyata sebagian besar lokasi memiliki kadar C tinggi. Hanya lokasi Parinsoran yang kadar C organiknya rendah. Tingginya persentase C organik pada sebagian besar lokasi penelitian memberikan harapan bahwa tapak tumbuh kelima populasi alam P.merkusii strain Tapanuli dapat dikelola dengan baik. Mengacu pada data struktur tegakan, dapat diketahui bahwa hampir semua populasi alam P. merkusii strain Tapanuli mampu tumbuh dan berkembang sehingga mendominasi tapak tumbuhnya. Hal ini menandakan bahwa sifat kimia tanah tidak menjadi kendala pertumbuhan dan perkembangan bagi populasi alam P. merkusii strain Tapanuli. Persentase C organik adalah sifat kimia tanah yang menunjukkan besarnya bahan organik yang terkandung di dalam tanah. Kandungan bahan organik penting untuk diketahui karena menjadi salah satu faktor yang menentukan kesuburan tanah. Melalui proses dekomposisi bahan organik, berbagai unsur hara yang diperlukan untuk pertumbuhan tanaman dapat tersedia di dalam tanah. Persentase N merupakan sifat kimia tanah yang menunjukkan ketersediaan unsur 67 N di dalam tanah. Adapun C-N rasio menggambarkan kesetimbangan hubungan antara unsur C dan N di dalam tanah. Proses dekomposisi bahan organik di dalam tanah dapat dilihat dari nilai C-N rasionya. Semakin tinggi nilai C-N rasio tanah maka bahan organik yang ada di dalam tanah tersebut semakin lama terdekomposisi. Sebaliknya semakin rendah nilai C-N rasio tanah maka proses dekomposisi bahan organik tersebut semakin cepat (Foth 1990). Secara umum dapat dinyatakan bahwa stabilitas tutupan hutan menyebabkan hambatan bagi regenerasi alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan. Adapun Tutupan ilalang-semak dan praktek pembukaan ladang secara berulang dengan cara membakar dan land clearing menjadi hambatan bagi regenerasi alam P. merkusii strain Tapanuli pada areal terbuka. Semai dianggap cukup bila terdapat penyebaran 40% dengan jumlah semai 1000 batang/ha (Smith 1963). Jumlah semai P. merkusii strain Tapanuli yang ditemukan di lokasi Lobugala tersebut ternyata jauh di bawah jumlah semai P. merkusii yang tumbuh di Ban Wat Chan, Thailand Utara yakni berkisar antara 11042 hingga 34250 batang/ha (Koskela et al. 1995). Hasil penelitian Harahap (2000b) menyatakan bahwa jumlah biji per kerucut diantara ketiga strain P. merkusii ternyata tidak jauh berbeda. Rata-rata jumlah biji per kerucut untuk P. merkusii strain Aceh adalah 5.7 untuk P. merkusii strain Tapanuli 8.86 dan P. merkusii strain Kerinci adalah 6.71. Berdasarkan informasi ini maka dapat dinyatakan bahwa rendahnya jumlah permudaan alam pada kelima populasi alam P. merkusii strain Tapanuli bukan disebabkan oleh faktor rendahnya kemampuan produksi biji. Bahkan dari hasil penelitian Harahap (2000c) tersebut, kemampuan rata-rata produksi biji untuk P. merkusii strain Tapanuli lebih tinggi dibanding P. merkusii strain Aceh dan P. merkusii strain Kerinci. Dengan demikian, rendahnya permudaan P. merkusii strain Tapanuli ini diduga kuat berasal dari faktor luar (non genetik). Berdasarkan kajian literatur, dapat diketahui bahwa semai P. merkusii strain Tapanuli sangat rentan dengan serangan hama Milionia basalis (De Veer & Govers 1953 diacu dalam Harahap 2000c). Kerentanan terhadap serangan hama inilah yang mungkin menyebabkan kemampuan tumbuh (survival rate) semai rendah. 68 Sub-topik Penelitian 2 Analisis Genetik Populasi Alam P. merkusii strain Tapanuli Pada Sebaran Alaminya di Tapanuli – Sumatera Utara Dengan Menggunakan Penanda Molekuler Mikrosatelit Hasil Hasil Isolasi DNA Optimasi isolasi DNA yang dilakukan terhadap 78 contoh daun yang berhasil dikumpulkan dari lima lokasi sebaran alam P. merkusii strain Tapanuli memperlihatkan tampilan DNA yang cukup jelas, demikian juga dengan kegiatan pengenceran yang dilakukan. Pengenceran 10x dan 5x menghasilkan pita DNA yang tebal, sedangkan pengenceran 2x dan 3x menghasilkan pita yang relatif tipis (Gambar 18). 2x GP4 GP5 Gambar 18 GP8 GP10 10x 5x 3x 10x 2x contoh DNA murni a b Contoh pita DNA hasil ekstraksi. Ket: (a) pita yang dihasilkan berdasarkan kesegaran sampel; menggunakan metode ekstraksi Dneasy Plant Mini Kit (50) dari QIAGEN, (b) ukuran besarnya pengenceran hasil ekstraksi DNA beserta kontaminasinya; menggunakan metode ekstraksi CTAB. Hasil Amplifikasi DNA Dengan Primer Mikrosatelit Tujuh primer mikrosatelit yang digunakan dalam penelitian ini merujuk pada primer mikrosatelit yang telah berhasil diuji oleh Nurtjahjaningsih et al. (2005), yakni Pm01, Pm04, Pm05, Pm07, Pm08, Pm09a, dan Pm12. Hasil seleksi primer menunjukkan bahwa amplifikasi DNA contoh dengan ketujuh primer yang diseleksi mampu menghasilkan produk amplifikasi yang polimorfik . 69 Hasil amplifikasi DNA menunjukkan adanya pita-pita DNA poliformik yang muncul dari 2 alel (Gambar 19) dimana posisi pita DNA yang muncul berada di bawah posisi primer mikrosatelit yang menjadi rujukan. Contoh pada primer Pm 04 yang menghasilkan fragmen berukuran 92 bp (Nurtjahjaningsih et al. 2005). Dalam hal ini ukuran pita yang muncul dari amplifikasi berkisar pada 65 dan 75 bp. Perbedaan ukuran fragmen yang dihasilkan saat ini dengan yang sebelumnya dengan primer mikrosatelit yang menjadi rujukan mungkin terjadi karena adanya perbedaan contoh penelitian yang digunakan. Nurtjahyaningsih et al. (2005) menggunakan bahan tanaman dari P. merkusii strain Aceh yang dikembangkan di dalam hutan tanaman di pulau Jawa, sedangkan penelitian ini menggunakan bahan tanaman yang bersumber dari populasi alam di Tapanuli – Sumatera Utara. Perbedaan genotip diantara kedua bahan tanaman yang dianalisis memungkinkan terjadinya perbedaan ukuran fragmen DNA yang muncul. Pm07 Pm09a Pm012 200 bp 150 bp Pm08 Pm01 Pm04 Pm05 100 bp 50 bp Gambar 19 Hasil amplifikasi DNA P. merkusii strain Tapanuli dengan primer mikrosatellite Pm01, Pm04, Pm05, Pm07, Pm08, Pm09a, Pm12 Pita-pita yang muncul tersebut selanjutnya diskoring dan ditentukan secara manual ukuran fragmennya berdasarkan posisi marka yang digunakan dan diolah dengan menggunakan software POPGENE 1.32 yang rincian hasilnya tersaji dalam Lampiran 6. Berdasarkan hasil pengolahan data ini secara umum dapat diketahui keragaman genetik baik di dalam populasi maupun antar populasi. 70 Keragaman Alel Populasi Alam P. merkusii Strain Tapanuli Nilai frekuensi alel pada lima populasi P. merkusii strain Tapanuli yang diteliti berkisar antara 0.0312 hingga 0.9167 (Tabel 17). Nilai frekuensi alel terendah dimiliki oleh populasi alam P. merkusii strain Tapanuli yang tumbuh di desa Tolang – Kec. Aek Bilah – Kab. Tapanuli Selatan, sedangkan nilai frekuensi alel tertinggi dijumpai pada populasi alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam Barat. Tabel 17. Keragaman nilai frekuensi alel pada setiap lokus dan populasi alam P. merkusii strain Tapanuli yang tersebar di Tapanuli – Sumatera Utara. Primer/Locus Panjang fragmen Alel Populasi DTT 111-117 Pm01 92 112-118 Pm05 284-309 132 81-99 181-193 Pm12 0.5294 0.2812 0.1667 2 3 0.5000 0.0882 0.8125 0.0938 0.4706 - 0.3750 0.3438 0.5417 0.2917 1 0.7059 0.3125 0.7647 0.1875 0.2500 0.6875 0.2353 - 0.8125 - 0.7500 - 0.2941 - - 1 0.4412 0.2500 0.6176 0.2500 0.0833 2 3 0.4412 0.1176 0.6250 0.1250 0.3824 0.9118 0.5000 0.2500 0.6250 0.2917 1 0.2353 0.3438 0.0882 0.0938 0.4167 0.7647 0.2500 0.4062 - 0.4062 0.5000 0.4167 0.1667 0.2941 0.8125 0.2059 0.7500 0.8333 0.1875 0.7941 - 0.2500 - 0.1667 - 0.7500 0.2059 0.7188 0.6667 0.7059 0.2500 0.7941 0.0312 0.2500 0.1667 0.1667 1 0.2940 0.0938 - 0.0938 0.0833 2 3 0.2941 0.6765 0.7500 0.1562 0.5000 0.5000 0.8125 0.0938 0.9167 - - 1 0.7059 - 1 2 3 Pm09a TOL 0.0938 2 3 Pm08 LOB 0.4118 2 3 Pm07 DTB 1 2 3 Pm04 PAR 0.2941 - - Berdasarkan data pada Tabel 17 dapat juga diketahui bahwa lokus Pm05 merupakan lokus yang memiliki alel yang tersebar merata pada semua populasi. 71 Hal ini menandakan bahwa primer Pm05 lebih optimal didalam mengamplifikasi DNA contoh P. merkusii strain Tapanuli dibanding primer yang lain. Keragaman Genetik Dalam Populasi Beberapa parameter yang biasa digunakan untuk menilai keragaman genetik dalam populasi adalah jumlah lokus polimorfik, jumlah alel teramati (Na), jumlah alel efektif (Ne) dan nilai heterosigositas harapan (He). Nilai keragaman genetik (He) tertinggi sebesar 0.4693 ditemukan pada populasi Lobugala, sedangkan nilai He terendah sebesar 0.3779 dimiliki oleh populasi Dolok Tusam Barat (Tabel 18). Tabel 18 Keragaman genetik pada lima populasi alam P. merkusii strain Tapanuli di Sumatera Utara No. Populasi 1. 2. 3. 4. 5. Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Rata-rata N 34 32 34 32 24 31 PLP (%) 100 100 100 100 100 100 Na Ne Ha He 2.4286 2.5714 2.0000 3.0000 2.5714 2.5143 1.9069 1.8531 2.0000 1.4755 1.9093 1.8290 0.2269 0.1696 0.3950 0.3661 0.3571 0.3029 0.4614 0.4316 0.3779 0.4693 0.4345 0.4349 Keterangan : N = Jumlah total individu; PLP = Persentase Lokus Polimorfik; Na = Jumah alel yang diamati; Na = Jumah alel efektif (Kimura and Crow (1964); He = Diferensiasi genetik Nei (1973)/Heterozigositas harapan Hasil tersebut menunjukkan bahwa keragaman genetik di dalam populasi alam P. merkusii strain Tapanuli di Lobugala paling tinggi dibanding empat populasi yg lainnya, sedangkan keragaman genetik dalam populasi yang terendah ditemukan pada populasi alam P. merkusii strain Tapanuli yang berasal dari lokasi hutan lindung Dolok Tusam Barat. Untuk melihat peluang inbreeding pada tiap lokasi dan kemungkinan pengaruhnya terhadap peningkatan keragaman individu dalam populasi P. merkusii strain Tapanuli yang diteliti, maka dilakukan pendekatan dengan melihat nilai fiksation indeksnya (Fis), seperti disajikan pada Tabel 19. 72 Tabel 19 Nilai Indeks Fiksasi (Fis) dari kelima populasi P. merkusii strain Tapanuli yang diteliti No Populasi Ratarata Primer Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 1. Dolok Tusam Timur -0.3353 -0.2812 1.0000 1.0000 1.0000 1.0000 0.8707 0.6077 2. Parinsoran -0.1636 0.5294 0.4269 1.0000 1.0000 1.0000 0.5362 0.6184 3. Dolok Tusam Barat -0.6528 -0.6190 -0.0968 0.0192 0.4603 -0.2593 0.8824 -0.0380 4. Lobugala -0.1327 0.0000 -0.0847 0.5897 0.6667 0.8512 0.2242 0.3021 5. Tolang 0.0175 -0.4497 -0.3333 1.0000 1.0000 0.6667 -0.0909 0.2586 Berdasarkan data Fis pada Tabel 19 di atas dapat diketahui bahwa hanya populasi P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat saja yang memiliki nilai Fis (-). Dengan demikian dapat dinyatakan bahwa dari kelima populasi yang diteliti, hanya populasi P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang menunjukkan kelebihan jumlah heterozigot. Hal ini menandakan juga bahwa populasi P. merkusii strain Tapanuli di Dolok Tusam Barat walaupun memiliki nilai keragamannya terendah namun sangat berpeluang untuk menghasilkan individu-individu dengan sifat heterozigot karena frekuensi alel yang seimbang sesuai harapan dibandingkan keempat lokasi yang lain. Diferensiasi Genetik Antar Populasi Diferensiasi genetik antar populasi menggunakan parameter jarak genetik. dapat diidentifikasi dengan Jarak genetik mengukur perbedaan struktur genetik antar dua populasi pada suatu lokus gen tertentu (Finkeldey 2005). Pebedaan genetik dari dua atau lebih populasi pada umumnya dianalisis dengan sebuah matrik dimana elemen-elemennya berupa jarak genetik dan pasangan kombinasi dari masing-masing populasi (Finkeldey 2005). Nilai jarak genetik diantara lima populasi P. merkusii strain Tapanuli yang diteliti berkisar dari 0.0194 hingga 0.6572. Nilai jarak genetik terendah (0.0194) diperoleh pada hubungan antara populasi Dolok Tusam Barat dengan populasi Dolok Tusam Timur. Hal ini menunjukkan bahwa antara populasi Dolok Tusam Barat dengan Dolok Tusam Timur memiliki tingkat kekerabatan yang paling dekat dibanding dengan ketiga populasi yang lain. Adapun nilai jarak genetik tertinggi (0.6572) ditemukan pada hubungan antara populasi Tolang dengan Dolok Tusam Barat (Tabel 20). 73 Tabel 20 Jarak genetik antar populasi P. merkusii strain Tapanuli Pop Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 1 **** 0.2799 0.0194 0.3107 0.4363 2 3 4 5 **** 0.4217 0.0896 0.0517 **** 0.4279 0.6572 **** 0.0660 **** Hal ini menandakan bahwa antara populasi Tolang dengan Dolok Tusam Barat memiliki tingkat kekerabatan yang paling jauh dibanding dengan ketiga populasi alam P. merkusii strain Tapanuli yang lainnya. Semakin dekat kekerabatan dua populasi maka kedua populasi tersebut semakin banyak memiliki kesamaan dalam hal struktur genetiknya. Demikian juga sebaliknya, semakin jauh kekerabatan dua populasi maka struktur genetik diantara kedua populasi itu pun akan semakin banyak perbedaannya. Hasil analisis kelompok dengan bantuan software Popgene 1.32 (Gambar 19) menunjukkan bahwa lima populasi P. merkusii strain Tapanuli yang diteliti dibagi menjadi 2 kelompok besar. Kelompok pertama menempatkan populasi Dolok Tusam Timur dan Dolok Tusam Barat ke dalam 1 kelompok. Adapun kelompok kedua, menempatkan populasi Parinsoran dan Tolang ke dalam sub kelompok pertama, dan populasi Lobugala ke dalam kelompok sendiri. Berdasarkan analisis kelompok ini, dapat diketahui ternyata populasi Lobugala merupakan populasi P. merkusii strain Tapanuli yang memiliki struktur genetik paling berbeda dengan struktur genetik keempat populasi lainnya. Dolok Tusam Timur Dolok Tusam Barat Parinsoran Tolang Lobugala Gambar 20 Dendrogram pengelompokan lima populasi alam P. merkusii strain Tapanuli berdasarkan jarak genetik Nei (1972) menggunakan UPGMA 74 Pembahasan Amplifikasi DNA Dengan Penanda Mikrosatelit Hasil seleksi primer menunjukkan bahwa amplifikasi DNA contoh dengan ketujuh primer (pm01, pm04, pm05, pm07, pm08, pm09a, pm12) yang diseleksi mampu menghasilkan produk amplifikasi dengan fragment DNA polimorfik . Kemampuan amplifikasi primer mikrosatelit untuk amplifikasi DNA telah teruji pada penelitian sebelumnya (Li et al.2002; Lagercrantz et al. 1993; Wang et al. 1994; Vendramin & Hansen 2005). Dibandingkan dengan gymospermae, transfer mikrosatelit pada jenis pinus relatif lebih sulit (Scot et al. 2006; Auckland 2002). Sebagai contoh pada loblolly pine hanya sekitar 60% saja loci mikrosatelit yang teramplifikasi, namun kebanyakan dengan pola polimorfik (Devey et al. 1999; Kutil & William 2001). Struktur Genetik Populasi P. merkusii Strain Tapanuli Struktur genetik adalah sebaran mutlak atau frekuensi relatif dari tipe-tipe genetik tertentu pada satu lokus gen. Secara garis besar, ada 2 tipe struktur genetik dari suatu populasi, yakni struktur dari genotip yang sesungguhnya merupakan penyebaran frekuensi dari genotip-genotip yang terdapat pada suatu populasi dan struktur dari allel yakni penyebaran frekuensi dari alel-alel dalam suatu populasi (Finkelday 2005). Keragaman alel diantara populasi dan lokus merupakan salah satu ukuran yang dapat digunakan untuk menggambarkan struktur genetik populasi suatu jenis. Nilai frekuensi alel pada lima populasi P. merkusii strain Tapanuli yang diteliti berkisar antara 0.0312 hingga 0.9167. Nilai frekuensi alel terendah dimiliki oleh populasi alam P. merkusii strain dari Logubala pada lokus pm09a, alel ke 2 sedangkan nilai frekuensi alel tertinggi dijumpai populasi Tolang yaitu alel no 2 pada pm12. Hal tersebut membuktikan bahwa pada lokasi dengan keragaman terjaga (kawan lindung) memiliki struktur genetik yang lebih komplek, sehingga memungkinkan diperoleh sifat-sifat tertentu melalui kegiatan pemuliaan. 75 Keragaman Genetik Populasi P. merkusii Strain Tapanuli Hasil analisis genetik dengan penanda mikrosatelit pada kelima populasi strain Tapanuli memperlihatkan nilai keragaman genetik tertinggi (He:0,4693 ) diperoleh pada populasi Lobugala (kawasan perladangan) , sedangkan keragaman terendah (He:0.3779) diperoleh pada populasi Dolok Tusam Barat (kawasan hutan lindung). Nilai tersebut sedikit berbeda dengan hasil penelitian awal yang dilakukan Nurtjahjaningsih (2007) mengenai keragaman populasi induk dan anakan di KBS Sumedang (0.501), KBS Baturaden (0.468) dan KBS Sempolan (0.528) dengan penanda mikrosatelit. Nilai tersebut lebih tinggi dibanding penelitian pada populasi aceh dengan menggunakan penanda allozyme He:0.304 (Kartikawati 1998; Na’iem 2000), lebih tinggi dibandingkan penelitian Siregar (2000) pada hutan tanaman pinus di Jawa dengan penanda Isozym (He:0.389) dan penelitian Na’iem & Munawar (2002) pada strain Kerinci (He: 0.042) dan Tapanuli (He: 0.219) dengan penanda allozyme. Namun masih dalam kisaran keragaman dengan penanda mikrosatelit umumnya pada pinus (He: 0.50-0.80). Hal tersebut dapat dipahami karena populasi strain Taapanuli sudah terbagi-bagi dalam beberapa sub populasi yang sempit dan terpisah-pisah sehingga memungkinkan terjadinya efek kawin kerabat yang tidak menguntungkan untuk pemuliaan dimasa mendatang. Perbedaan tingginya nilai keragaman genetik pada lima populasi yang diteliti memperlihatkan terjadinya perubahan sumber genetik pada kelima lokasi tersebut. Kawasan Dolok Tusam Barat dan Dolok Tusam Timur merupakan kawasan hutan lindung yang belum tersentuh oleh kegiatan reboisasi maupun rehabilitasi sehingga kondisi keragaman genetiknya masih terjaga seperti alaminya. Sedangkan pada lokasi lain (Lobuga, Tolang dan Parinsoran) telah terjadi input aktifitas manusia seperti kegiatan perladangan dan perkebunan sehingga memungkinkan terjadinya perubahan nilai keragaman genetiknya. Khusus pada daerah Lobugala yang merupakan lokasi dengan tingkat keragaman tinggi, berdasarkan sejarah lahannya pada lokasi tersebut pernah dilakukan kegiatan rehabilitasi dengan mengintroduksi bibit dari luar populasi (Simorangkir 15 Maret 2012, komunikasi pribadi) yang menyebabkan tingginya keragaman genetik pada lokasi tersebut dibandingkan populasi lain. 76 Lebih lanjut Hardiyanto (1993, 2000) menjelaskan bahwa sampai saat ini populasi tusam di Sumatera terutama Tapanuli telah mengalami penurunan yang cukup drastis karena kegiatan pembalakan dan terdesak oleh kegiatan pertanian dan perkebunan sehingga memungkinkan terjadinya seleksi mundur (disgenic selection) dan tingginya inbreeding. Hasil perhitungan nilai indeks fiksasi (Fis) memperlihatkan pada lokasi yang terfragmentasi memiliki nilai Fis yang cukup tinggi (Fis:+ 0.2586-0.606) mengindikasikan peluang inbreeding yang cukup tinggi, sedangkan pada Dolok Tusam Barat memiliki nilai indeks fiksasi rendah (Fis:-0.0380) yang mengindikasikan peluang inbreeding yang rendah. Angka minus menunjukkan bahwa persen heterosigot lebih besar daripada homosigot, sedangkan nilai Fis (+) menunjukkan semakin besarnya homosigositasnya yang berarti kemungkinan terjadi inbreeding semakin besar (Munawar 2002). Hal ini menandakan juga bahwa populasi P. merkusii strain Tapanuli di Dolok Tusam Barat walaupun memiliki nilai keragamannya terendah namun sangat berpeluang untuk menghasilkan individu-individu dengan sifat heterozigot sesuai harapan dibandingkan keempat lokasi yang lain. Hasil nilai Fis pada keempat populasi yang lain memperlihatkan peluang kejadian inbreeding yang cukup besar. Populasi P. merkusii strain Tapanuli di Parinsoran merupakan populasi yang paling tinggi peluang terjadinya inbreeding. Liu et al. (2012) menyatakan bahwa pada umumnya pinus merupakan jenis yang melakukan perkawinan secara outbreeding, namun ada beberapa hal yang dapat membuat pinus melakukan perkawinan kerabat (inbreeding), yakni pada saat populasi suatu jenis mengalami fragmentasi. Hal ini seperti ditemui pada Pinus rzedowskii (Delagado et al. 1999), dan Pinus pinceana (Ledig et al. 2001). Inbreeding pada pinus juga dapat terjadi karena habitat terisolasi, misal pada Pinus resinosa (Boys et al. 2005). Robledo-Arnuncio dan Gill (2005) telah berhasil membuktikan bahwa Pinus sylvestris yang tumbuh pada lokasi yang terisolasi memiliki laju kawin sendiri yang lebih besar dibanding jenis yang tumbuh pada populasi besar. 77 Hubungan Genetik Perhitungan mengenai hubungan genetik antar populasi sangat berguna untuk mengetahui pola sebaran dan kesamaan sifat genetik pada semua populasi yang diteliti. Pengetahuan tentang hubungan genetik ini merupakan haal mendasar yang diperlukan untuk mengkaji sejarah persebaran sifat genetik maupun untuk mempertahankan dan merencanakan pengelolaan keragaman genetik populasi. Nilai hubungan genetik dapat diperoleh dari hasil perhitungan dengan parameter jarak genetik (genetic distance) yang dilanjutkan dengan analisi kelompok (cluster). Nilai jarak genetik terdekat (0.0194) diperoleh pada hubungan antara populasi Dolok Tusam Barat dengan populasi Dolok Tusam Timur. Hal ini menunjukkan bahwa antara populasi Dolok Tusam Barat dengan Dolok Tusam Timur memiliki tingkat kekerabatan yang paling dekat dan kemungkinan berasal dari sumber benih yang sama. Sedangkan jarak genetik terjauh (0.6572) diperoleh dari populasi Dolok Tusam Barat dan Tolang, hal tersebut mengindikasikan kekerabatan kedua pohon pada lokasi tersebut cukup jauh. Hasil analisis kelompok (cluster) membagi strain Tapanuli kedalam dua kelompok besar yaitu kelompok I (Dolok Tusam Barat dan Dolok Tusam Timur) dan kelompok II (Tolang, Parinsoran dan Labugala) walaupun sesungguhnya masih terdapat hubungan kekerabatan dan karena perkembangan pemanfaatan lahan telah menyebabkan terjadinya kelompok-kelompok populasi alam yang sedikit terpisah. Kelompok II pada penelitian ini terdiri dari populasi yang terfragmentasi, perbedaan tersebut kemungkinan disebabkan adanya infusi sumber benih lain melalui kegiatan reboisasi pada daerah tersebut. Hal tersebut didukung oleh Indrioko (1996) dan Kartikawati (1998) yang menyatakan bahwa kegiatan reboisasi hutan yang dilakukan di daerah Aceh, Tapanuli, Kerinci dan daerahdaerah lain di seluruh Indonesia menggunakan benih tusam yang didatangkan dari Jawa. Implikasi Fragmentasi Habitat dan Keragaman Genetik Pengetahuan mengenai keragaman genetik dari suatu populasi sangat penting untuk kegiatan konservasi yang dilakukan karena keragaman genetik yang 78 tinggi akan membantu populasi beradaptasi terhadap perubahan lingkungan disekelilingnya dan terjaganya biodiversity. Lebih lanjut Namkoong et al. (1996) diacu dalam Finkeldey (2005) menyatakan bahwa derajat keragaman genetik merupakan salah satu indikator kelestarian pengelolaan hutan. Keragaman genetik strain Tapanuli pada lima lokasi penelitian tergolong cukup tinggi, hal tersebut mengindikasikan kegiatan seleksi dan pemeliharaan yang dilakukan mampu menjaga keragaman genetiknya. Fragmentasi habitat yang terjadi pada daerah Lobugala, Parinsoran dan Torang, sedikit mempengaruhi keragaman genetiknya hal tersebut ditunjukkan dengan sedikit perbedaan nilai He pada kawasan hutan lindung Dolok Tusam. Pada lokasi terfragmentasi, kegiatan rehabilitasi untuk memulihkan kondisi hutan masih terus dilakukan dengan melakukan infusi jenis dari hutan sehingga keragamannya tetap terjaga tinggi walaupun indeks fiksasinya tinggi. Adanya peluang inbreeding yang cukup tinggi pada lokasi terfragmentasi memungkinkan terjadinya persentase homozigositas yang cukup tinggi sehingga memungkinkan terjadinya kerusakan struktur genetik karena genetic drift, depresi inbreeding, asortif mating, meiotic drift (Munawar 2002). Rekomendasi yang dapat dihasilkan pada penelitian ini adalah menjaga populasi alami strain Tapanuli (Dolok Tusam Barat dan Dolok Tusam Timur) karena memiliki keragaman alel cukup tinggi serta peluang terjadinya inbreeding yang rendah sehingga memungkinkan diperolehnya sumber gen bagi karakter tertentu sesuai yang diharapkan. Demikian juga untuk produksi biomassa karbon. Adanya tutupan lahan pinus yang masih rapat dan pertumbuhan yang bagus pada kedua lokasi tersebut memungkinkan diperoleh biomassa karbon yang cukup banyak dibandingkan lokasi terfragmentasi. Berdasarkan hasil analisis genetik dengan menggunakan penanda molekuler mikrosatelit dapat diketahui bahwa populasi Lobugala memiliki nilai heterosigositas harapan (He) tertinggi, dan populasi Dolok Tusam Barat memiliki nilai heterosigositas harapan (He) terendah. Namun jika nilai He tersebut dibandingkan dengan nilai heterosigositas aktualnya (Ha) maka hanya populasi Dolok Tusam Barat yang memiliki surplus heterosigositas, sedangkan keempat populasi lainnya mengalami defisit heterosigositas. 79 Tingginya nilai He pada populasi Lobugala menunjukkkan bahwa keragaman di dalam populasi ini lebih tinggi dibanding populasi yang lain. Hal ini dapat terjadi kemungkinan karena adanya outbreeding pada populasi P. merkusii strain Tapanuli yang ada di lokasi Lobugala. Kondisi tutupan lahan yang relatif lebih terbuka dibanding tutupan lahan keempat lokasi lainnya memungkinkan terjadinya pergerakan biji P. merkusii strain Tapanuli dari berbagai lokasi sehingga terjadi outbreeding di Lobugala. Adapun nilai He yang terendah pada populasi Dolok Tusam Barat menunjukkan bahwa populasi alam P. merkusii strain Tapanuli pada lokasi ini memiliki keragaman di dalam populasi yang rendah. Hal ini dapat terjadi kemungkinan karena pengaruh kondisi tegakan alam P. merkusii strain Tapanuli pada lokasi Dolok Tusam Barat yang telah mencapai klimaks sehingga peluang terjadinya outbreeding kecil. Selanjutnya berdasarkan nilai Indeks Fiksasi (Fis) dapat diketahui bahwa hanya populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang memiliki nilai negatif atau terjadi surplus heterosigositas sehingga peluang terjadinya inbreeding pun kecil. Sebaliknya populasi alam P. merkusii strain Tapanuli yang tumbuh di empat lokasi yang lain memiliki nilai Fis positif atau terjadi defisit heterosigositas sehingga peluang terjadinya depresi pun meningkat. Rendahnya peluang terjadinya depresi inbreeding pada populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat diduga kuat terjadi sebagai dampak dari kondisi tutupan hutan yang stabil. Sebaliknya meningkatnya peluang depresi inbreeding pada lokasi Lobugala kemungkinan karena adanya tegakan alam P. merkusii strain Tapanuli yang mengelompok dalam ukuran populasi yang sempit. Selanjutnya berdasarkan analisis genetik dapat diketahui juga keanekaragaman genetik antar populasi yang antara lain ditunjukkan oleh nilai jarak genetik dan digambarkan dalam bentuk dendrogram. Berdasarkan nilai jarak genetiknya, diantara lima populasi P. merkusii strain Tapanuli yang diteliti berkisar dari 0.0194 hingga 0.6572. Nilai jarak genetik terendah (0.0194) diperoleh pada hubungan antara populasi Dolok Tusam Barat dengan populasi 80 Dolok Tusam Timur. Hal ini menunjukkan bahwa antara populasi Dolok Tusam Barat dengan Dolok Tusam Timur memiliki tingkat kekerabatan yang paling dekat dibanding dengan ketiga populasi yang lain. Adapun nilai jarak genetik tertinggi (0.6572) ditemukan pada hubungan antara populasi Tolang dengan Dolok Tusam Barat. Hal ini menandakan bahwa antara populasi Tolang dengan Dolok Tusam Barat memiliki tingkat kekerabatan yang paling jauh dibanding dengan ketiga populasi alam P. merkusii strain Tapanuli yang lainnya. Semakin dekat kekerabatan dua populasi maka kedua populasi tersebut semakin banyak memiliki kesamaan dalam hal struktur genetiknya. Demikian juga sebaliknya, semakin jauh kekerabatan dua populasi maka struktur genetik diantara kedua populasi itu pun akan semakin banyak perbedaannya. Selanjutnya mengacu pada hasil analisis kelompok, dapat diketahui bahwa lima populasi P. merkusii strain Tapanuli yang diteliti dibagi menjadi 2 kelompok besar. Kelompok pertama menempatkan populasi Dolok Tusam Timur dan Dolok Tusam Barat ke dalam satu kelompok. Adapun kelompok kedua, menempatkan populasi Parinsoran dan Tolang ke dalam sub kelompok pertama, dan populasi Lobugala ke dalam kelompok sendiri. Berdasarkan analisis kelompok ini, dapat diketahui ternyata populasi Lobugala merupakan populasi P. merkusii strain Tapanuli yang memiliki struktur genetik paling berbeda dengan struktur genetik keempat populasi lainnya. Perbedaan struktur genetik populasi Lobugala kemungkinan terjadi sebagai dampak dari proses adaptasi populasi P. merkusii strain Tapanuli terhadap kondisi tapak tumbuhnya. Berdasarkan analisis kelompok ini juga diketahui ternyata kedekatan dua populasi tidak ditentukan oleh kedekatan jarak geografisnya, melainkan dikarenakan kedekatan struktur genetiknya. Hal ini nampak pada penempatan populasi Parinsoran yang satu kelompok dengan populasi Tolang. Kedua populasi ini berada pada jarak geografis yang jauh tetapi ternyata memiliki struktur genetik yang berdekatan. Hasil dari analisis pengelompokan tersebut juga dapat digunakan sebagai dasar untuk pemilihan sumber materi genetik untuk keperluan pemuliaan ataupun untuk kepentingan pembudidayaan. Mengacu pada nilai keragaman genetik dan nilai jarak genetik maka dapat dinyatakan bahwa populasi Dolok Tusam Barat dan 81 Dolok Tusam Timur merupakan populasi yang cocok dijadikan untuk lokasi pengambilan sumber pengambilan materi genetik P. merkusii strain Tapanuli. Karenanya keberadaan tegakan alam P. merkusii strain Tapanuli di kawasan hutan lindung Dolok Tusam Barat dan Dolok Tusam Timur perlu dilestarikan. Sub-topik Penelitian 3 Analisis Kandungan Biomassa Karbon Tegakan Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara Hasil Informasi mengenai distribusi diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat diperlukan sebagai acuan untuk menentukan distribusi diameter dari pohon-pohon yang akan ditebang untuk kegiatan destructive sampling. Distribusi diameter tersebut disusun dengan menggunakan data-data diameter hasil inventarsiasi tegakan alam P. merkusii strain Tapanuli yang ada di dalam kluster plot pengamatan, seperti disajikan di dalam lampiran 3. Mengacu pada data hasil inventarisasi tersebut dapat diketahui bahwa kerapatan tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat relatif sama. Di dalam kluster plot Dolok Tusam Timur terdapat 47 pohon P. merkusii strain Tapanuli dengan rentang diameter antara 12.4 cm hingga 120.6 cm. Adapun di dalam kluster plot Dolok Tusam Barat terdapat 43 pohon P. merkusii strain Tapanuli dengan rentang diameter antara 30 cm hingga 98 cm. Selanjutnya data-data diameter tersebut didistribusikan ke dalam kelas diameter dengan interval 10 cm seperti disajikan pada Lampiran 3. Secara keseluruhan pola sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat ditampilkan dalam grafik pada Gambar 21. Berdasarkan grafik sebaran kelas diameter tersebut dapat diketahui bahwa pohon-pohon P. merkusii strain Tapanuli dengan diameter 40 hingga 79,9 cm banyak ditemukan di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam 82 Barat. Pola Sebaran kelas diameter seperti tergambarkan dalam grafik inilah yang selanjutnya digunakan sebagai acuan untuk menentukan sebaran kelas diameter pohon-pohon P. merkusii strain Tapanuli yang akan ditebang untuk destructive sampling. 18 16 5 14 2 Jumlah 12 9 10 9 8 3 12 6 HL DT Barat 11 6 4 6 5 2 0 HL DT Timur 0 2 0 0 6 6 2 1 1 1 0 2 0 1 0 Kelas diameter (cm) Gambar 21 Grafik sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat. Jumlah pohon yang ditebang untuk destructive sampling dalam penelitian ini sebanyak 36 pohon. Seperti tersaji pada Gambar 21 maka ketiga puluh enam pohon yang ditebang untuk destructive sampling tersebut harus dapat mewakili setiap kelas diameter pohon yang berhasil didata dari hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat, yakni mulai dari kelas diameter 10-19,9 cm hingga 120-129.9 cm. Mengingat status kawasan Dolok Tusam Timur dan Dolok Tusam Barat merupakan kawasan hutan negara untuk pemenuhan fungsi lindung atau Hutan Lindung maka tegakan alam P. merkusii strain Tapanuli yang telah diinventarisir tersebut tidak boleh ditebang. Sehubungan dengan hal ini, maka kegiatan destructive sampling dilakukan pada lahan milik warga dengan sebaran diameter pohon P. merkusii strain Tapanuli mengikuti pola sebaran kelas diameter P. merkusii strain Tapanuli yang ada di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat (Gambar 21). 83 Berdasarkan hasil inventarisasi tegakan alam P. merkusii strain Tapanuli pada lahan milik warga, sebanyak 36 batang pohon dengan rentang diameter 1382 cm telah berhasil dipilih untuk kegiatan destructive sampling. Dengan demikian ada empat kelas diameter dari struktur tegakan alam P. merkusii strain Tapanuli yang ada di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat yang belum terwakili oleh kelas diameter dari 36 batang pohon yang ditebang untuk destructive sampling. Hal ini terjadi karena keterbatasan jumlah pohon P. merkusii strain Tapanuli milik warga yang berdiameter besar. Pada umumnya diameter batang pohon P. merkusii strain Tapanuli milik warga berkisar antara 20-60 cm. Untuk memenuhi keterwakilan dari semua kelas diameter yang ada pada kawasan hutan lindung Dolok Tusam maka jumlah sampel untuk penyusunan persamaan allometrik perlu ditambah, terutama dari kelas diameter besar. Terkait dengan hal tersebut maka dilakukan pendekatan volumetrik, yakni pengukuran biomassa pohon P. merkusii strain Tapanuli yang dihitung dari nilai kerapatan jenis kayunya dikalikan dengan volumenya. Melalui pendekatan volumetrik, tegakan alam P. merkusii strain Tapanuli yang memiliki diameter besar tidak perlu ditebang, namun cukup diambil sampel kayunya untuk dianalisis kerapatan jenis kayunya. Mengacu pada pola sebaran kelas diameter pada tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat maka ada tambahan delapan sampel yang diukur biomassanya dengan pendekatan volumetrik. Kedelapan sampel tambahan tersebut memiliki sebaran diameter sebagai berikut: 75 cm, 79.5 cm, 86 cm, 95 cm, 104 cm, 110.9 cm, 115.5 cm, dan 120..6 cm. Gambar 22 menyajikan grafik sebaran kelas diameter dari tiga sumber data yang berbeda yakni: a). Sebaran kelas diameter hasil dari kegiatan inventarisasi tegakan alam P. merkusii strain Tapanuli yang ada di hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat (grafik dengan garis berwarna biru), b). Sebaran kelas diameter dari 36 sampel pohon yang akan digunakan untuk destruvtive sampling (grafik dengan garis berwarna merah), c). Sebaran kelas diameter sebagai hasil dari kompilasi antara 36 sampel destructive sampling + 8 sampel volumetrik (grafik dengan garis berwarna hijau). Seperti nampak pada Gambar 84 22 sebaran kelas diameter untuk 36 sampel destructive sampling dan 8 sampel untuk pendekatan volumetrik secara garis besar memiliki pola grafik yang sama dengan sebaran kelas diameter hasil inventarisasi dari hutan lindug Dolok Tusam Timur dan Dolok Tusam Barat. 18 16 Jumlah pohon 14 12 10 8 Inventory 6 Destructive 4 Destructive + 8 2 0 Sebaran Diameter (cm) Gambar 22 Perbandingan pola sebaran diameter antara hasil inventori plot di hutan lindung Dolok Tusam (warna biru) dengan 36 pohon untuk destructive sampling (warna merah) serta 44 pohon untuk modifikasi destructive sampling + volumetrik hijau). kluster sampel sampel (warna Distribusi Biomassa P. merkusii Strain Tapanuli Hasil Destructive Sampling Sebanyak 36 pohon P. merkusii strain Tapanuli ditebang untuk pelaksanaan metode destructive sampling. Hasil pengukuran dimensi pohon dan biomassanya secara terperinci disajikan pada Lampiran 4. Mencermati data biomassa tersebut, dapat diketahui bahwa secara keseluruhan rata-rata biomassa yang dialokasikan ke bagian atas tanah adalah sebesar 77.32%, sedangkan sisanya sebesar 22.68% dialokasikan untuk biomassa di bawah tanah (akar). Selanjutnya dari 77.32% biomassa bagian atas tanah tersebut, sebanyak 57.88% dialokasikan ke batang, 12.87% dialokasikan ke cabang, 3.74% dialokasikan ke ranting, 2.83% dialokasikan ke daun, dan 0.01% dialokasikan ke buah. Sebaran alokasi biomassa pada masing-masing pohon dari tiga puluh enam pohon P. merkusii strain Tapanuli yang ditebang dalam destructive sampling, secara visual tergambarkan dalam Grafik yang ditampilkan pada Gambar 23. 85 Seperti tampak pada Gambar 23, sebagian besar biomassa dialokasikan ke batang dengan kisaran 38.02–82.25%. Akar merupakan bagian pohon yang mendapatkan alokasi biomassa terbesar kedua setelah batang yakni berkisar antara 9.5836.71%. Adapun alokasi biomassa untuk bagian pohon yang lain sebagai berikut: cabang (1.39-28.35%), ranting (1.49-8.20%), daun ( 1.36-6.67%) dan buah (0.030.11%). 100,00% 80,00% Persentase (%) 60,00% 40,00% 20,00% 82,0 76,0 74,0 72,0 65,3 63,0 62,0 61,0 59,5 57,0 55,2 54,5 53,0 50,0 48,0 47,0 45,0 44,1 43,0 41,3 40,5 39,0 38,4 36,5 34,3 32,7 30,5 29,1 27,2 26,0 25,0 23,0 20,0 19,3 17,0 13,0 0,00% Diameter (cm) Buah Gambar 23 Daun Ranting Cabang Batang Akar Grafik sebaran alokasi biomassa pada setiap bagian pohon dari 36 Pinus merkusii strain Tapanuli yang ditebang didalam kegiatan destructive sampling 86 Mengacu pada data biomassa hasil dari kegiatan destructive sampling tersebut dapat diketahui juga nisbah pucuk akar yang cenderung mengalami penurunan seiring dengan peningkatan diameter batang. Nilai nisbah pucuk akar dari ketiga puluh enam pohon P. merkusii strain Tapanuli yang ditebang tersebut rata-rata bernilai 4.1 dengan nilai nisbah pucuk akar terkecil 1.7 dan terbesar 9.4. Selain itu, juga dapat diketahui nilai kerapatan jenis kayu dan nilai perbandingan antara biomassa total dengan biomassa batang atau dikenal dengan istilah nilai Biomassa Ekspansion Factor (BEF) dari 36 pohon P. merkusii strain Tapanuli yang ditebang tersebut. Nilai kerapatan jenis kayu dari P. merkusii strain Tapanuli yang ditebang tersebut rata-rata 0.479 g/cm3. Adapun nilai BEF dari P. merkusii strain Tapanuli yang ditebang tersebut berkisar antara 1.22- 2.63 dengan nilai rata-rata 1.78. Persamaan Allometrik Biomassa Bagian Atas, Bagian Bawah dan Total P. merkusii Strain Tapanuli Persamaan allometrik untuk pendugaan kandungan biomassa karbon pada tegakan alam P. merkusii strain Tapanuli ini menggunakan dua input data yang berbeda. Input data pertama, merupakan data biomassa hasil destructive methode terhadap 36 pohon contoh P. merkusii strain Tapanuli. Hasil pengukuran biomassa bagian atas, bawah, dan total dari P. merkusii yang dijadikan sebagai pohon contoh tersebut disajikan pada Lampiran 3. Biomassa bagian atas (above ground biomass) tersebut merupakan penjumlahan dari biomassa batang, cabang, ranting, daun, dan buah dari P. merkusii strain Tapanuli yang diteliti, sedangkan biomassa bagian bawah tanah (below ground biomass) adalah biomassa akar dari pohon P. merkusii strain Tapanuli. Data biomassa tersebut di dalam penyusunan persamaan allometrik digunakan sebagai peubah tak bebas Y. Adapun untuk peubah X nya, ada 4 model peubah yakni: a). Diameter, b). Diameter x Tinggi, c). Diameter x Kerapatan Jenis Kayu, dan d). Diameter x Kerapatan Jenis Kayu x Tinggi. Input data kedua, merupakan data biomassa hasil modifikasi antara metode destructive sampling dengan metode volumetrik. Input data kedua ini terdiri atas 36 data biomassa dari hasil destructive methode P. merkusii strain Tapanuli ditambah dengan 8 data biomassa P. merkusii strain Tapanuli yang dihitung dari 87 pendekatan volumetrik. Data biomassa yang digunakan sebagai peubah Y dan beberapa parameter yang digunakan sebagai peubah X untuk penyusunan persamaan allometrik ini disajikan pada Lampiran 5. Model persamaan allometrik yang dihasilkan dari dua sumber data tersebut masing-masing disajikan pada Tabel 21 dan Tabel 22 di bawah ini. Tabel 21 Model persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli yang diolah dari 36 data biomassa pohon hasil destructive sampling No Peubah bebas (X) Peubah tak bebas (Y) Model Persamaan R2 R2adj RMSE Y=aXb 1. Diameter Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.2222 X2.3035 Y = 0.1678 X2.3085 Y = 0.0239 X2.4864 0.96620 0.96890 0.85080 0.965251 0.967960 0.846370 0.199183 0.191416 0.481772 2. Diameter x Tinggi Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0057 X1.7622 Y = 0.0039 X1.7787 Y = 0.0006 X1.853 0.94460 0.96080 0.78930 0.943007 0.959629 0.783086 0.255089 0.214865 0.572462 3. Diameter x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 2.0815 X2.1242 Y = 1.5401 X2.1373 Y = 0.2971 X2.2578 0.94840 0.95860 0.80980 0.946903 0.957351 0.804158 0.246216 0.220843 0.543946 4. Diameter x Tinggi x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0361X1.6751 Y = 0.0245 X1.6954 Y = 0.0051 X1.7417 0.94320 0.96470 0.77060 0.941511 0.963618 0.763832 0.258415 0.203974 0.597328 Tabel 22 Model persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli yang diolah dari 44 data biomassa pohon hasil modifikasi destructive sampling + volumetrik No Peubah bebas (X) Peubah tak bebas (Y) Model Persamaan Y=aXb R2 R2adj RMSE 1. Diameter Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.2451X2.2757 Y = 0.1900X2.2730 Y = 0.0283X2.4393 0.97840 0.97980 0.90240 0.977900 0.979317 0.900094 0.183996 0.177670 0.436644 2. Diameter x Tinggi Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0093X1.6885 Y = 0.0069X1.6931 Y = 0.001X1.7824 0.96330 0.97220 0.86170 0.962397 0.971534 0.858445 0.240009 0.208435 0.519749 3. Diameter x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 2.4771X2.0604 Y = 1.8885X2.0625 Y = 0.3591X2.1887 0.96620 0.97180 0.87520 0.965382 0.971086 0.872239 0.230288 0.210070 0.493776 4. Diameter x Tinggi x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0648X1.5754 Y = 0.0477X1.5820 Y = 0.0085X1.6531 0.96020 0.97190 0.84870 0.959284 0.971200 0.845086 0.249748 0.209654 0.543721 88 Berdasarkan perbandingan nilai R2, R2adj dan RMSE dapat diketahui bahwa persamaan allometrik nomor 1 pada Tabel 20 (dibentuk dari 36 data biomassa hasil destructive sampling + 8 data biomassa dari pendekatan volumetrik) dengan diameter sebagai peubah bebas X memiliki nilai R2 terbesar, R2adj terbesar dan nilai RMSE terkecil dibanding persamaan allometrik lainnya. Hal ini menunjukkan bahwa persamaan allometrik terbaik untuk pendugaan biomassa karbon P. merkusii strain Tapanuli adalah persamaan yang disusun dari 1 peubah bebas X yakni diameter setinggi dada (DBH). Model persamaan allometrik terbaik untuk pendugaan biomassa total P. merkusii strain Tapanuli adalah Y = 0.2451(DBH)2.2757 dengan R2 = 0.97840, Radj = 0.977900, RMSE = 0.183996. Persamaan allometrik untuk pendugaan biomassa atas tanah P. merkusii strain Tapanuli adalah Y = 0.1900(DBH)2.2730 dengan R2 = 0.97980, Radj = 0.979317, RMSE = 0.177670. Adapun persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli bawah tanah adalah Y = 0.0283(DBH)2.4393 dengan R2 = 0.90240, Radj = 0.900094, RMSE = 0.436644. Grafik persamaan allometrik terbaik untuk pendugaan biomassa P. merkusii strain Tapanuli disajikan pada Gambar 24. 16000.0 Y = 0.2451(DBH)2.2757 R² = 0.9784 14000.0 Biomassa (Kg) 12000.0 AGB 10000.0 BGB Y = 0.19(DBH)2.273 R² = 0.9798 8000.0 TB 6000.0 Power (AGB) Y = 0.0283(DBH)2.4393 R² = 0.9024 4000.0 2000.0 0.0 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 Diameter (cm) Gambar 24 Grafik model persamaan allometrik terbaik untuk pendugaan biomassa Pinus merkusii strain Tapanuli. 89 Perbandingan Persamaan Allometrik Terpilih (Hasil Penelitian) dengan Persamaan Allometrik yang Sudah Ada Persamaan allometrik yang terpilih tersebut selanjutnya dibandingkan dengan persamaan allometrik yang disusun oleh Siregar (2007) untuk pendugaan biomassa total P. merkusii yang tumbuh di Cianten – Jawa Barat. Perbandingan kedua persamaan ini dilakukan untuk melihat keeratan kedua persamaan di dalam menduga kandungan biomassa total jika dibandingkan dengan biomassa total aktual (hasil pengukuran dari destructive sampling). Secara sederhana, perbandingan kedua persamaan allometrik tersebut dilakukan dengan cara memasukkan nilai diameter setinggi dada (DBH) ke dalam persamaan allometrik Cianten (Y=0.1031(DBH)2.4587) dan Tapanuli (Y = 0.2451(DBH)2.2757 ) dan membandingkan hasilnya dengan nilai berat biomassa total hasil pengukuran dari kegiatan destructive sampling. Grafik yang menunjukkan perbandingan antara nilai dugaan biomassa total yang dihasilkan dari persamaan allometrik Cianten dengan persamaan Tapanuli disajikan pada Gambar 25 di bawah ini. 6000.00 Y = 0.2451(DBH)2.2757 Pinus - Tapanuli Y= 0.1031(DBH)2.4587 Pinus - Cianten Berat Biomassa (Kg) 5000.00 4000.00 Berat Aktual 3000.00 Cianten Tapanuli 2000.00 1000.00 0.00 0.0 20.0 40.0 60.0 Diameter (cm) 80.0 100.0 Gambar 25 Grafik perbandingan antara nilai dugaan biomassa P. merkusii strain Tapanuli antara persamaan allometrik Tapanuli dengan persamaan allometrik Cianten 90 Persamaan allometrik P. merkusii – Cianten menghasilkan nilai dugaan biomassa total dengan simpangan total dan rata-rata terhadap nilai aktual biomassa total masing-masing sebesar -8119.09 kg dan -225.53 kg. Adapun simpangan total dan rata-rata yang dihasilkan dari persamaan allometrik P. merkusii – Tapanuli masing-masing sebesar -784.11 kg dan -21.78 kg. Berdasarkan nilai simpangan total dan rata-rata tersebut, secara umum dapat dinyatakan bahwa persamaan allometrik Cianten lebih tepat digunakan untuk menduga biomassa tegakan P. merkusii dengan diameter kecil (di bawah 40 cm), sedangkan persamaan allometrik hasil penelitian ini lebih tepat digunakan untuk menduga biomassa tegakan P. merkusii yang memiliki kisaran diameter besar hingga diameter 120 cm. Hasil perbandingan antara nilai dugaan yang dihasilkan dari persamaan allomterik Pinus-Cianten dengan nilai dugaan hasil dari persamaan Pinus- Tapanuli disajikan pada Lampiran 6. Analisis Kandungan Biomassa Karbon pada Lima Populasi Alam P. merkusii strain Tapanuli yang Tumbuh pada Ekosistem Daratan Tapanuli – Sumatera Utara Persamaan allometrik terpilih tersebut selanjutnya digunakan untuk menghitung potensi kandungan biomassa total dan karbon pada tegakan P. merkusii strain Tapanuli yang tumbuh pada lima lokasi sebaran alaminya di Tapanuli – Sumatera Utara. Analisis diawali dengan menghitung kandungan biomassa total tegakan P. merkusii strain Tapanuli kemudian mengalikannya dengan nilai devault 0.5 sehingga kandungan karbonnya dapat diketahui seperti tersaji pada Tabel 23. Tabel 23 Kandungan biomassa total dan karbon P. merkusii strain Tapanuli serta di lima lokasi penelitian No Lokasi Biomassa (ton/ha) Atas Stok Karbon (ton C/ha) Total 143.9 Bawah (akar) 44.3 Kerapatan Pohon (pohon/ha) 187.8 117 Dolok Tusam Timur Parinsoran 287.8 Bawah (akar) 88.6 75.1 21.4 97.9 37.5 10.7 48.9 85 291.8 88.5 380.8 145.9 44.2 190.4 107 4 Dolok Tusam Barat Lobugala 142.9 41.9 186.4 71.5 21.0 93.2 90 5 Tolang 70.1 20.2 91.3 35.0 10.1 45.7 52 1 2 3 Total Atas 375.7 91 Berdasarkan data pada Tabel 23 dapat diketahui juga bahwa urutan lokasi dengan kandungan stok karbon mulai dari yang terendah ke yang tertinggi yaitu: Tolang, Parinsoran, Lobugala, Dolok Tusam Timur, dan Dolok Tusam Barat. Besarnya kandungan stok karbon tersebut sangat erat kaitannya dengan kerapatan tegakan alam P. merkusii strain Tapanuli pada setiap lokasi penelitian. Pembahasan Biomassa merupakan salah parameter penting yang perlu diamati didalam kegiatan penelitian yang terkait dengan aspek silvikultur, ekologi, dan fisiologi pohon. Berdasarkan pengolahan data biomassa, maka ada banyak aspek yang dapat dianalisis lebih dalam, antara lain produktivitas, kandungan unsur hara di dalam jaringan tanaman, kandungan biomassa karbon, dan sebaran kelas umur. Atas dasar inilah maka kegiatan pengukuran terhadap kandungan biomassa pada suatu pohon atau tegakan harus dapat dilakukan sesuai kaidah ilmiah yang benar sehingga diperoleh data yang akurat. Berdasarkan hasil sebaran biomassa pada tegakan alam P. merkusii strain Tapanuli dapat diketahui bahwa biomassanya menyebar secara tidak teratur seperti disajikan pada Gambar 23. Hal ini secara tidak langsung menandakan bahwa tegakan P. merkusii strain Tapanuli yang diteliti terdiri atas pohon-pohon dengan umur yang berbeda. Data ini secara tidak langsung dapat digunakan sebagai bukti bahwa populasi P. merkusii strain Tapanuli yang menyebar di daratan ekosistem Tapanuli benar-benar merupakan tegakan alam. Berdasarkan data pada Lampiran 4, dapat diketahui bahwa alokasi biomassa batang tidak menunjukkan pola pada umumnya tanaman yakni semakin bertambah diameter maka alokasi biomassa ke batang semakin besar (Zhang et al. 2005). Hal ini terjadi kemungkinan karena pengaruh dari keragaman umur, kerapatan, dan kualitas tapak dari pohon P. merkusii strain Tapanuli yang ditebang. Hal ini sebagaimana dinyatakan (Lambers et al. 1998) yang menyatakan bahwa keragaman alokasi biomassa pohon kemungkinan disebabkan oleh perbedaan umur tegakan, kerapatan, dan kualitas tapak, dikarenakan produksi daun dan bagian cabang sangat sensitif terhadap cahaya, air, unsur hara, serta kondisi tanah lainnya. 92 Selanjutnya berdasarkan perbandingan antara persamaan allometrik yang dihasilkan dari penelitian ini dengan persamaan allometrik hasil penelitian di Cianten secara umum dapat dinyatakan bahwa nilai dugaan biomassa yang dihasilkan dari persamaan hasil penelitian di Tapanuli ternyata lebih mendekati niai biomassa aktualnya (hasil destructive samping). Menurut Chave et al. (2005), Raison et al. (2009), perbedaan dua model persamaan allometrik secara garis besar terkait dengan perbedaan beberapa informasi yang perlu diperhatikan didalam penyusunan persamaan allometrik yakni jenis vegetasi yang diduga biomassanya (spesifik jenis, kelompok jenis, campuran jenis), metode sampling, jumlah dan keterwakilan pohon sampel, jumlah dan ukuran plot inventarisasi, dan koreksi bias dalam penerapan persamaan. Terkait dengan perbedaan 2 model persamaan allometrik tersebut, Krisnawati (2010) menyarankan agar persamaan allometrik seharusnya tidak digunakan untuk menduga biomassa di luar rentang data/ukuran pohon yang digunakan untuk menyusun persamaan. Hal ini perlu diperhatikan untuk mendapatkan nilai dugaan biomassa dengan tingkat keakuratan dan kevalidan yang tinggi. Selanjutnya berdasarkan data stok karbon pada Tabel 23, dapat diketahui bahwa lokasi dengan kerapatan pohon P. merkusii strain Tapanuli tinggi memiliki kandungan biomassa dan simpanan karbon lebih tinggi dibanding lokasi yang kerapatan pohonnya rendah. Dolok Tusam Timur dan Dolok Tusam Barat merupakan hutan lindung dengan kondisi tegakan alam P. merkusii strain Tapanuli dalam keadaan rapat dan memiliki dimensi pohon besar. Kondisi inilah yang menjadikan kedua lokasi tersebut memiliki kandungan biomassa dan simpanan karbon jauh lebih besar dibanding lokasi lainnya. Kandungan biomassa atas kedua lokasi tersebut sedikit di bawah rata-rata stok karbon pada daratan di kawasan tropis Asia yakni 185 ton C/ha (Iverson et al. 1993). Namun jika mengacu pada nilai devault dari biomassa atas pada hutan hujan tropis yang dikeluarkan oleh IPCC (2006), maka kandungan biomassa untuk lokasi Dolok Tusam Timur dan Dolok Tusam Barat termasuk tinggi, yakni mendekati nilai devault sebesar 300 ton/ha. 93 PEMBAHASAN UMUM Pinus merkusii merupakan satu-satunya jenis tumbuhan daun jarum yang penyebarannya mampu melewati lintang selatan khatulistiwa (Cooling 1968). Di Indonesia jenis ini menyebar secara alami di tiga lokasi yakni Takengon - Aceh, Tapanuli – Sumatera Utara, dan Kerinci – Sumatera Barat. Diantara ketiga populasi alam tersebut, hanya P. merkusii asal Aceh saja yang kini mengalami penyebaran cukup pesat hingga jauh melewati sebaran alaminya. Adapun penyebaran P. merkusii asal Tapanuli dan Kerinci, relatif masih stagnan di sekitar lokasi sebaran alaminya. Berdasarkan hasil analisis perubahan tutupan lahan, secara garis besar dapat diketahui bahwa tutupan hutan di lima lokasi sebaran alam P. merkusii strain Tapanuli yang diteliti relatif dalam kondisi stabil. Ada tiga lokasi yang kondisi tutupan hutannya relatif baik yakni Dolok Tusam Timur, Dolok Tusam Barat, dan Tolang. Kondisi ini terjadi kemungkinan sebagai dampak dari tercapainya kondisi klimaks pada struktur tegakan yang ada di tiga lokasi tersebut. Struktur tegakan alam P. merkusii strain Tapanuli yang mencapai klimaks tersebut secara umum mempengaruhi terhadap karakter regenerasi, struktur genetik, dan kandungan biomassa karbonnya. Berdasarkan hasil analisis struktur tegakan, dapat diketahui bahwa karakter regenerasi alam pada lokasi dengan tutupan hutan lebat (Dolok Tusam Barat, Dolok Tusam Timur, dan Tolang) secara umum memang menunjukkan kurva J terbalik yang merupakan salah satu ciri bentuk struktur tegakan di hutan alam (Lamprecht 1989). Namun jika dirinci lebih lanjut berdasarkan tingkat perkembangan pohonnya maka dapat diketahui adanya ketimpangan di dalam struktur tegakan populasi alam P. merkusii strain Tapanuli tersebut, yaitu jumlah anakan P. merkusii strain Tapanuli sangat rendah pada sebaran alaminya. Sebaliknya untuk jenis lain, jumlah anakannya relatif lebih banyak dibanding P. merkusii strain Tapanuli. Kondisi ini tentu akan menjadi salah satu faktor penghambat berkembangnya anakan alami yang tumbuh di dalam hutan. Akibatnya anakan alam P. merkusii strain Tapanuli yang sempat muncul, dalam perkembangannya tidak mampu bersaing dengan jenis non pinus. 94 Hal ini sekaligus menjawab bentuk struktur tegakan P. merkusii strain Tapanuli yang sedikit atau bahkan tidak ada jumlah pancang dan tiangnya. Berdasarkan hasil analisis pengelompokan secara genetik, dapat diketahui bahwa lokasi dengan tingkat kerapatan tutupan hutan yang relatif sama akan berada pada kelompok yang sama. Karenanya, lokasi Dolok Tusam Barat dan Dolok Tusam Timur yang relatif memiliki tingkat penutupan hutan paling rapat, berada pada kelompok yang sama. Sebaliknya untuk lokasi Lobugala dengan tingkat tutupan hutan terendah, berada pada kelompok tersendiri. Kemudian untuk lokasi Parinsoran dan Tolang yang memiliki tingkat tutupan hutan relatif sama, berada pada satu kelompok genetik yang sama. Berdasarkan analisis pengelompokan genetik dapat diketahui juga ternyata lokasi dengan tingkat fragmentasi yang sama secara genetik akan mengelompok dalam kelompok yang sama. Kelompok pertama adalah untuk lokasi yang tidak terfragmentasi yakni Dolok Tusam Timur dan Dolok Tusam Barat. Kemudian kelompok kedua adalah untuk lokasi yang terfragmentasi yakni Tolang, Parinsoran, dan Lobugala. Untuk kelompok yang terfragmentasi ini, dibagi menjadi dua sub kelompok. Sub kelompok pertama adalah untuk lokasi yang tingkat fragmentasinya menengah yakni Parinsoran dan Tolang, dan sub kelompok kedua adalah lokasi yang paling terfragmentasi yakni Lobugala. Berdasarkan data stok karbon pada Tabel 23, dapat diketahui bahwa secara garis besar berdasarkan jumlah stok karbonnya, kelima lokasi penelitian dapat dikelompokkan menjadi tiga. Kelompok pertama adalah Dolok Tusam Timur (stok karbon 187,8 ton C/ha) dan Dolok Tusam Barat (stok karbon 190.4 ton C/ha) yang memiliki kandungan stok karbon tinggi. Kelompok kedua adalah lokasi Lobugala dengan stok karbon 93.2 ton C/ha. Kelompok ketiga adalah lokasi Parinsoran ( stok karbon 48.9 ton C/ha) dan Tolang (stok karbon 45.7 ton C/ha). Pola pengelompokan stok karbon tersebut ternyata persis sama dengan pola pengelompokan berdasarkan kedekatan genetiknya. Hal ini secara tidak langsung mengindikasikan bahwa kemampuan suatu tegakan alam P. merkusii strain Tapanuli didalam menyerap karbon juga dipengaruhi oleh faktor genetik. Populasi alam yang berada pada kekerabatan genetik yang dekat akan memiliki stok karbon yang sama. Berdasarkan pengelompokan ini secara umum dapat dinyatakan 95 bahwa populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Timur dan Dolok Tusam Barat memiliki struktur genetik yang mampu menjadikan populasi ini memiliki stok karbon yang tinggi. Bertitik tolak dari uraian di atas, maka ada beberapa hal yang perlu diperhatikan untuk pengelolaan populasi alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara sebagai berikut: a. Untuk keperluan pelestarian materi genetik P. merkusii strain Tapanuli, maka lokasi Dolok Tusam Barat merupakan lokasi yang direkomendasikan untuk dijadikan sebagai sumber benih. b. Untuk keperluan pelestarian biomassa karbon, maka lokasi hutan lindung Dolok Tusam Barat dan Dolok Tusam Timur merupakan lokasi yang direkomendasikan untuk dijaga kelestariannya sehingga stok karbon yang ada saat ini tidak berkurang. c. Untuk keperluan kesinambungan regenerasi alam P. merkusii strain Tapanuli, maka Lobugala, Parinsoran, dan Tolang direkomendasikan sebagai lokasi untuk perbanyakan anakan alam P. merkusii strain Tapanuli. 97 SIMPULAN Berdasarkan hasil dan pembahasan pada bab sebelumnya, maka simpulan dari penelitian ini sebagai berikut: a. Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui kondisi tutupan hutan di lima lokasi penelitian relatif stabil. Bahkan di lokasi Lobugala, tutupan hutannya meningkat. Selanjutnya berdasarkan analisis sifat kimia tanah dapat diketahui kandungan karbon tanah di lima lokasi penelitian berkisar antara 46,1- 89 ton C/ha. Kandungan karbon tanah tertinggi ditemukan di Lobugala, sedangkan yang terendah di Parinsoran. Adapun berdasarkan analisis struktur tegakan dapat diketahui bahwa kelima lokasi penelitian mengalami defisit permudaan alam P. merkusii strain Tapanuli. b. Berdasarkan hasil analisis genetik dapat diketahui nilai heterosigositas harapan (He) pada lima populasi alam P. merkusii strain Tapanuli berkisar antara 0,3779 hingga 0,4693. Nilai He tertinggi dimiliki oleh populasi alam P. merkusii strain Tapanuli yang tumbuh di Lobugala, sedangkan yang terendah dimiliki oleh populasi alam Dolok Tusam Barat. Namun demikian, berdasarkan nilai heterosigositas aktualnya, hanya populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang mengalami surplus heterosigositas. Selanjutnya berdasarkan kedekatan jarak genetiknya, kelima populasi alam P. merkusii strain Tapanuli mengelompok menjadi dua kelompok besar. Kelompok pertama terdiri atas populasi Dolok Tusam Timur dan Dolok Tusam Barat. Adapun kelompok kedua terdiri atas dua sub kelompok. Sub kelompok pertama terdiri atas populasi Parinsoran dan Tolang, sedangkan sub kelompok kedua hanya terdiri populasi Lobugala. c. Persamaan allometrik terbaik untuk pendugaan biomasa karbon P. merkusii strain Tapanuli menggunakan peubah bebas diameter setinggi dada (DBH) dengan model persamaan sebagai berikut: untuk pendugaan biomassa di bagian atas tanah adalah Y = 0,1900(DBH)2,2730 R² = 0,97980, R2adj=0,979317, RMSE=0,177670; untuk pendugaan biomassa akar adalah Y = 0,0283(DBH)2,4393 , R² = 0,90240, R2adj=0,900094 98 RMSE=0,436644; dan 2,2757 0,2451(DBH) untuk pendugaan biomassa total adalah Y= R² = 0,97840 R2adj= 0,977900 RMSE=0,183996. Stok karbon P. merkusii strain Tapanuli di 5 lokasi penelitian sbb: Dolok Tusam Timur 187,8 ton C/ha, Parinsoran 48,9 ton C/ha, Dolok Tusam Barat 190,4 ton C/ha, Lobugala 93,2 ton C/ha, dan Tolang 45,7 ton C/ha. SARAN Beberapa saran diajukan untuk menindaklanjuti hasil penelitian ini, sebagai berikut: a. Agar proses regenerasi populasi alam P. merkusii strain Tapanuli dapat terjadi secara lestari dan optimal maka di setiap lokasi sebaran alam P. merkusii strain Tapanuli perlu dibuat tempat khusus untuk pemeliharaan semai alam sehingga pertumbuhannya optimal. b. Agar potensi genetik P. merkusii strain Tapanuli tetap terjaga dengan baik maka populasi alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara perlu dikelola lebih baik oleh pemerintah. c. Agar potensi kandungan karbon yang ada di dalam kawasan hutan lindung Dolok Tusam – Tapanuli Utara tetap terjaga dan terevaluasi secara kontinyu dengan tingkat keakuratan yang tinggi maka pemerintah perlu kembali menata dan memantapkan tata batas kawasan hutan lindung Dolok Tusam – Tapanuli – Sumatera Utara. ANALISIS PERUBAHAN TUTUPAN LAHAN, STRUKTUR GENETIK, DAN KANDUNGAN BIOMASSA KARBON Pinus merkusii Jungh. et de Vriese strain TAPANULI PADA SEBARAN ALAMINYA DI SUMATERA UTARA ALFAN GUNAWAN AHMAD SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2012 99 DAFTAR PUSTAKA Auckland L, Thomas B, Yi Z, Mervyn S, Claire W. 2002. Conifer Microsatellite Handbook. Texas A&M University. College Station. Texas. Angelsen A. 2009. Realising REDD+. National Strategy and Policy Options. CIFOR. Bogor . Arifin HS, Wulandari C, Pramukanto Q, Kaswanto RL. 2009. Analisis Lanskap Agroforestry. Bogor: IPB Press. Arifin HS, Nakagoshi N. 2011. Landscape ecology and urban biodiversity in tropical indonesian cities. J Landscape Ecol Eng 7:33-43. Brown S. 2002. Meassuring, Monitoring, and Verification of Carbon Benefits for Forest Based Projects. Phill. Trans. R. Soc.Lond . Brown S. 1997. Estimating Biomass and Biomass Change of Tropical Forests: a Primer. (FAO Forestry Paper - 134). FAO, Rome. Basuki TM, Adi RN, Sukresno. 2004. Informasi Teknis Stok Karbon Organik dalam Tegakan Pinus merkusii, Agatihis lorantifolia dan Tanah. Prosiding Ekspose BP2TPDAS-IBB Surakarta, 3 Agustus 2004. Burley J. 1976. Genetics Systems and Genetic Conservation of Tropical Pines. Dalam: Burley J. Dan B.T. Styles (Eds). Tropical Trees: Variation, Breeding and Conservation, Linn Soc. Symp. Series No.2. London- New York: Academic Press. Chave J, Andalo C, Brown S, Cairans MA, Chambers JQ, Folster H, Eamus D, Folster H, Fromard F, Huguchi N, Kira T, Lescure JP, Nelson WB, Ogawa H, Puig H, Riera B, Yamakura T. 2005. Tree allometry and improved estimation of carbon stocks and balance in tropical forests. J Oecologia 145: 87-99. Chen CR, Condroa LM, Davis MR, Scordock RR. 2000. Effects of afforestation on posphorus dynamics and bioligical properties in a New Zealand grassland soil. J Plant Soil 220: 151-163. Cooling ENG. 1968. Fast Growing Timber Trees of the Lowland Tropics No. 4. Pinus merkusii. Department of Forestry, University of Oxford, Commonwealth Forestry Institute, England. Devey ME, Fiddler T, Liu B, Knapp S, Neale D. 1994. An RFLP Linkage Map For Loblolly Pine Based Not A Three-Generation Outbreed Pedigree. J Theor.Appl.Genet. 00:656-662 . Echeverria C. 2011. How Landscape Change: Integration of Spatial Patterns and human Processes in Temperate Landscape of Southern Chile. J Applied Geography 32 : 822-831. Ellingson LJ, Kauffman JB, Cummings DL, Sanford RL, Jaramillo VJ. 2000 Soil N Dynamics Associated With Deforestation, Biomass Burning, and Pasture Conversion in a Mexican Tropical dry Forest. J Forest Ecology and Management 137 : 41-51. 100 Fandeli C. 1977. Beberapa Pinus yang Tumbuh di Asia Tenggara, Yogyakarta: Yayasan Pembina Fakultas Kehutanan – Universitas Gajah Mada. [FAO] Food and Agriculture Organization. 2010. Global Forest Resources Assessment. Main report. FAO Forestry Paper 163. Rome. 371 p. [FAO] Food and Agriculture Organization. 2000. Land Cover Classification Syatem. Geo Spatial Data And Information. Rome. Finkeldey R. 2005. Pengantar Genetika Hutan Tropis. E. Jamhuri , I.Z. Siregar, U.J. Siregar dan A.W. Kertadikara, penerjemah. Gottingen : Institute of Forest Genetics and Forest Tree Breeding Georg-August-UniverityGöttingen. Terjemahan dari : An Introduction to Tropical Forest Genetics Fitzsimmons MJ, Pennoek DJ, Thorpe J. 2003. Effects of Deforestation on Ecosystem Carbon Densites in Central Sasktachewan. J Forest Ecology and Management 188:349-361. Fitzsimmons M. 2001. Effects of Deforestation and Reforestation on Landsacape Spatial Structure in Boreal Saskatchewan. J Forest Ecology and Management 173:577-592. Forest Watch Indonesia. 2011. Potret Keadaan Hutan Indonesia Periode Tahun 2000-2009. Ed-Pertama. Foth HD. 1990. Fundamentals of Soil Science. Eight edition. United Stated of America: John Wiley & Sons. Guo LB, Gifford RM. 2002. Soil carbon stocks and land use change: a meta analysis. J Glob Chang Biol 8:345-360. Harahap RMS, Aswandi. 2008. Pengembangan dan Konservasi Tusam (Pinus merkusii) Strain Tapanuli dan Kerinci. http://restoreourforest.blogspot.com. pengembangan dan-konservasi-tusam-pinus.html (1 of 14)11/17/2008 5:22:50 AM. Harahap RMS. 2000a. Status Hutan Alam Pinus merkusii di Sumatera Saat Ini. Prosiding Seminar Nasional Sistem Silvikultur 1999: Peluang dan Tantangan Menuju Produktivitas dan Kelestarian Sumberdaya Hutan Jangka Panjang. Wanagama I, 1-2 Desember 1999. Editor: Eko B. Hariyanto. Fakultas Kehutanan – Universitas Gajah Mada. Yogyakarta. Harahap RMS. 2000b. Keragaman Sifat dan Data Ekologi Populasi Alami Pinus merkusii. Prosiding Seminar Nasional Sistem Silvikultur 1999: Peluang dan Tantangan Menuju Produktivitas dan Kelestarian Sumberdaya Hutan Jangka Panjang. Wanagama I, 1-2 Desember 1999. Editor: Eko B. Hariyanto. Fakultas Kehutanan – Universitas Gajah Mada. Yogyakarta. Harahap RMS. 2000c. Uji Asal Benih Pinus merkusii di Sumatera Utara. Prosiding Seminar Nasional Sistem Silvikultur 1999: Peluang dan Tantangan Menuju Produktivitas dan Kelestarian Sumberdaya Hutan Jangka Panjang. Wanagama I, 1-2 Desember 1999. Editor: Eko B. Hariyanto. Fakultas Kehutanan – Universitas Gajah Mada. Yogyakarta. 101 Harahap RMS, Mukti A. 1976. Pengamatan strobli dan percobaan orientasi penyerbukan terkendali dan tanpa pelindung. Laporan Nomor 237. Bogor: Lembaga Penelitian Hutan. Hardiyanto EB, Danarto S. 2000. Ex situ Conservation of Pinus merkusii in Java, Indonesia. Dalam: Proceeding of the International Conference on Ex situ and In situ Conservation of Commercial Tropical Trees. 11-13 June 2001. Yogyakarta Husaeni EA. 1996. Hama Hutan di Indonesia. Kerjasama Proyek Pendidikan dan Latihan dalam Rangka Pengindonesiaan Tenaga Kerja Pengusahaan Hutan dengan Fakultas Kehutanan. Bogor: Institut Pertanian Bogor. Indrioko S. 1996. Studi Variasi Genetik Pinus merkusii Jungh et de Vriese di Pulau Jawa dengan Analisis Isozim [Tesis S2]Bogor: Program Pascasarjana Universitas Gadjah Mada; 1996. [IPCC] Intergovernmental Panel on Climate Change. 2003. Good Practice Guidance for Land Use, Land-Use Change and Forestry. Intergovernmental Panel on Climate Change National Greenhouse Gas Inventories Programme. www.ipcc-nggip.iges.or.jp/lulucf/gpglulucf_unedit.htmlTH [IPCC] Intergovernmental Panel on Climate Change . 2006. Agriculture, forestry and other land use . In: Eggleston HS, Buendia L, Miwa K, Ngara T, Tanabe K. (Eds.). IPCC Guidelines for National Greenhouse Gas Inventories, Prepared by the National Greenhouse Gas Inventories Programme. IGES. Japan. [ITTO] International Tropical Timber Organization. 2011. ITTO. Status of Tropical Forest Management 2011. ITTO Technical Series No 38. Prepared by J. Blaser, A. Sarre. [ITTO] International Tropical Timber Organization. 2009. Guidelines for the Conservation and Sustainable Use of Biodiversity in Tropical Timber Production Forests. ITTO Policy Development Series No 17. [ITTO] International Tropical Timber Organization. 2002. ITTO guidelines for the restoration, management and rehabilitation of degraded and secondary tropical. [ITTO] International Tropical Timber Organization. 1997. Guidelines for Fire Management in Tropical Forests. ITTO Policy Development Series No 6. [ITTO] International Tropical Timber Organization. 1997. Guidelines for Fire Management in Tropical Forests. ITTO Policy Development Series No 6. [ITTO] International Tropical Timber Organization. 1993. Guidelines for the establishment and sustainable management of planted tropical forests. Iverson RI, Brown S, Grainger A. 1993. Carbon Sequestration in Tropical Asia: an Assessment of Technically Suitable Forest Lands Using Geographic Information Systems Analysis. J Climate Research 3: 23-38. [IUCN] International Union for Conservation of Nature and Natural Resources . 2012. Conifer Specialist Group 2000. Pinus merkusii. IUCN Red List of Threatened Species. Version 2011.1.[terhubung berkala]. http://www.iucnredlist.org. [27 Sept 2012]. 102 [JIFRO] Japan International Forestry Consultants Assosiation . 2000. Manual of Biomass Measurements in Plantation and in Regenerated Vegetation. Japan. Karhu A. 2001. Evolution and application of pine microsatellites. [Desertation]. Linnanmaa: Faculity of Science University of Oulu.2001. Kartikawati NK. 1998. Studi variasi genetik Tusam (Pinus merkusii Jungh et de Vriese) pada hutan alam di Aceh dan hutan tanaman di Jawa dengan Metode Analisis Isozim. [Tesis] S2. Yogyakrata : Program Pascasarjana – Universitas Gadjah Mada. Kartikawati NK. 1996. Pewarisan pola berkas jaringan megagametofit pinus merkusii jungh et de vriese dengan menggunakan metode isozim. [Skripsi]. Yogyakarta Fakultas Kehutanan Universitas Gadjah Mada. Kartikawati NK, Na'iem M. 1999. Study of genetic variation of Pinus merkusii natural and plantation forest using Isozyme Technique. J Agrosains 12 (1), Januari 1999. [Kemenhut] Kementrian Kehutanan. 2010. Statistik Kehutanan. Planologi Kehutanan. Jakarta: Departemen Kehutanan RI. Koskela J, Kuusipalo J, Sirikul W. 1995. Natural regeneration dynamics of pinus merkusii in northern thailand. J Forest Ecology and Management 77 : 169- 179. Korner C, Asshof R, Bignucolo O, Hattenschwiler S, Keel SG, Ried SP, Pepin S, Siegwof RW, Zotz G. 2005. Carbon flux and growth in mature deciduous forest trees exposed to elevated CO2. J Science 309(5739) : 1360-1362. Krisnawati H. 2010. Status data Stok Karbon Dalam Biomas Hutan di Indonesia In: REDD+ & Forest Governance. Editor: N. Masripatin dan C. Wulandari. Pusat Penelitian dan Pengembangan Perubahan Iklim dan Kebijakan. Badan Penelitian dan Pengembangan Kehutanan – Kementerian Kehutanan Republik Indonesia. Kutil BL, Williams CG. 2001. Triplet repeat micro-satellites shared among hard and soft pines. J Of He-Redity 92:327-332 Lagercrantz U, Ellegren H, Andersson L. 1993. Abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. J Nucleic Ac-Ids Research 21: 1111-1115. Lamb AFA, Cooling NG. 1967. Exploration, Utilization and Conservation of Low Altitute Tropical Pine Gene Resources. Food and Agriculture Organization of The United Nations. Rome. Lambers H, Chapin FS, Pons TL. 1998. Plant Physiological Ecology. Newyork: Spinger-Verlag. Lamprecht H. 1989. Silviculture in The Tropics. Tropical Forest Ecosystem and Their Tree Species – Possibilities and Methods for Their Long Term Utilization. Federal Republic of Germany: Technical Cooperation. Li YC, Korol AB, Fahima T, Beiles , Nevo E. 2002. Microsatellites: genomic distribution, putative functions and mutational mechanisms: a Review. J Mol. Ecol. 11: 2453-2465. 103 Lira PK, Tambosi LR, Ewers RM, Metzger JP. 2012. Land-use and land-cover in atlantic forest landscapes. J Forest Ecology and Management 278: 80-89. Mangold R. 1997. Forest Health Monitoring: Field Methods Guide. USDA Forest Service. NC 27709. USA: FHM Monitoring Program, Research Triangle Park. Munawar AA. 2002. Studi keragaman genetik tusam (pinus merkusii jungh et de vriese) di hutan alam tapanuli dan kerinci dengan analisis isozim serta implementasinya dalam konservasi [Tesis] Yogyaklarta:Program Pascasarjana, Universitas Gajah Mada. Myers N. 1996. The world’s forests: problems and potentials. J Environ. Conserv. 21: 156–168. Nurtjahjaningsih ILG, Saito Y, Lian CL, Tsuda Y, Ide Y. 2005. Development and characteristics of microsatellite markers in Pinus merkusii. J Molecular Ecology Notes 5: 552-553. Parfitt RL, Scott NA, Ross DJ, Salt GJ, Tate KR. 2003. Land use change effects on soil C and N transformation in soils of high N status: comparisons under indigenous forest, pasture, and pine plantation. J Biogeochemistry 66:203221. Pili R, Anfodillo T, Carrer M. 2006. Towards a functional and simplified allometry for estimating forest. J Forest Ecol Manag 237(1-3): 583-593 Pritchett WL. 1979. Properties and Management of Forest Soils, Chapter 11: Mycorrhizal: Forms And Function. Raison J, Waterworth R, Twomey A. 2009. Guidelines for evaluation and use of allometric equations and biomass C data sourced from the review of available information. Racmatsyah O, Haneda NF. 2007. Pengendalian Kutu Lilin pada Pinus merkusii secara kimia. Fakultas Kehutanan, Institut Pertanian Bogor dan Perum Perhutani. Ross DJ, Tate KR, Scott NA, Felthman CW. 1999. Land-use change effects on soil carbon, nitrogen, and phophorus pools and fluxes in three adjacent ecosystems. J Soil biol Biochm 31: 803-813. Salisbury FB, Ross CW. 1995. Fisiologi Tumbuhan, Jilid 2. Penerjemah: Diah RL, Sumaryono. Bandung :Penerbit ITB. Saroinsong F, Harashina K, Arifin H, Gandasasmita K, Sakamoto K. 2007. Practical application of a land resources information system for agricultural landscape planning. J Landscape and Urban Planning 79 :38-52. Scott LJ, Shepherd M, Dieters MJ, Nikles G, Henry RJ. 2001. Characteristic Of Microsatellites Loci In Araucaria Cunninghamii And Transfer To Related Species. Plant Systemic And Evolution. Sebben AM, Degen B, Azevedo VCR, Silva MB, de Lacerda AEB, Ciampi AY, Kanashiro M, Carneiro FS, Thompson I, Loveless MD. 2008. Modelling the long-term impacts of selective logging on genetic diversity and 104 demographic structure of four tropical tree species in the Amazon forest. J Forest Ecol Manag 254: 335–349 Siregar CA. 2011. Develop Forest Carbon Standard and Carbon Accounting System for Small-scale Plantation Based on Local Experinces. Indonesia’s Ministry of Forestry – International Tropical Timber Organization. RED-PD 007/09 Rev.2 (F). Siregar CA. 2007. Pendugaan Biomassa pada Tanaman Pinus (pinus merkusii jungh et de vriese) dan Konservasi Karbon Tanah Cianten, Jawa Barat. Ringkasan Hasil-hasil Penelitian. Bogor: Badan Litbang Kehutanan. Departemen Kehutanan RI. Siregar IZ, Hattemer HH. 1999. Genetic variation of Pinus merkusii Jungh et de vriese in Indonesia. Scientific paper at Deutscher Tropentag 1999 in Berlin, Session: Biodiversity and Development of Plant Genetic Resources. Smith J. 1963. Manual of Malayan Silviculture Part I – III. Malayan Forest Record No.23. Forest Research Institute, Kepong – Malaysia. Suhaendi H. 1988. Pendugaan parameter-parameter genetika-ekologi dari beberapa sifat kuantitatif dalam hutan tanaman Pinus merkusii Jungh et de vriese strain tapanuli dan strain Aceh [Disertasi] Bogor: Program Pascasarjana. Institut Pertanian Bogor;1988. Suhaendi H. 2005. Kajian konservasi Pinus merkusii strain Tapanuli di Sumatera. J Analisis Kebijakan Kehutanan 2(1) : 45-57. Suhendang E. 1995. Ukuran Kenormalan Pada Hutan Tidak Seumur. Di dalam: Penerapan Ekolable Di Hutan Produksi. Prosiding Simposium Penerapan Ekolable di Hutan Produksi; Jakarta, 10-12 Agustus 1995. hlm 249-263. Tan KH. 1993. Principles of Soil Chemistry. Second edition. New York: Marcell Dekker, Inc. Tisdale SL, Nelson WL, Beaton JD. 1985. Soil Fertility And Fertilizers. Fourth edition. United States of America : Macmillaan Publishing Company. Turner BL, Lambin EF, Reenberg A. 2007. Land change science special feature The emergence of land change science for global environmental change and sustainability. Proceedings of the National Academy of Sciences of the United States of America 104: 20672–20677. Turner MG, Pearson SM, Boistad P, Wear DN. 2003. Effects of land-cover change on spatial pattern of forest communities in the southern appalachian mountains (USA). J Landscape Echology 18: 449-464. Vendramin G, Hansen OK. 2005. Molecular markers for characterizing diversity in forest trees’ in ‘Conservation and management of forest genetic resources in Europe Te Geburek and J. Turok (eds) Arbora Publish-er, Zvolen ISBN 80-967088-1-3. Wang Z, Weber JL, Zhong G, dan Tanksley SD. 1994. Survey of plant short tandem dna repeats. J Theor. Appl. Gene. 88:1- 6. [WCFSD] World Commission on Forests and Sustainable Development. 1999. Sustainable Forest Management. Issues paper. 42 p. 105 Weising K, Nybom H, Wolff K, Kahl G. 2005. Repetitive DNA. In DNA Fingerprinting In Plants: Principles, Methods, And Applications. 2. ed. Boca Raton FL: Taylor & Francis. Xiang W, Liu S, Deng X, Shen A, Lei X, Tian D, Zhao M, Peng C. 2011. Generala allometric equation and biomass allocatioan of Pinus massoniana trees on a regional scale in southern China. J Eco Res 26: 697-711. Yafid B, Jafarsidik YS. 2005. Permudaan Pinus merkusii jungh et de vriese galur kerinci, potensi dan komposisi tegakan di kawasan bukit Tapan, Taman Nasional Kerinci Seblat. Info Hutan II (2):145-152. Zhang DX, Hewitt GM. 2003. Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. J Mol. Ecol 12:563-584. 106 Lampiran 1. Kondisi tutupan lahan pada ekosistem daratan Tapanuli pada tahun 1994, 2005, dan 2011 No Tutupan lahan Luas (Ha) Laju perubahan luas (Ha/tahun) Keterangan 2005 2011 1994-2005 2005-2011 1994-2011 79.743,64 78.570,98 -86,2 -195,4 -124,8 Menurun 84.393,23 85.097,75 52,27 117,4 75,3 Meningkat 800,46 1.268,61 33,97 78,0 49,5 Meningkat 164.937,33 164.937,33 1994 1. Hutan 80.692,25 2. Non Hutan 83.818,27 3. Log Over Area (LOA) 426,81 Jumlah 164.937,33 Lampiran 2. Kondisi tapak tumbuh tidak kering dan kering pada ekosistem daratan Tapanuli pada tahun 1994, 2005, dan 2011 No. 1. 2. 3. 4. 5. Kelas Kering Tidak Kering Kering Agak Kering Sangat Kering No Data (Awan) TOTAL Kelas kering Tidak kering Kering No Data (awan) Kelas kering Tidak kering Kering No Data (awan) 1994 (Ha) 114.600,36 44.080,34 6.214,99 41,64 0,00 164.937,33 2005 (Ha) 102.423,55 40.073,64 15.734,21 2.854,94 3.850,99 164.937,33 2011 (Ha) 105.492,27 26.039,78 5.455,48 1.708,51 26.241,29 164.937,33 Trend 1994 2005 2011 1994-2005 2005-2011 1994-2011 114600,36 102423,55 105492,27 -12176,81 -1106,98 3068,72 511,45 -9108,09 -535,77 50336,97 58662,79 33203,77 8325,82 756,89 -25459,02 -4243,17 -17133,20 -1007,84 0,00 3850,99 26241,29 3850,99 350,09 22390,30 3731,72 26241,29 1543,605 164937,33 164937,33 164937,33 1994 69,48% 30,52% 0,00% 100,00% 2005 62,10% 35,57% 2,33% 100,00% Trend 2011 1994-2005 2005-2011 63,96% -7,38% -0,67% 1,86% 20,13% 5,05% 0,46% -15,44% 15,91% 2,33% 0,21% 13,58% 100,00% 0,31% -2,57% 2,26% 1994-2011 -5,52% -10,39% 15,91% -0,32% -0,61% 0,94% 107 Lampiran 3. Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Lokasi : DOLOK TUSAM TIMUR Land Cover 1 2 3 Luas (Ha) 2.020,43 2020,43 1,81 9,74 4,72 1 2 3 4 16,27 2,35 165,44 49,59 30,96 DOLOK TUSAM TIMUR 2005 No Poligon Luas (Ha) 1 2.002,66 2.002,66 1 1,81 2 5,70 3 12,07 4 9,74 5 4,72 34,03 1 2,35 2 165,44 3 49,59 4 30,96 248,33 2285,03 248,33 2285,03 1994 Hutan Sub total LOA No Poligon 1 Sub total Non Hutan Sub total Jumlah Lokasi 2011 No Poligon 1 1 2 3 1 2 3 4 5 Luas (Ha) 1.990,70 1.990,70 36,98 1,45 4,72 43,15 2,35 165,44 2,85 49,59 30,96 251,18 2.285,03 : PARINSORAN Land Cover PARINSORAN 1994 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) No Poligon Luas (Ha) Hutan 1 197,60 1 197,60 1 195,58 2 0,02 2 0,02 2 0,02 3 728,39 3 709,42 3 659,31 Sub total 926,00 907,04 854,92 LOA 1 188,25 1 188,25 1 2,01 2 3,31 3 201,98 Sub total 188,25 188,25 207,31 Non Hutan 1 1.170,78 1 1.189,75 1 4,95 2 1.217,86 Sub total 1170,78 1189,75 1.222,81 Jumlah 2285,03 2285,03 2.285,03 Lokasi : DOLOK TUSAM BARAT Land Cover Hutan Sub total LOA Sub total Non Hutan Sub total Jumlah DOLOK TUSAM BARAT 1994 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) No Poligon Luas (Ha) 1 1.651,31 1 1.651,31 1 1.644,89 1651,31 1.651,31 1.644,89 1 10,62 1 10,62 1 17,04 10,62 10,62 17,04 1 134,63 1 134,63 1 134,63 2 488,46 2 488,46 2 488,46 623,10 623,10 623,10 2285,03 2285,03 2.285,03 108 Lokasi : LOBUGALA Land Cover Hutan Sub total LOA Sub total Non Hutan Sub total Jumlah Lokasi 1994 No Poligon Luas (Ha) 1 197,09 2 92,49 289,59 1 4,14 4,14 1 1.991,30 1991,30 2285,03 LOBUGALA 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) 1 197,09 1 201,24 2 92,49 2 92,49 289,59 293,73 1 4,14 4,14 1 1.991,30 1 1.991,30 1991,30 1.991,30 2285,03 2.285,03 : TOLANG – AEK BILAH Land Cover AEK BILAH 1994 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) No Poligon Luas (Ha) Hutan 1 1.640,69 1 1.610,92 1 1.583,17 2 0,69 Sub total 1640,69 1.611,61 1.583,17 LOA 1 4,57 1 2,79 2 6,60 2 6,90 3 6,60 4 2,82 5 3,09 6 2,87 Sub total 11,17 25,07 Non Hutan 1 214,91 1 214,91 1 226,35 2 418,26 2 458,51 2 450,44 Sub total 633,17 673,42 676,79 Jumlah 2285,03 2285,03 2.285,03 109 Lampiran 4. Kondisi penggunaan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Lokasi : DOLOK TUSAM TIMUR Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah Lokasi DOLOK TUSAM TIMUR 1994 2005 2011 No. Poligon Luas (Ha) No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 2.020,43 1 2.011,25 1 2.004,15 Sub Total 2.020,43 Sub Total 2.011,25 Sub Total 2.004,15 1 2,35 1 1,81 1 1,81 2 1,81 2 9,55 2 9,55 3 9,55 3 11,53 3 3,19 4 9,74 4 9,74 4 11,53 5 4,72 5 4,72 5 3,90 Sub Total 28,16 Sub Total 37,34 6 9,74 7 4,72 Sub Total 44,44 1 14,55 1 14,55 1 14,55 2 17,09 2 17,09 2 17,09 3 22,73 3 22,73 3 20,32 Sub Total 54,37 Sub Total 54,37 Sub Total 51,96 1 55,92 1 52,97 1 45,97 2 30,02 2 8,23 2 10,63 Sub Total 85,94 3 23,90 3 23,90 Sub Total 85,10 Sub Total 80,51 1 68,33 1 71,28 1 78,28 2 8,23 2 9,66 2 9,66 3 19,58 3 16,03 3 16,03 Sub Total 96,13 Sub Total 96,97 Sub Total 103,97 2.285,03 2.285,03 2.285,03 : DOLOK TUSAM BARAT Land Use Hutan Ilalang-semak Kebun Ladang Sawah DOLOK TUSAM BARAT 1994 2005 No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 1.651,31 1 1.651,31 Sub Total 1.651,31 Sub Total 1.651,31 1 16,93 1 13,73 2 10,62 2 10,62 3 15,94 3 4,63 4 65,84 4 15,94 5 13,73 5 65,73 Sub Total 123,06 6 11,91 7 4,25 Sub Total 126,80 1 110,36 1 97,87 2 69,83 2 19,89 Sub Total 180,19 Sub Total 117,76 1 33,24 1 35,58 2 35,62 2 105,73 3 4,89 3 41,62 4 114,23 4 58,23 Sub Total 187,98 Sub Total 241,16 1 2 3 Sub Total Jumlah 24,29 6,66 111,54 142,49 2.285,03 1 2 3 4 Sub Total 107,41 28,91 6,66 5,02 147,99 2.285,03 2011 No. Poligon Luas (Ha) 1 1.647,73 Sub Total 1.647,73 1 3,66 2 3,58 3 10,62 4 4,63 5 2,55 6 11,91 7 162,36 Sub Total 199,31 1 116,19 Sub Total 116,19 1 2 3 4 5 6 Sub Total 1 2 3 Sub Total 3,36 105,73 8,33 55,72 1,74 33,70 208,57 28,91 79,29 5,02 113,22 2.285,03 110 Lokasi : PARINSORAN Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah Lokasi PARINSORAN 1994 2005 2011 No. Poligon Luas (Ha) No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 197,60 1 197,60 1 197,60 2 0,02 2 0,02 2 712,44 3 728,39 3 728,39 Sub Total 910,03 Sub Total 926,00 Sub Total 926,00 1 5,87 1 8,45 1 66,74 2 1,39 2 5,13 2 31,09 3 2,46 Sub Total 13,59 3 2,23 4 1,69 4 22,62 5 4,56 5 14,40 6 13,13 6 15,53 7 7,14 7 3,76 Sub Total 36,24 8 7,71 Sub Total 164,08 1 232,84 1 77,40 1 77,40 Sub Total 232,84 2 190,69 2 176,40 Sub Total 268,08 Sub Total 253,79 1 165,64 1 106,08 1 23,10 2 22,35 2 22,35 2 106,08 3 188,25 3 188,25 3 48,01 Sub Total 376,24 Sub Total 316,68 4 5,93 5 22,35 Sub Total 205,47 1 82,84 1 113,03 1 117,52 2 630,86 2 647,65 2 634,13 Sub Total 713,70 Sub Total 760,68 Sub Total 751,65 2.285,03 2.285,03 2.285,03 : TOLANG – AEK BILAH Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah AEK BILAH 1994 2005 2011 No. Poligon Luas (Ha) No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 1.640,69 1 1.632,37 1 1.604,57 Sub Total 1.640,69 2 3,76 Sub Total 1.604,57 Sub Total 1.636,13 1 2,27 1 11,75 1 2,97 2 4,57 2 7,01 2 2,97 3 6,60 3 3,87 3 3,25 4 1,27 Sub Total 22,64 4 4,19 5 0,94 5 3,60 Sub Total 15,65 6 9,36 7 18,01 Sub Total 44,34 1 174,01 1 162,58 1 37,98 2 161,13 2 153,67 2 147,72 Sub Total 335,14 Sub Total 316,25 3 96,56 4 9,87 Sub Total 292,13 1 14,36 1 4,92 1 4,92 2 4,92 2 1,39 2 1,39 3 26,61 3 2,53 3 2,53 4 7,90 4 26,61 4 26,61 5 81,52 5 7,90 5 1,82 6 66,13 6 17,89 6 12,02 Sub Total 201,44 7 1,27 7 22,72 8 3,67 8 1,27 9 70,67 9 10,11 10 70,19 10 3,67 Sub Total 207,05 11 8,14 12 0,48 13 61,75 14 6,87 15 50,30 Sub Total 214,61 1 53,83 1 64,68 1 64,68 2 7,97 2 7,97 2 35,34 3 30,32 3 30,32 3 29,35 Sub Total 92,12 Sub Total 102,97 Sub Total 129,37 2.285,03 2.285,03 2.285,03 111 Lokasi : LOBUGALA Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah LOBUGALA 1994 2005 No. Poligon Luas (Ha) No. Poligon Luas 1 197,09 1 2 92,49 2 Sub Total 289,59 Sub Total 1 10,30 1 2 2,43 2 3 54,55 3 4 3,65 4 5 8,52 5 6 40,21 6 7 11,07 7 8 5,73 8 9 8,22 9 10 4,14 10 Sub Total 148,82 11 Sub Total 1 2 3 4 Sub Total 1 2 3 4 5 Sub Total 18,93 94,01 34,35 104,80 252,09 9,93 32,85 58,65 40,93 283,37 425,73 1 2 3 4 5 Sub Total 42,50 11,10 45,84 1.005,80 63,56 1.168,80 2.285,03 1 2 3 4 Sub Total 1 2 3 4 5 6 Sub Total 1 2 3 4 5 Sub Total 2011 (Ha) No. Poligon Luas (Ha) 201,24 1 201,24 92,49 2 92,49 293,73 Sub Total 293,73 10,30 1 2,49 2,43 2 12,23 17,44 3 6,73 12,40 4 11,31 54,55 5 12,83 3,65 6 6,98 8,52 7 11,92 11,07 8 13,84 63,78 9 19,02 8,22 10 11,53 8,59 11 9,54 200,95 12 8,59 Sub Total 127,01 11,31 1 98,27 98,27 2 31,62 34,35 3 140,66 124,39 Sub Total 270,55 268,32 9,93 1 9,93 32,85 2 32,85 75,15 3 6,87 40,93 4 59,31 69,84 5 349,68 195,96 Sub Total 458,63 424,66 42,50 1 20,62 11,10 2 146,91 45,84 3 930,57 940,65 4 37,01 57,27 Sub Total 1.135,11 1.097,37 2.285,03 2.285,03 112 Lampiran 5. Kondisi Tapak Tumbuh Tidak Kering dan Tapak Tumbuh Kering di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Lokasi : DOLOK TUSAM TIMUR Dolok Tusam Timur Derajat Kekeringan Tidak Kering Lokasi 1994 2005 2011 Luas (Ha) Luas (Ha) Luas (Ha) 1.930,33 1.642,47 1.764,39 Kering 325,13 304,74 69,72 Agak Kering 28,50 81,18 9,47 Sangat Kering 1,07 72,01 2,36 Awan 0,00 184,63 439,09 Jumlah 2.285,03 2.285,03 2.285,03 : PARINSORAN Parinsoran Derajat Kekeringan 2005 2011 Luas (Ha) Luas (Ha) Luas (Ha) 1.224,61 1.295,36 1.215,25 Kering 948,42 784,86 579,35 Agak Kering 111,79 187,74 44,78 Sangat Kering 13,83 4,18 Awan 0,21 0,00 3,23 441,47 Jumlah 2.285,03 2.285,03 2.285,03 Tidak Kering Lokasi 1994 : DOLOK TUSAM BARAT Derajat Kekeringan Tidak Kering Kering Agak Kering Sangat Kering Awan Jumlah Dolok Tusam Barat 1994 2005 2011 Luas (Ha) Luas (Ha) Luas (Ha) 1.910,35 1.139,93 1.656,86 336,87 486,48 201,20 37,66 171,16 34,96 0,16 136,25 12,37 0,00 351,22 379,64 2.285,03 2.285,03 2.285,03 113 Lokasi : LOBUGALA Derajat Kekeringan Tidak Kering Kering Agak Kering Sangat Kering Awan Jumlah Lokasi 1994 Luas (Ha) 1.034,05 1.069,24 181,61 0,13 0,00 2.285,03 Lobugala 2005 Luas (Ha) 547,20 490,09 677,19 182,70 387,85 2.285,03 2011 Luas (Ha) 748,62 563,80 326,45 122,35 523,81 2.285,03 : TOLANG Lampiran 6. Hasil pengolahan skoring mikrosatellite dengan menggunakan software Popgene 1.32 POPULATION GENETIC ANALYSIS of Pinus merkusii strain Tapanuli ** Single-Population Descriptive Statistics ** population ID : 1 population name : DOLOK TUSAM TIMUR * Population : 1 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 2.7576 0.2081 -1.2848 (2, 1) 10 7.2121 1.0777 6.5364 (2, 2) 2 4.1212 1.0918 -2.8920 (3, 1) 0 1.2727 1.2727 0.0000 (3, 2) 3 1.5455 1.3690 3.9798 (3, 3) 0 0.0909 0.0909 0.0000 ========================================================== == 114 Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.110213 Degree of freedom : 3 Probability : 0.163902 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 6.339385 Degree of freedom : 3 Probability : 0.096217 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 3.1818 0.0104 -0.3530 (2, 1) 9 6.8182 0.6982 4.9974 (2, 2) 1 3.1818 1.4961 -2.3149 (3, 1) 0 1.8182 1.8182 0.0000 (3, 2) 4 1.8182 2.6182 6.3077 (3, 3) 0 0.1818 0.1818 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.822857 Degree of freedom : 3 Probability : 0.077763 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.637082 Degree of freedom : 3 Probability : 0.034526 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 4 0.8485 11.7056 12.4048 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 6.3030 6.3030 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 13 9.8485 1.0085 7.2184 115 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 19.017143 Degree of freedom : 1 Probability : 0.000013 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.623204 Degree of freedom : 1 Probability : 0.000009 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 12 8.3636 1.5810 8.6643 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 5 1.3636 9.6970 12.9928 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 5 1.3636 9.6970 12.9928 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 12 8.3636 1.5810 8.6643 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : 116 G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 1 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.4118 0.4412 0.2353 0.7059 0.2941 Allele 2 0.5000 0.4412 0.2941 0.7059 Allele 3 0.0882 0.1176 0.7647 ========================================================== ============ Summary Statistics of population 1 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** *************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 3.0000 2.3401 0.9261 Pm05 34 3.0000 2.4807 0.9738 Pm07 34 2.0000 1.5622 0.5456 Pm04 34 2.0000 1.7101 0.6058 Pm08 34 2.0000 1.7101 0.6058 Mean 34 2.4000 1.9606 0.7314 St. Dev 0.5477 0.4180 0.2017 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** **************** ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== 117 Pm01 34 0.2353 0.7647 0.4100 0.5900 0.5727 0.5298 Pm05 34 0.2353 0.7647 0.3850 0.6150 0.5969 0.5486 Pm07 34 1.0000 0.0000 0.6292 0.3708 0.3599 0.4752 Pm04 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3769 Pm08 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3399 Mean 34 0.6941 0.3059 0.5137 0.4863 0.4720 0.4541 St. Dev 0.4188 0.4188 0.1090 0.1090 0.1058 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 -0.2143 -0.0737 1.0000 1.0000 1.0000 Allele 2 -0.5294 -0.5509 **** 1.0000 1.0000 Allele 3 -0.0968 -0.1333 1.0000 **** **** Total -0.3353 -0.2812 1.0000 1.0000 1.0000 ========================================================== ============ population ID : 2 population name : PARINSORAN * Population : 2 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 3 2.5161 0.0931 1.0553 (2, 2) 10 10.4839 0.0223 -0.9451 (3, 1) 0 0.2903 0.2903 0.0000 (3, 2) 3 2.5161 0.0931 1.0553 118 (3, 3) 0 0.0968 0.0968 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.692308 Degree of freedom : 3 Probability : 0.875012 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 1.165630 Degree of freedom : 3 Probability : 0.761259 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 4 0.9032 10.6175 11.9046 (2, 1) 0 5.1613 5.1613 0.0000 (2, 2) 8 6.1290 0.5711 4.2625 (3, 1) 0 1.0323 1.0323 0.0000 (3, 2) 4 2.5806 0.7806 3.5060 (3, 3) 0 0.1935 0.1935 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.356391 Degree of freedom : 3 Probability : 0.000371 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.673131 Degree of freedom : 3 Probability : 0.000198 * Population : 2 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 1.7742 0.8469 3.1516 (2, 1) 3 2.8387 0.0092 0.3316 (2, 2) 2 0.9032 1.3318 3.1797 (3, 1) 2 4.6129 1.4800 -3.3428 (3, 2) 1 3.3548 1.6529 -2.4208 (3, 3) 5 2.5161 2.4520 6.8672 ========================================================== == 119 Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 7.772860 Degree of freedom : 3 Probability : 0.050947 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.766408 Degree of freedom : 3 Probability : 0.051094 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm04* ========================================================== = Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 5 1.4516 8.6738 12.3676 (2, 1) 0 7.0968 7.0968 0.0000 (2, 2) 11 7.4516 1.6897 8.5682 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.460317 Degree of freedom : 1 Probability : 0.000029 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 20.935851 Degree of freedom : 1 Probability : 0.000005 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm08* ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 13 10.4839 0.6039 5.5929 (2, 1) 0 5.0323 5.0323 0.0000 (2, 2) 3 0.4839 13.0839 10.9473 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.720000 Degree of freedom : 1 Probability : 0.000015 likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 16.540192 Degree of freedom : 1 Probability : 0.000048 120 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 2 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.0938 0.2500 0.3438 0.3125 0.8125 Allele 2 0.8125 0.6250 0.2500 0.6875 0.1875 Allele 3 0.0938 0.1250 0.4062 ========================================================== ============ Summary Statistics of population 2 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** ***************============================================= ===== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 1.4755 0.6125 Pm05 32 3.0000 2.1333 0.9003 Pm07 32 3.0000 2.8927 1.0796 Pm04 32 2.0000 1.7534 0.6211 Pm08 32 2.0000 1.4382 0.4826 Mean 32 2.6000 1.9386 0.7392 St. Dev 0.5477 0.6015 0.2437 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** ***************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** ************* ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 32 0.6250 0.3750 0.6673 0.3327 0.3223 0.5298 Pm05 32 0.7500 0.2500 0.4516 0.5484 0.5312 0.5486 121 Pm07 32 0.6250 0.3750 0.3246 0.6754 0.6543 0.4752 Pm04 32 1.0000 0.0000 0.5565 0.4435 0.4297 0.3769 Pm08 32 1.0000 0.0000 0.6855 0.3145 0.3047 0.3399 Mean 32 0.8000 0.2000 0.5371 0.4629 0.4484 0.4541 St. Dev 0.1896 0.1896 0.1515 0.1515 0.1468 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 -0.1034 1.0000 0.3074 1.0000 1.0000 Allele 2 -0.2308 0.4667 0.3333 1.0000 1.0000 Allele 3 -0.1034 -0.1429 0.6113 **** **** Total -0.1636 0.5294 0.4269 1.0000 1.0000 ========================================================== ============ population ID : 3 population name : DOLOK TUSAM BARAT * Population : 3 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 4.6364 1.4991 -3.3631 (2, 1) 14 8.7273 3.1856 13.2329 (2, 2) 1 3.6364 1.9114 -2.5820 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.596078 Degree of freedom : 1 Probability : 0.010220 Likelihood ratio test for Hardy-Weinberg equilibrium : 122 G-square : 7.287822 Degree of freedom : 1 Probability : 0.006942 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 4 6.3636 0.8779 -3.7144 (2, 1) 13 8.2727 2.7013 11.7516 (2, 2) 0 2.3636 2.3636 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.942857 Degree of freedom : 1 Probability : 0.014777 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.037168 Degree of freedom : 1 Probability : 0.004583 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0909 0.0909 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 3 2.8182 0.0117 0.3751 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 14 14.0909 0.0006 -0.1812 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.103226 Degree of freedom : 1 Probability : 0.747992 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.193892 Degree of freedom : 1 123 Probability : 0.659697 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 10 9.8485 0.0023 0.3053 (2, 1) 6 6.3030 0.0146 -0.5913 (2, 2) 1 0.8485 0.0271 0.3286 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.043956 Degree of freedom : 1 Probability : 0.833935 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.042703 Degree of freedom : 1 Probability : 0.836286 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 0.6364 2.9221 4.5805 (2, 1) 3 5.7273 1.2987 -3.8798 (2, 2) 12 10.6364 0.1748 2.8951 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 4.395604 Degree of freedom : 1 Probability : 0.036032 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 3.595838 Degree of freedom : 1 Probability : 0.057924 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 3 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ 124 Allele 1 0.5294 0.6176 0.0882 0.7647 0.2059 Allele 2 0.4706 0.3824 0.2353 0.7941 Allele 3 0.9118 ========================================================== ============ Summary Statistics of population 3 : ****************************************************************** *************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** *************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 2.0000 1.9931 0.6914 Pm05 34 2.0000 1.8951 0.6652 Pm07 34 2.0000 1.1918 0.2984 Pm04 34 2.0000 1.5622 0.5456 Pm08 34 2.0000 1.4859 0.5084 Mean 34 2.0000 1.6256 0.5418 St. Dev 0.0000 0.3238 0.1565 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** *************** ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 34 0.1765 0.8235 0.4866 0.5134 0.4983 0.5298 Pm05 34 0.2353 0.7647 0.5134 0.4866 0.4723 0.5486 Pm07 34 0.8235 0.1765 0.8342 0.1658 0.1609 0.4752 125 Pm04 34 0.6471 0.3529 0.6292 0.3708 0.3599 0.3769 Pm08 34 0.8235 0.1765 0.6631 0.3369 0.3270 0.3399 Mean 34 0.5412 0.4588 0.6253 0.3747 0.3637 0.4541 St. Dev 0.3151 0.3151 0.1386 0.1386 0.1345 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 -0.6528 -0.6190 -0.0968 0.0192 0.4603 Allele 2 -0.6528 -0.6190 **** 0.0192 0.4603 Allele 3 **** **** -0.0968 **** **** Total -0.6528 -0.6190 -0.0968 0.0192 0.4603 ========================================================== ============ population ID : 4 population name : LOBUGALA * Population : 4 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 1.1613 2.9113 5.6945 (2, 1) 3 3.4839 0.0672 -0.8972 (2, 2) 0 2.1290 2.1290 0.0000 (3, 1) 0 3.1935 3.1935 0.0000 (3, 2) 9 4.2581 5.2808 13.4714 (3, 3) 1 1.7742 0.3378 -1.1467 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.919697 126 Degree of freedom : 3 Probability : 0.003017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 17.121978 Degree of freedom : 3 Probability : 0.000667 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 0.9032 4.8675 7.2024 (2, 1) 2 4.1290 1.0978 -2.8996 (2, 2) 3 3.8710 0.1960 -1.5294 (3, 1) 0 2.0645 2.0645 0.0000 (3, 2) 8 4.1290 3.6290 10.5824 (3, 3) 0 0.9032 0.9032 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 12.758036 Degree of freedom : 3 Probability : 0.005190 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 13.355809 Degree of freedom : 3 Probability : 0.003927 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 2 1.2581 0.4376 1.8543 (2, 2) 2 2.5161 0.1059 -0.9183 (3, 1) 1 1.5484 0.1942 -0.8744 (3, 2) 7 6.7097 0.0126 0.5930 (3, 3) 4 3.8710 0.0043 0.2623 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.851282 Degree of freedom : 3 Probability : 0.837166 127 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.916914 Degree of freedom : 3 Probability : 0.821344 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 0.4839 4.7505 5.6763 (2, 1) 2 5.0323 1.8271 -3.6909 (2, 2) 12 10.4839 0.2193 3.2416 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.796923 Degree of freedom : 1 Probability : 0.009132 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.227098 Degree of freedom : 1 Probability : 0.022238 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 11 8.9032 0.4938 4.6526 (2, 1) 2 6.1935 2.8394 -4.5214 (2, 2) 3 0.9032 4.8675 7.2024 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 8.200699 Degree of freedom : 1 Probability : 0.004187 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.333521 Degree of freedom : 1 Probability : 0.006768 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 4 : ========================================================== ============ 128 Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.2812 0.2500 0.0938 0.1875 0.7500 Allele 2 0.3750 0.5000 0.4062 0.8125 0.2500 Allele 3 0.3438 0.2500 0.5000 ========================================================== ============ Summary Statistics of population 4 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** **************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 2.9595 1.0916 Pm05 32 3.0000 2.6667 1.0397 Pm07 32 3.0000 2.3594 0.9344 Pm04 32 2.0000 1.4382 0.4826 Pm08 32 2.0000 1.6000 0.5623 Mean 32 2.6000 2.2048 0.8221 St. Dev 0.5477 0.6634 0.2808 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** **************** ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 32 0.2500 0.7500 0.3165 0.6835 0.6621 0.5298 Pm05 32 0.3750 0.6250 0.3548 0.6452 0.6250 0.5486 Pm07 32 0.3750 0.6250 0.4052 0.5948 0.5762 0.4752 Pm04 32 0.8750 0.1250 0.6855 0.3145 0.3047 0.3769 129 Pm08 32 0.8750 0.1250 0.6129 0.3871 0.3750 0.3399 Mean 32 0.5500 0.4500 0.4750 0.5250 0.5086 0.4541 St. Dev 0.3010 0.3010 0.1641 0.1641 0.1590 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.5362 0.6667 -0.1034 0.5897 0.6667 Allele 2 -0.6000 -0.2500 -0.1660 0.5897 0.6667 Allele 3 -0.2468 -0.3333 0.0000 **** **** Total -0.1327 0.0000 -0.0847 0.5897 0.6667 ========================================================== ============ population ID : 5 population name : Aekbilah * Population : 5 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 0.2609 11.5942 8.1475 (2, 1) 0 2.2609 2.2609 0.0000 (2, 2) 3 3.3913 0.0452 -0.7356 (3, 1) 0 1.2174 1.2174 0.0000 (3, 2) 7 3.9565 2.3411 7.9876 (3, 3) 0 0.9130 0.9130 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.371795 Degree of freedom : 3 Probability : 0.000369 Likelihood ratio test for Hardy-Weinberg equilibrium : 130 G-square : 15.399542 Degree of freedom : 3 Probability : 0.001505 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0435 0.0435 0.0000 (2, 1) 2 1.3043 0.3710 1.7098 (2, 2) 3 4.5652 0.5366 -2.5191 (3, 1) 0 0.6087 0.6087 0.0000 (3, 2) 7 4.5652 1.2986 5.9842 (3, 3) 0 0.9130 0.9130 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 3.771429 Degree of freedom : 3 Probability : 0.287227 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.174869 Degree of freedom : 3 Probability : 0.159431 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 1.9565 1.9565 0.0000 (2, 1) 10 4.3478 7.3478 16.6582 (2, 2) 0 1.9565 1.9565 0.0000 (3, 1) 0 1.7391 1.7391 0.0000 (3, 2) 0 1.7391 1.7391 0.0000 (3, 3) 2 0.2609 11.5942 8.1475 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 26.333333 Degree of freedom : 3 Probability : 0.000008 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 24.805710 Degree of freedom : 3 131 Probability : 0.000017 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 0.6522 8.4522 9.1563 (2, 1) 0 4.6957 4.6957 0.0000 (2, 2) 9 6.6522 0.8286 5.4411 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.976471 Degree of freedom : 1 Probability : 0.000185 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 14.597394 Degree of freedom : 1 Probability : 0.000133 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 10 8.2609 0.3661 3.8211 (2, 1) 0 3.4783 3.4783 0.0000 (2, 2) 2 0.2609 11.5942 8.1475 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 15.438596 Degree of freedom : 1 Probability : 0.000085 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 11.968632 Degree of freedom : 1 Probability : 0.000541 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 5 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.1667 0.0833 0.4167 0.2500 0.8333 Allele 2 0.5417 0.6250 0.4167 0.7500 0.1667 Allele 3 0.2917 0.2917 0.1667 132 ========================================================== ============ Summary Statistics of population 5 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** **************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 24 3.0000 2.4615 0.9901 Pm05 24 3.0000 2.0719 0.8602 Pm07 24 3.0000 2.6667 1.0282 Pm04 24 2.0000 1.6000 0.5623 Pm08 24 2.0000 1.3846 0.4506 Mean 24 2.6000 2.0370 0.7783 St. Dev 0.5477 0.5465 0.2589 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** ****************============================================ ==================================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 24 0.4167 0.5833 0.3804 0.6196 0.5938 0.5298 Pm05 24 0.2500 0.7500 0.4601 0.5399 0.5174 0.5486 Pm07 24 0.1667 0.8333 0.3478 0.6522 0.6250 0.4752 Pm04 24 1.0000 0.0000 0.6087 0.3913 0.3750 0.3769 Pm08 24 1.0000 0.0000 0.7101 0.2899 0.2778 0.3399 Mean 24 0.5667 0.4333 0.5014 0.4986 0.4778 0.4541 St. Dev 0.4057 0.4057 0.1541 0.1541 0.1477 0.0923 ========================================================== ===================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 133 ========================================================== ============ Allele 1 1.0000 -0.0909 -0.7143 1.0000 1.0000 Allele 2 -0.1748 -0.6000 -0.7143 1.0000 1.0000 Allele 3 -0.4118 -0.4118 1.0000 **** **** Total 0.0175 -0.4497 -0.3333 1.0000 1.0000 Lampiran 7. Distribusi biomassa hasil destructive sampling 36 pohon P. merkusii strain Tapanuli Berat Kering (Kg) No. Diameter Tinggi Batang (cm) (m) Kg Cabang % Kg Ranting % Kg Daun % Kg Buah % Kg Akar % Kg Total % Kg % 1. 13,0 16,53 35,3 82,09% 0,6 1,40% 2,3 5,35% 0,7 1,63% 0,0 0,00% 4,1 9,53% 43,0 100,00% 2. 17,0 25,80 140,7 81,71% 7,1 4,12% 3,7 2,15% 4,2 2,44% 0,0 0,00% 16,5 9,58% 172,2 100,00% 3. 19,3 21,26 166,2 76,76% 15,1 6,96% 5,8 2,66% 8,7 4,02% 0,0 0,00% 20,8 9,61% 216,5 100,00% 4. 20,0 25,50 216,6 82,23% 10,2 3,87% 5,7 2,16% 5,6 2,13% 0,0 0,00% 25,3 9,61% 263,4 100,00% 5. 23,0 22,50 212,4 54,98% 17,1 4,43% 8,0 2,07% 5,7 1,48% 0,0 0,00% 143,1 37,04% 386,3 100,00% 6. 25,0 17,10 186,0 49,88% 32,5 8,72% 8,5 2,28% 7,8 2,09% 0,0 0,00% 138,1 37,03% 372,9 100,00% 7. 26,0 21,30 196,9 48,33% 44,0 10,80% 8,3 2,04% 7,3 1,79% 0,0 0,00% 150,9 37,04% 407,4 100,00% 8. 27,2 16,50 186,1 38,02% 53,2 10,87% 38,2 7,80% 32,3 6,60% 0,0 0,00% 179,7 36,71% 489,5 100,00% 9. 29,1 26,30 392,3 51,87% 52,7 6,97% 15,8 2,09% 15,4 2,04% 0,0 0,00% 280,1 37,04% 756,3 100,00% 10. 30,5 22,60 330,8 61,54% 75,2 13,99% 16,8 3,13% 9,3 1,73% 0,0 0,00% 105,4 19,61% 537,5 100,00% 11. 32,7 21,92 392,3 51,69% 145,0 19,11% 38,8 5,11% 34,0 4,48% 0,0 0,00% 148,8 19,61% 758,9 100,00% 12. 34,3 28,10 511,9 63,08% 89,7 11,05% 27,6 3,40% 23,2 2,86% 0,0 0,00% 159,1 19,61% 811,5 100,00% 13. 36,5 19,05 331,3 53,39% 74,6 12,02% 50,9 8,20% 41,4 6,67% 0,0 0,00% 122,3 19,71% 620,5 100,00% 14. 38,4 23,73 575,2 56,88% 140,1 13,85% 46,0 4,55% 50,8 5,02% 0,9 0,09% 198,3 19,61% 1011,3 100,00% 15. 39,0 27,90 677,8 60,73% 145,9 13,07% 45,3 4,06% 28,2 2,53% 0,0 0,00% 218,8 19,61% 1116,0 100,00% 173,8 13,77% 1262,0 100,00% 16. 40,5 23,30 671,5 53,21% 63,9 5,06% 52,0 4,12% 0,3 0,02% 300,5 23,81% 17. 41,3 27,67 593,2 67,29% 52,3 5,93% 13,1 1,49% 13,0 1,47% 0,0 0,00% 209,9 23,81% 881,5 100,00% 18. 43,0 30,86 1112,7 63,14% 148,2 8,41% 45,8 2,60% 35,9 2,04% 0,0 0,00% 419,6 23,81% 1762,2 100,00% 19. 44,1 21,52 585,5 54,54% 138,0 12,86% 59,3 5,52% 37,0 3,45% 0,0 0,00% 253,7 23,63% 1073,5 100,00% 20. 45,0 27,74 953,6 62,13% 114,7 57,3 3,73% 43,8 2,85% 0,0 0,00% 365,4 23,81% 1534,8 100,00% 7,47% 21. 47,0 27,78 766,4 53,51% 260,0 18,15% 34,2 2,39% 30,6 2,14% 0,0 0,00% 341,0 23,81% 1432,2 100,00% 22. 48,0 20,80 753,0 57,48% 127,5 9,73% 65,1 4,97% 51,8 3,95% 0,7 0,05% 311,9 23,81% 1310,0 100,00% 23. 50,0 31,20 1299,1 58,69% 139,9 6,32% 52,4 2,37% 30,3 1,37% 0,0 0,00% 691,7 31,25% 2213,4 100,00% 24. 53,0 20,40 858,8 48,08% 278,7 15,60% 138,9 7,78% 77,9 4,36% 1,9 0,11% 430,0 24,07% 1786,2 100,00% 25. 54,5 30,90 1294,3 48,75% 419,6 15,81% 60,6 2,28% 50,7 1,91% 0,0 0,00% 829,6 31,25% 2654,8 100,00% 2719,1 100,00% 26. 55,2 28,00 1430,6 52,61% 264,2 9,72% 111,7 4,11% 62,9 2,31% 0,0 0,00% 849,7 31,25% 27. 57,0 30,08 1221,8 49,75% 359,9 14,65% 58,3 2,37% 48,4 1,97% 0,0 0,00% 767,5 31,25% 2455,9 100,00% 28. 59,5 25,05 1651,0 43,46% 674,0 17,74% 181,1 4,77% 104,0 2,74% 1,7 0,04% 1187,2 31,25% 3799,0 100,00% 29. 61,0 30,65 1692,6 58,77% 596,5 20,71% 101,0 3,51% 72,5 2,52% 0,0 0,00% 417,4 14,49% 2880,0 100,00% 30. 62,0 28,04 1631,5 66,00% 354,1 14,32% 74,1 3,00% 54,0 2,18% 0,0 0,00% 358,3 14,49% 2472,0 100,00% 31. 63,0 26,20 1776,4 65,43% 399,7 14,72% 79,5 2,93% 66,0 2,43% 0,0 0,00% 393,5 14,49% 2715,1 100,00% 32. 65,3 29,94 1981,9 59,15% 764,3 22,81% 62,6 1,87% 59,4 1,77% 0,0 0,00% 482,2 14,39% 3350,4 100,00% 33. 72,0 28,57 1817,8 43,44% 1058,1 25,29% 159,7 3,82% 128,3 3,07% 0,0 0,00% 1020,6 24,39% 4184,5 100,00% 34. 74,0 34,80 2874,2 54,56% 886,0 16,82% 128,7 2,44% 105,0 1,99% 0,0 0,00% 1274,0 24,18% 5267,9 100,00% 35. 76,0 24,28 1854,8 38,06% 1377,7 28,27% 304,0 6,24% 148,4 3,04% 0,0 0,00% 1188,7 24,39% 4873,6 100,00% 36. 82,0 28,60 Rata-rata 2681,5 53,84% 57,36% 892,4 17,92% 12,73% 146,6 2,94% 3,70% 86,5 1,74% 2,80% 0,0 0,00% 0,01% 1173,1 23,56% 23,39% 4980,1 100,00% 100,00% 134 Lampiran 8. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. Data Biomassa hasil detructive sampling untuk penyusunan persamaan allometrik P. merkusii strain Tapanuli Parameter Pertumbuhan D 13,0 17,0 19,3 20,0 23,0 25,0 26,0 27,2 29,1 30,5 32,7 34,3 36,5 38,4 39,0 40,5 41,3 43,0 44,1 45,0 47,0 48,0 50,0 53,0 54,5 55,2 57,0 59,5 61,0 62,0 63,0 65,3 72,0 74,0 76,0 82,0 H 16,53 25,80 21,26 25,50 22,50 17,10 21,30 16,50 26,30 22,60 21,92 28,10 19,05 23,73 27,90 23,30 27,67 30,86 21,52 27,74 27,78 20,80 31,20 20,40 30,90 28,00 30,08 25,05 30,65 28,04 26,20 29,94 28,57 34,80 24,28 28,60 Peubah Bebas (X) D*H D*WD D*H*WD 214,89 5,82 96,15 438,60 8,13 209,63 410,32 10,32 219,30 510,00 9,34 238,20 517,50 11,03 248,14 427,50 11,15 190,65 553,80 8,76 186,67 448,80 12,74 210,18 765,33 14,41 379,04 689,30 15,52 350,82 716,78 16,73 366,76 963,83 15,69 440,96 695,33 16,32 310,85 911,23 18,65 442,66 1088,10 17,17 479,01 943,65 18,81 438,32 1142,77 17,67 489,02 1326,98 21,46 662,34 949,03 20,75 446,59 1248,30 22,45 622,66 1305,66 19,91 553,01 998,40 23,58 490,56 1560,00 26,94 840,58 1081,20 29,43 600,43 1684,05 25,75 795,62 1545,60 24,86 695,97 1714,56 22,48 676,19 1490,48 33,21 831,86 1869,65 28,30 867,41 1738,48 32,22 903,41 1650,60 31,97 837,56 1955,08 31,43 941,12 2057,04 35,32 1009,13 2575,20 38,78 1349,48 1845,28 38,02 923,02 2345,20 41,56 1188,54 Peubah Tak Bebas (Y) Above Ground Biomass Below Ground Biomass Total Biomass (Kg) (Kg) (Kg) AGB BGB TB 38,9 4,1 43,0 155,7 16,5 172,2 195,7 20,7 216,5 238,1 25,2 263,3 243,2 141,1 384,3 234,8 136,2 371,0 256,5 148,8 405,3 309,8 179,7 489,5 476,2 276,2 752,4 432,1 250,6 682,7 610,1 149,8 759,9 652,4 160,2 812,6 498,2 122,3 620,5 813,0 199,6 1012,6 897,2 220,2 1117,4 961,5 236,0 1197,5 671,6 207,8 879,4 1342,6 415,5 1758,1 819,8 253,7 1073,5 1169,4 361,9 1531,3 1091,2 337,7 1428,9 998,1 308,9 1307,0 1521,7 470,9 1992,6 1356,2 430,0 1786,2 1825,2 578,7 2403,9 1869,4 592,7 2462,1 1688,4 535,3 2223,7 2611,8 828,1 3439,9 2462,6 414,0 2876,6 2113,7 355,4 2469,1 2321,6 390,3 2711,9 2868,2 482,2 3350,4 3163,9 1009,2 4173,1 3993,9 1274,0 5267,9 3684,9 1175,4 4860,3 3807,0 1173,1 4980,1 135 107 Lampiran 1. Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah DOLOK TUSAM TIMUR 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 1 2020.43 1 2011.25 1 2004.15 5 28.16 5 37.34 7 44.44 3 54.37 3 54.37 3 51.96 2 85.94 3 85.1 3 80.51 3 96.13 3 96.97 3 103.97 14 2285.03 15 2285.03 17 2285.03 PARINSORAN 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 3 926.00 3 926 2 910.03 7 36.24 2 13.59 8 164.08 1 232.84 2 268.08 2 253.79 3 376.24 3 316.68 5 205.47 2 713.70 2 760.68 2 751.65 16 2285.03 12 2285.03 19 2285.03 DOLOK TUSAM BARAT 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 1 1651.31 1 1651.31 1 1647.73 5 123.06 7 126.8 7 199.31 2 180.19 2 117.76 1 116.19 4 187.98 4 241.16 6 208.57 3 142.49 4 147.99 3 113.22 15 2285.03 18 2285.03 18 2285.03 LOBUGALA 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 2 289.59 2 293.73 2 293.73 10 148.82 11 200.95 12 127.01 4 252.09 4 268.32 3 270.55 5 425.73 6 424.66 5 458.63 5 1168.8 5 1097.37 4 1135.11 26 2285.03 28 2285.03 26 2285.03 TOLANG 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 1 5 2 6 3 17 1640.69 15.65 335.14 201.44 92.12 2285.03 2 3 2 10 3 20 1636.13 22.64 316.25 207.05 102.97 2285.03 1 7 4 15 3 30 1604.57 44.34 292.13 214.61 129.37 2285.03 108 Lampiran 2. Hasil analisis genetik dengan menggunakan software Popgene 3.2 population ID : 1 population name : DOLOK TUSAM TIMUR * Population : 1 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 2.7576 0.2081 -1.2848 (2, 1) 10 7.2121 1.0777 6.5364 (2, 2) 2 4.1212 1.0918 -2.8920 (3, 1) 0 1.2727 1.2727 0.0000 (3, 2) 3 1.5455 1.3690 3.9798 (3, 3) 0 0.0909 0.0909 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.110213 Degree of freedom : 3 Probability : 0.163902 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 6.339385 Degree of freedom : 3 Probability : 0.096217 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 3.1818 0.0104 -0.3530 (2, 1) 9 6.8182 0.6982 4.9974 (2, 2) 1 3.1818 1.4961 -2.3149 (3, 1) 0 1.8182 1.8182 0.0000 (3, 2) 4 1.8182 2.6182 6.3077 (3, 3) 0 0.1818 0.1818 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.822857 Degree of freedom : 3 Probability : 0.077763 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.637082 Degree of freedom : 3 Probability : 0.034526 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 4 0.8485 11.7056 12.4048 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 6.3030 6.3030 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 13 9.8485 1.0085 7.2184 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 19.017143 Degree of freedom : 1 Probability : 0.000013 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.623204 Degree of freedom : 1 Probability : 0.000009 109 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 12 8.3636 1.5810 8.6643 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 5 1.3636 9.6970 12.9928 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 5 1.3636 9.6970 12.9928 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 12 8.3636 1.5810 8.6643 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 5 1.3636 9.6970 12.9928 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 7.2727 7.2727 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 12 8.3636 1.5810 8.6643 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) 110 ============================================================ (1, 1) 0 0.0000 0.0000 0.0000 (2, 1) 0 0.3030 0.3030 0.0000 (2, 2) 5 1.3636 9.6970 12.9928 (3, 1) 1 0.6970 0.1318 0.7220 (3, 2) 0 6.9697 6.9697 0.0000 (3, 3) 11 7.6667 1.4493 7.9423 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 3 Probability : 0.000339 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 3 Probability : 0.000077 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 1 : ============================================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ============================================================================== ============ Allele 1 0.4118 0.4412 0.2353 0.7059 0.2941 0.2941 0.0294 Allele 2 0.5000 0.4412 0.2941 0.7059 0.2941 Allele 3 0.0882 0.1176 0.7647 0.7059 0.6765 ============================================================================== ============ Summary Statistics of population 1 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 3.0000 2.3401 0.9261 Pm05 34 3.0000 2.4807 0.9738 Pm07 34 2.0000 1.5622 0.5456 Pm04 34 2.0000 1.7101 0.6058 Pm08 34 2.0000 1.7101 0.6058 Pm09a 34 2.0000 1.7101 0.6058 Pm12 34 3.0000 1.8349 0.7281 Mean St. Dev 34 2.4286 1.9069 0.7130 0.5345 0.3552 0.1714 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ********************************************************************************* ** Summary of Heterozygosity Statistics for All Loci ** ********************************************************************************** 111 ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 34 0.2353 0.7647 0.4100 0.5900 0.5727 0.5298 Pm05 34 0.2353 0.7647 0.3850 0.6150 0.5969 0.5486 Pm07 34 1.0000 0.0000 0.6292 0.3708 0.3599 0.4752 Pm04 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3769 Pm08 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3399 Pm09a 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.4074 Pm12 34 0.9412 0.0588 0.5312 0.4688 0.4550 0.3669 Mean 34 0.7731 0.2269 0.5246 0.4754 0.4614 0.4350 St. Dev 0.3680 0.3680 0.0917 0.0917 0.0890 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ============================================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ============================================================================== ============ Allele 1 -0.2143 -0.0737 1.0000 1.0000 1.0000 1.0000 -0.0303 Allele 2 -0.5294 -0.5509 **** 1.0000 1.0000 **** 1.0000 Allele 3 -0.0968 -0.1333 1.0000 **** **** 1.0000 0.8656 Total -0.3353 -0.2812 1.0000 1.0000 1.0000 1.0000 0.8707 ============================================================================== ============ population ID : 2 population name : PARINSORAN * Population : 2 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 3 2.5161 0.0931 1.0553 (2, 2) 10 10.4839 0.0223 -0.9451 (3, 1) 0 0.2903 0.2903 0.0000 (3, 2) 3 2.5161 0.0931 1.0553 (3, 3) 0 0.0968 0.0968 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.692308 Degree of freedom : 3 Probability : 0.875012 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 1.165630 Degree of freedom : 3 Probability : 0.761259 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 4 0.9032 10.6175 11.9046 (2, 1) 0 5.1613 5.1613 0.0000 112 (2, 2) 8 6.1290 0.5711 4.2625 (3, 1) 0 1.0323 1.0323 0.0000 (3, 2) 4 2.5806 0.7806 3.5060 (3, 3) 0 0.1935 0.1935 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.356391 Degree of freedom : 3 Probability : 0.000371 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.673131 Degree of freedom : 3 Probability : 0.000198 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 1.7742 0.8469 3.1516 (2, 1) 3 2.8387 0.0092 0.3316 (2, 2) 2 0.9032 1.3318 3.1797 (3, 1) 2 4.6129 1.4800 -3.3428 (3, 2) 1 3.3548 1.6529 -2.4208 (3, 3) 5 2.5161 2.4520 6.8672 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 7.772860 Degree of freedom : 3 Probability : 0.050947 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.766408 Degree of freedom : 3 Probability : 0.051094 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 5 1.4516 8.6738 12.3676 (2, 1) 0 7.0968 7.0968 0.0000 (2, 2) 11 7.4516 1.6897 8.5682 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.460317 Degree of freedom : 1 Probability : 0.000029 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 20.935851 Degree of freedom : 1 Probability : 0.000005 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 13 10.4839 0.6039 5.5929 (2, 1) 0 5.0323 5.0323 0.0000 (2, 2) 3 0.4839 13.0839 10.9473 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : 113 Chi-square : 18.720000 Degree of freedom : 1 Probability : 0.000015 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 16.540192 Degree of freedom : 1 Probability : 0.000048 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 12 8.9032 1.0771 7.1638 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 6.1935 6.1935 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 4 0.9032 10.6175 11.9046 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.888199 Degree of freedom : 1 Probability : 0.000023 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.068448 Degree of freedom : 1 Probability : 0.000013 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 0 2.3226 2.3226 0.0000 (2, 2) 12 8.9032 1.0771 7.1638 (3, 1) 3 0.4839 13.0839 10.9473 (3, 2) 0 3.8710 3.8710 0.0000 (3, 3) 1 0.3226 1.4226 2.2628 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 21.873913 Degree of freedom : 3 Probability : 0.000069 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 20.373932 Degree of freedom : 3 Probability : 0.000142 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 2 : ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.0938 0.2500 0.3438 0.3125 0.8125 0.7500 0.0938 Allele 2 0.8125 0.6250 0.2500 0.6875 0.1875 0.7500 Allele 3 0.0938 0.1250 0.4062 0.2500 0.1562 ======================================================================================= === Summary Statistics of population 2 : *********************************************************************************** 114 ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 1.4755 0.6125 Pm05 32 3.0000 2.1333 0.9003 Pm07 32 3.0000 2.8927 1.0796 Pm04 32 2.0000 1.7534 0.6211 Pm08 32 2.0000 1.4382 0.4826 Pm09a 32 2.0000 1.6000 0.5623 Pm12 32 3.0000 1.6787 0.7277 Mean 32 2.5714 1.8531 0.7123 St. Dev 0.5345 0.5129 0.2098 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 32 0.6250 0.3750 0.6673 0.3327 0.3223 0.5298 Pm05 32 0.7500 0.2500 0.4516 0.5484 0.5312 0.5486 Pm07 32 0.6250 0.3750 0.3246 0.6754 0.6543 0.4752 Pm04 32 1.0000 0.0000 0.5565 0.4435 0.4297 0.3769 Pm08 32 1.0000 0.0000 0.6855 0.3145 0.3047 0.3399 Pm09a 32 1.0000 0.0000 0.6129 0.3871 0.3750 0.4074 Pm12 32 0.8125 0.1875 0.5827 0.4173 0.4043 0.3669 Mean 32 0.8304 0.1696 0.5544 0.4456 0.4316 0.4350 St. Dev 0.1720 0.1720 0.1275 0.1275 0.1235 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 -0.1034 1.0000 0.3074 1.0000 1.0000 1.0000 -0.1034 Allele 2 -0.2308 0.4667 0.3333 1.0000 1.0000 **** 1.0000 Allele 3 -0.1034 -0.1429 0.6113 **** **** 1.0000 0.2889 Total -0.1636 0.5294 0.4269 1.0000 1.0000 1.0000 0.5362 ======================================================================================= === population ID : 3 population name : DOLOK TUSAM BARAT * Population : 3 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) 115 ============================================================ (1, 1) 2 4.6364 1.4991 -3.3631 (2, 1) 14 8.7273 3.1856 13.2329 (2, 2) 1 3.6364 1.9114 -2.5820 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.596078 Degree of freedom : 1 Probability : 0.010220 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.287822 Degree of freedom : 1 Probability : 0.006942 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 4 6.3636 0.8779 -3.7144 (2, 1) 13 8.2727 2.7013 11.7516 (2, 2) 0 2.3636 2.3636 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.942857 Degree of freedom : 1 Probability : 0.014777 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.037168 Degree of freedom : 1, Probability : 0.004583 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0909 0.0909 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 3 2.8182 0.0117 0.3751 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 14 14.0909 0.0006 -0.1812 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.103226 Degree of freedom : 1 Probability : 0.747992 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.193892 Degree of freedom : 1 Probability : 0.659697 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~ * Population : 3 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 10 9.8485 0.0023 0.3053 (2, 1) 6 6.3030 0.0146 -0.5913 (2, 2) 1 0.8485 0.0271 0.3286 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.043956 Degree of freedom : 1 Probability : 0.833935 Likelihood ratio test for Hardy-Weinberg equilibrium : 116 G-square : 0.042703 Degree of freedom : 1 Probability : 0.836286 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 0.6364 2.9221 4.5805 (2, 1) 3 5.7273 1.2987 -3.8798 (2, 2) 12 10.6364 0.1748 2.8951 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 4.395604 Degree of freedom : 1 Probability : 0.036032 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 3.595838 Degree of freedom : 1 Probability : 0.057924 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.6364 0.6364 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 7 5.7273 0.2828 2.8094 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 10 10.6364 0.0381 -1.2339 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.957265 Degree of freedom : 1 Probability : 0.327877 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 1.575518 Degree of freedom : 1 Probability : 0.209407 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0000 0.0000 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 8 4.1212 3.6506 10.6127 (3, 1) 0 0.0000 0.0000 0.0000 (3, 2) 1 8.7576 6.8718 -4.3398 (3, 3) 8 4.1212 3.6506 10.6127 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 14.173010 Degree of freedom : 1 Probability : 0.000167 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 16.885577 Degree of freedom : 1 Probability : 0.000040 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 3 : 117 ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.5294 0.6176 0.0882 0.7647 0.2059 0.2059 Allele 2 0.4706 0.3824 0.2353 0.7941 0.5000 Allele 3 0.9118 0.7941 0.5000 ======================================================================================= === Summary Statistics of population 3 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 2.0000 1.9931 0.6914 Pm05 34 2.0000 1.8951 0.6652 Pm07 34 2.0000 1.1918 0.2984 Pm04 34 2.0000 1.5622 0.5456 Pm08 34 2.0000 1.4859 0.5084 Pm09a 34 2.0000 1.4859 0.5084 Pm12 34 2.0000 2.0000 0.6931 Mean 34 2.0000 1.6591 0.5587 St. Dev 0.0000 0.3086 0.1414 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 34 0.1765 0.8235 0.4866 0.5134 0.4983 0.5298 Pm05 34 0.2353 0.7647 0.5134 0.4866 0.4723 0.5486 Pm07 34 0.8235 0.1765 0.8342 0.1658 0.1609 0.4752 Pm04 34 0.6471 0.3529 0.6292 0.3708 0.3599 0.3769 Pm08 34 0.8235 0.1765 0.6631 0.3369 0.3270 0.3399 Pm09a 34 0.5882 0.4118 0.6631 0.3369 0.3270 0.4074 Pm12 34 0.9412 0.0588 0.4848 0.5152 0.5000 0.3669 Mean 34 0.6050 0.3950 0.6106 0.3894 0.3779 0.4350 St. Dev 0.2975 0.2975 0.1268 0.1268 0.1231 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 -0.6528 -0.6190 -0.0968 0.0192 0.4603 -0.2593 **** 118 Allele 2 -0.6528 -0.6190 **** 0.0192 0.4603 **** 0.8824 Allele 3 **** **** -0.0968 **** **** -0.2593 0.8824 Total -0.6528 -0.6190 -0.0968 0.0192 0.4603 -0.2593 0.8824 ======================================================================================= === Population ID : 4 population name : LOBUGALA * Population : 4 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 1.1613 2.9113 5.6945 (2, 1) 3 3.4839 0.0672 -0.8972 (2, 2) 0 2.1290 2.1290 0.0000 (3, 1) 0 3.1935 3.1935 0.0000 (3, 2) 9 4.2581 5.2808 13.4714 (3, 3) 1 1.7742 0.3378 -1.1467 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.919697 Degree of freedom : 3 Probability : 0.003017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 17.121978 Degree of freedom : 3 Probability : 0.000667 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 0.9032 4.8675 7.2024 (2, 1) 2 4.1290 1.0978 -2.8996 (2, 2) 3 3.8710 0.1960 -1.5294 (3, 1) 0 2.0645 2.0645 0.0000 (3, 2) 8 4.1290 3.6290 10.5824 (3, 3) 0 0.9032 0.9032 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 12.758036 Degree of freedom : 3 Probability : 0.005190 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 13.355809 Degree of freedom : 3 Probability : 0.003927 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 2 1.2581 0.4376 1.8543 (2, 2) 2 2.5161 0.1059 -0.9183 (3, 1) 1 1.5484 0.1942 -0.8744 (3, 2) 7 6.7097 0.0126 0.5930 (3, 3) 4 3.8710 0.0043 0.2623 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.851282 Degree of freedom : 3 Probability : 0.837166 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.916914 Degree of freedom : 3 119 Probability : 0.821344 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 0.4839 4.7505 5.6763 (2, 1) 2 5.0323 1.8271 -3.6909 (2, 2) 12 10.4839 0.2193 3.2416 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.796923 Degree of freedom : 1 Probability : 0.009132 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.227098 Degree of freedom : 1 Probability : 0.022238 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 11 8.9032 0.4938 4.6526 (2, 1) 2 6.1935 2.8394 -4.5214 (2, 2) 3 0.9032 4.8675 7.2024 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 8.200699 Degree of freedom : 1 Probability : 0.004187 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.333521 Degree of freedom : 1 Probability : 0.006768 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 11 8.1613 0.9874 6.5668 (2, 1) 1 0.7419 0.0898 0.5970 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 5.9355 5.9355 0.0000 (3, 2) 0 0.2581 0.2581 0.0000 (3, 3) 4 0.9032 10.6175 11.9046 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.888199 Degree of freedom : 3 Probability : 0.000464 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.068448 Degree of freedom : 3 Probability : 0.000265 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ 120 (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 3 2.5161 0.0931 1.0553 (2, 2) 11 10.4839 0.0254 1.0573 (3, 1) 0 0.2903 0.2903 0.0000 (3, 2) 1 2.5161 0.9136 -1.8454 (3, 3) 1 0.0968 8.4301 4.6707 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 9.849231 Degree of freedom : 3 Probability : 0.019892 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 4.937911 Degree of freedom : 3 Probability : 0.176400 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 4 : ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.2812 0.2500 0.0938 0.1875 0.7500 0.7188 0.0938 Allele 2 0.3750 0.5000 0.4062 0.8125 0.2500 0.0312 0.8125 Allele 3 0.3438 0.2500 0.5000 0.2500 0.0938 ======================================================================================= === Summary Statistics of population 4 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 2.9595 1.0916 Pm05 32 3.0000 2.6667 1.0397 Pm07 32 3.0000 2.3594 0.9344 Pm04 32 2.0000 1.4382 0.4826 Pm08 32 2.0000 1.6000 0.5623 Pm09a 32 3.0000 1.7239 0.6922 Pm12 32 3.0000 1.4755 0.6125 Mean 32 2.7143 2.0319 0.7736 St. Dev 0.4880 0.6210 0.2449 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 32 0.2500 0.7500 0.3165 0.6835 0.6621 0.5298 Pm05 32 0.3750 0.6250 0.3548 0.6452 0.6250 0.5486 Pm07 32 0.3750 0.6250 0.4052 0.5948 0.5762 0.4752 Pm04 32 0.8750 0.1250 0.6855 0.3145 0.3047 0.3769 Pm08 32 0.8750 0.1250 0.6129 0.3871 0.3750 0.3399 Pm09a 32 0.9375 0.0625 0.5665 0.4335 0.4199 0.4074 121 Pm12 32 0.7500 0.2500 0.6673 0.3327 0.3223 0.3669 Mean 32 0.6339 0.3661 0.5156 0.4844 0.4693 0.4350 St. Dev 0.2896 0.2896 0.1536 0.1536 0.1488 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.5362 0.6667 -0.1034 0.5897 0.6667 0.8454 -0.1034 Allele 2 -0.6000 -0.2500 -0.1660 0.5897 0.6667 -0.0323 0.1795 Allele 3 -0.2468 -0.3333 0.0000 **** **** 1.0000 0.6322 Total -0.1327 0.0000 -0.0847 0.5897 0.6667 0.8512 0.2242 ======================================================================================= === population ID : 5 population name : TOLANG * Population : 5 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 0.2609 11.5942 8.1475 (2, 1) 0 2.2609 2.2609 0.0000 (2, 2) 3 3.3913 0.0452 -0.7356 (3, 1) 0 1.2174 1.2174 0.0000 (3, 2) 7 3.9565 2.3411 7.9876 (3, 3) 0 0.9130 0.9130 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.371795 Degree of freedom : 3 Probability : 0.000369 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 15.399542 Degree of freedom : 3 Probability : 0.001505 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0435 0.0435 0.0000 (2, 1) 2 1.3043 0.3710 1.7098 (2, 2) 3 4.5652 0.5366 -2.5191 (3, 1) 0 0.6087 0.6087 0.0000 (3, 2) 7 4.5652 1.2986 5.9842 (3, 3) 0 0.9130 0.9130 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 3.771429 Degree of freedom : 3 Probability : 0.287227 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.174869 Degree of freedom : 3 Probability : 0.159431 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ 122 (1, 1) 0 1.9565 1.9565 0.0000 (2, 1) 10 4.3478 7.3478 16.6582 (2, 2) 0 1.9565 1.9565 0.0000 (3, 1) 0 1.7391 1.7391 0.0000 (3, 2) 0 1.7391 1.7391 0.0000 (3, 3) 2 0.2609 11.5942 8.1475 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 26.333333 Degree of freedom : 3 Probability : 0.000008 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 24.805710 Degree of freedom : 3 Probability : 0.000017 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 0.6522 8.4522 9.1563 (2, 1) 0 4.6957 4.6957 0.0000 (2, 2) 9 6.6522 0.8286 5.4411 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.976471 Degree of freedom : 1 Probability : 0.000185 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 14.597394 Degree of freedom : 1 Probability : 0.000133 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 10 8.2609 0.3661 3.8211 (2, 1) 0 3.4783 3.4783 0.0000 (2, 2) 2 0.2609 11.5942 8.1475 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 15.438596 Degree of freedom : 1 Probability : 0.000085 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 11.968632 Degree of freedom : 1 Probability : 0.000541 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 7 5.2174 0.6091 4.1148 (2, 1) 2 2.7826 0.2201 -1.3210 (2, 2) 1 0.2609 2.0942 2.6875 (3, 1) 0 2.7826 2.7826 0.0000 (3, 2) 0 0.6957 0.6957 0.0000 (3, 3) 2 0.2609 11.5942 8.1475 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.995833 Degree of freedom : 3 Probability : 0.000441 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 13.628807 Degree of freedom : 3 Probability : 0.003457 123 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0435 0.0435 0.0000 (2, 1) 2 1.9130 0.0040 0.1778 (2, 2) 10 10.0435 0.0002 -0.0868 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.047619 Degree of freedom : 1 Probability : 0.827259 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.091039 Degree of freedom : 1 Probability : 0.762860 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 5 : ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.1667 0.0833 0.4167 0.2500 0.8333 0.6667 0.0833 Allele 2 0.5417 0.6250 0.4167 0.7500 0.1667 0.1667 0.9167 Allele 3 0.2917 0.2917 0.1667 0.1667 ======================================================================================= === Summary Statistics of population 5 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 24 3.0000 2.4615 0.9901 Pm05 24 3.0000 2.0719 0.8602 Pm07 24 3.0000 2.6667 1.0282 Pm04 24 2.0000 1.6000 0.5623 Pm08 24 2.0000 1.3846 0.4506 Pm09a 24 3.0000 2.0000 0.8676 Pm12 24 2.0000 1.1803 0.2868 Mean 24 2.5714 1.9093 0.7208 St. Dev 0.5345 0.5501 0.2871 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] 124 *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ================================================================================ Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ================================================================================ Pm01 24 0.4167 0.5833 0.3804 0.6196 0.5938 0.5298 Pm05 24 0.2500 0.7500 0.4601 0.5399 0.5174 0.5486 Pm07 24 0.1667 0.8333 0.3478 0.6522 0.6250 0.4752 Pm04 24 1.0000 0.0000 0.6087 0.3913 0.3750 0.3769 Pm08 24 1.0000 0.0000 0.7101 0.2899 0.2778 0.3399 Pm09a 24 0.8333 0.1667 0.4783 0.5217 0.5000 0.4074 Pm12 24 0.8333 0.1667 0.8406 0.1594 0.1528 0.3669 Mean 24 0.6429 0.3571 0.5466 0.4534 0.4345 0.4350 St. Dev 0.3559 0.3559 0.1809 0.1809 0.1733 0.0830 ================================================================================ * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 1.0000 -0.0909 -0.7143 1.0000 1.0000 0.6250 -0.0909 Allele 2 -0.1748 -0.6000 -0.7143 1.0000 1.0000 0.4000 -0.0909 Allele 3 -0.4118 -0.4118 1.0000 **** **** 1.0000 **** Total 0.0175 -0.4497 -0.3333 1.0000 1.0000 0.6667 -0.0909 ======================================================================================= === 125 Lampiran 3. Hasil inventarisasi sebaran diameter tegakan alam Pinus merkusii strain Tapanuli di dalam kawasan Hutan Lindung Dolok Tusam Timur dan Dolok Tusam Barat – Sumatera Utara Kelas Diameter >0-9,9 10-19,9 20-29,9 30-39,9 40-49,9 50-59,9 60-69,9 70-79,9 80-89,9 90-99,9 100-109,9 110-119,9 120-129,9 Jumlah pohon HL DT Barat HL DT Timur Dolok Tusam 0 0 0 0 2 2 0 5 5 1 6 7 6 9 15 12 5 17 6 9 15 11 2 13 1 2 3 6 3 9 0 1 1 0 2 2 0 1 1 43 47 90 Destructive Sampling 0 3 6 6 7 6 4 3 1 0 0 0 0 36 Pendekatan Volumetrtik 0 0 0 0 0 0 0 2 1 1 1 2 1 8 Jumlah Data 0 3 6 6 7 6 4 5 2 1 1 2 1 44 126 Lampiran 4. Batang No. Diameter Tinggi (cm) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. (m) 13.0 16.53 17.0 25.80 19.3 21.26 20.0 25.50 23.0 22.50 25.0 17.10 26.0 21.30 27.2 16.50 29.1 26.30 30.5 22.60 32.7 21.92 34.3 28.10 36.5 19.05 38.4 23.73 39.0 27.90 40.5 23.30 41.3 27.67 43.0 30.86 44.1 21.52 45.0 27.74 47.0 27.78 48.0 20.80 50.0 31.20 53.0 20.40 54.5 30.90 55.2 28.00 57.0 30.08 59.5 25.05 61.0 30.65 62.0 28.04 63.0 26.20 65.3 29.94 72.0 28.57 74.0 34.80 76.0 24.28 82.0 28.60 Rata-rata total Sebaran persentase biomassa hasil destructive sampling 36 pohon Pinus merkusii strain Tapanuli di Tapanuli – Sumatera Utara kg 35.3 140.7 166.2 216.6 212.4 186.0 196.9 186.1 392.3 330.8 392.3 511.9 331.3 575.2 677.8 671.5 593.2 1112.7 585.5 953.6 766.4 753.0 1299.1 858.8 1294.3 1430.6 1221.8 1651.0 1692.6 1631.5 1776.4 1981.9 1817.8 2874.2 1854.8 2681.5 Cabang % 82.05% 81.71% 76.78% 82.25% 55.27% 50.14% 48.58% 38.02% 52.14% 48.45% 51.63% 63.00% 53.39% 56.81% 60.66% 56.07% 67.45% 63.29% 54.54% 62.27% 53.64% 57.61% 65.20% 48.08% 53.84% 58.10% 54.94% 48.00% 58.84% 66.08% 65.50% 59.15% 43.56% 54.56% 38.16% 53.84% 57.88% kg 0.6 7.1 15.1 10.2 17.1 32.5 44.0 53.2 52.7 75.2 145.0 89.7 74.6 140.1 145.9 173.8 52.3 148.2 138.0 114.7 260.0 127.5 139.9 278.7 419.6 264.2 359.9 674.0 596.5 354.1 399.7 764.3 1058.1 886.0 1377.7 892.4 Berat Kering (kg) Daun Ranting % 1.39% 4.12% 6.97% 3.87% 4.45% 8.76% 10.86% 10.87% 7.00% 11.01% 19.08% 11.04% 12.02% 13.84% 13.06% 14.51% 5.95% 8.43% 12.86% 7.49% 18.20% 9.76% 7.02% 15.60% 17.45% 10.73% 16.18% 19.59% 20.74% 14.34% 14.74% 22.81% 25.36% 16.82% 28.35% 17.92% 12.87% kg 2.3 3.7 5.8 5.7 8.0 8.5 8.3 38.2 15.8 16.8 38.8 27.6 50.9 46.0 45.3 63.9 13.1 45.8 59.3 57.3 34.2 65.1 52.4 138.9 60.6 111.7 58.3 181.1 101.0 74.1 79.5 62.6 159.7 128.7 304.0 146.6 % 5.35% 2.15% 2.66% 2.16% 2.08% 2.29% 2.05% 7.80% 2.10% 2.46% 5.11% 3.40% 8.20% 4.54% 4.05% 5.34% 1.49% 2.61% 5.52% 3.74% 2.39% 4.98% 2.63% 7.78% 2.52% 4.54% 2.62% 5.26% 3.51% 3.00% 2.93% 1.87% 3.83% 2.44% 6.25% 2.94% 3.74% kg 0.7 4.2 8.7 5.6 5.7 7.8 7.3 32.3 15.4 9.3 34.0 23.2 41.4 50.8 28.2 52.0 13.0 35.9 37.0 43.8 30.6 51.8 30.3 77.9 50.7 62.9 48.4 104.0 72.5 54.0 66.0 59.4 128.3 105.0 148.4 86.5 % 1.63% 2.44% 4.02% 2.13% 1.48% 2.10% 1.80% 6.60% 2.05% 1.36% 4.47% 2.86% 6.67% 5.02% 2.52% 4.34% 1.48% 2.04% 3.45% 2.86% 2.14% 3.96% 1.52% 4.36% 2.11% 2.55% 2.18% 3.02% 2.52% 2.19% 2.43% 1.77% 3.07% 1.99% 3.05% 1.74% 2.83% Buah kg 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.9 0.0 0.3 0.0 0.0 0.0 0.0 0.0 0.7 0.0 1.9 0.0 0.0 0.0 1.7 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Akar % kg 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.09% 0.00% 0.03% 0.00% 0.00% 0.00% 0.00% 0.00% 0.05% 0.00% 0.11% 0.00% 0.00% 0.00% 0.05% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.01% 4.1 16.5 20.7 25.2 141.1 136.2 148.8 179.7 276.2 250.6 149.8 160.2 122.3 199.6 220.2 236.0 207.8 415.5 253.7 361.9 337.7 308.9 470.9 430.0 578.7 592.7 535.3 828.1 414.0 355.4 390.3 482.2 1009.2 1274.0 1175.4 1173.1 Total % 9.58% 9.58% 9.58% 9.58% 36.71% 36.71% 36.71% 36.71% 36.71% 36.71% 19.71% 19.71% 19.71% 19.71% 19.71% 19.71% 23.63% 23.63% 23.63% 23.63% 23.63% 23.63% 23.63% 24.07% 24.07% 24.07% 24.07% 24.07% 14.39% 14.39% 14.39% 14.39% 24.18% 24.18% 24.18% 23.56% 22.68% kg 43.0 172.2 216.5 263.3 384.3 371.0 405.3 489.5 752.4 682.7 759.9 812.6 620.5 1012.6 1117.4 1197.5 879.4 1758.1 1073.5 1531.3 1428.9 1307.0 1992.6 1786.2 2403.9 2462.1 2223.7 3439.9 2876.6 2469.1 2711.9 3350.4 4173.1 5267.9 4860.3 4980.1 % 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 127 Lampiran 5. Data biomassa yang menjadi input peubah bebas X untuk penyusunan persamaan allometrik untuk Pinus merkusii strain Tapanuli di Tapanuli – Sumatera Utara No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. Parameter Pertumbuhan D 13.0 17.0 19.3 20.0 23.0 25.0 26.0 27.2 29.1 30.5 32.7 34.3 36.5 38.4 39.0 40.5 41.3 43.0 44.1 45.0 47.0 48.0 50.0 53.0 54.5 55.2 57.0 59.5 61.0 62.0 63.0 65.3 72.0 74.0 75.0 76.0 79.5 82.0 86.0 95.0 104.0 110.9 115.5 120.6 H 16.53 25.80 21.26 25.50 22.50 17.10 21.30 16.50 26.30 22.60 21.92 28.10 19.05 23.73 27.90 23.30 27.67 30.86 21.52 27.74 27.78 20.80 31.20 20.40 30.90 28.00 30.08 25.05 30.65 28.04 26.20 29.94 28.57 34.80 36.00 24.28 32.50 28.60 33.00 35.00 36.00 38.00 37.00 36.50 WD 0.447 0.478 0.534 0.467 0.479 0.446 0.337 0.468 0.495 0.509 0.512 0.458 0.447 0.486 0.440 0.464 0.428 0.499 0.471 0.499 0.424 0.491 0.539 0.555 0.472 0.450 0.394 0.558 0.464 0.520 0.507 0.481 0.491 0.524 0.520 0.500 0.558 0.507 0.586 0.539 0.520 0.551 0.583 0.451 Peubah Bebas (X) D*H D*WD D*H*WD 214.89 5.82 96.15 438.60 8.13 209.63 410.32 10.32 219.30 510.00 9.34 238.20 517.50 11.03 248.14 427.50 11.15 190.65 553.80 8.76 186.67 448.80 12.74 210.18 765.33 14.41 379.04 689.30 15.52 350.82 716.78 16.73 366.76 963.83 15.69 440.96 695.33 16.32 310.85 911.23 18.65 442.66 1088.10 17.17 479.01 943.65 18.81 438.32 1142.77 17.67 489.02 1326.98 21.46 662.34 949.03 20.75 446.59 1248.30 22.45 622.66 1305.66 19.91 553.01 998.40 23.58 490.56 1560.00 26.94 840.58 1081.20 29.43 600.43 1684.05 25.75 795.62 1545.60 24.86 695.97 1714.56 22.48 676.19 1490.48 33.21 831.86 1869.65 28.30 867.41 1738.48 32.22 903.41 1650.60 31.97 837.56 1955.08 31.43 941.12 2057.04 35.32 1009.13 2575.20 38.78 1349.48 2700.00 39.00 1404.00 1845.28 38.02 923.02 2583.75 44.36 1441.73 2345.20 41.56 1188.54 2838.00 50.40 1663.07 3325.00 51.21 1792.18 3744.00 54.08 1946.88 4214.20 61.11 2322.02 4273.50 67.34 2491.45 4401.90 54.39 1985.26 Peubah Tak Bebas (Y) Above Ground Biomass (Kg) Below Ground Biomass (Kg) Total Biomass (Kg) AGB BGB TB 38.9 4.1 43.0 155.7 16.5 172.2 195.7 20.7 216.5 238.1 25.2 263.3 243.2 141.1 384.3 234.8 136.2 371.0 256.5 148.8 405.3 309.8 179.7 489.5 476.2 276.2 752.4 432.1 250.6 682.7 610.1 149.8 759.9 652.4 160.2 812.6 498.2 122.3 620.5 813.0 199.6 1012.6 897.2 220.2 1117.4 961.5 236.0 1197.5 671.6 207.8 879.4 1342.6 415.5 1758.1 819.8 253.7 1073.5 1169.4 361.9 1531.3 1091.2 337.7 1428.9 998.1 308.9 1307.0 1521.7 470.9 1992.6 1356.2 430.0 1786.2 1825.2 578.7 2403.9 1869.4 592.7 2462.1 1688.4 535.3 2223.7 2611.8 828.1 3439.9 2462.6 414.0 2876.6 2113.7 355.4 2469.1 2321.6 390.3 2711.9 2868.2 482.2 3350.4 3163.9 1009.2 4173.1 3993.9 1274.0 5267.9 3561.7 1124.8 4686.5 3684.9 1188.7 4873.6 3876.9 1224.3 5101.2 3807.0 1173.1 4980.1 4837.8 1527.7 6365.5 5758.9 1818.6 7577.5 6848.7 2162.8 9011.5 8710.4 2750.6 11461.0 9733.5 3073.8 12807.3 8018.1 2532.0 10550.1 128 Lampiran 6. Perbandingan nilai dugaan biomassa P. merkusii strain Tapanuli antara hasil dari persamaan allometrik Tapanuli dengan persamaan allometrik Cianten (Siregar, 2007) 2,4587 Y=0,1031(DBH) No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. Diameter Berat Aktual a 13.0 43.02 17.0 172.20 19.3 216.47 20.0 263.33 23.0 384.27 25.0 371.00 26.0 405.28 27.2 489.50 29.1 752.42 30.5 682.74 32.7 759.87 34.3 812.55 36.5 620.50 38.4 1012.58 39.0 1117.45 40.5 1197.53 41.3 879.44 43.0 1758.09 44.1 1073.50 45.0 1531.29 47.0 1428.89 48.0 1306.98 50.0 1992.61 53.0 1786.20 54.5 2403.90 55.2 2462.12 57.0 2223.73 59.5 3439.90 61.0 2876.61 62.0 2469.05 63.0 2711.91 65.3 3350.40 72.0 4173.14 74.0 5267.90 76.0 4860.33 82.0 4980.10 Jumlah 62276.81 Rata-rata 1729.91 Cianten b 2,2757 Y = 0,2451(DBH) Tapanuli c 56.51 109.29 149.30 162.97 229.79 282.08 310.64 347.08 409.76 459.95 545.85 613.88 715.27 810.31 841.80 923.65 969.16 1070.21 1138.78 1196.77 1331.82 1402.58 1550.66 1789.52 1916.62 1977.72 2140.07 2378.28 2528.42 2631.55 2737.14 2989.41 3800.86 4065.73 4341.25 5233.02 54157.72 1504.38 Selisih Cianten - Aktual Selisih Tapanuli - Aktual b-a c-a 84.01 13.49 40.99 154.69 -62.91 -17.51 206.48 -67.17 -9.99 223.92 -100.36 -39.41 307.77 -154.47 -76.50 372.08 -88.92 1.08 406.82 -94.65 1.53 450.81 -142.42 -38.69 525.68 -342.66 -226.74 585.01 -222.79 -97.73 685.49 -214.01 -74.38 764.21 -198.67 -48.34 880.35 94.77 259.85 988.11 -202.26 -24.47 1023.60 -275.65 -93.85 1115.40 -273.88 -82.14 1166.17 89.72 286.73 1278.28 -687.88 -479.80 1353.92 65.28 280.42 1417.62 -334.51 -113.67 1565.08 -97.07 136.19 1641.89 95.60 334.91 1801.73 -441.96 -190.89 2057.21 3.32 271.01 2192.10 -487.28 -211.80 2256.70 -484.40 -205.42 2427.66 -83.66 203.93 2676.77 -1061.62 -763.13 2832.82 -348.19 -43.79 2939.61 162.50 470.55 3048.62 25.24 336.71 3307.82 -360.99 -42.58 4131.19 -372.28 -41.95 4396.97 -1202.17 -870.93 4672.09 -519.08 -188.25 5554.05 252.92 573.95 61492.70 -8119.09 -784.11 1708.13 -225.53 -21.78 ANALISIS PERUBAHAN TUTUPAN LAHAN, STRUKTUR GENETIK, DAN KANDUNGAN BIOMASSA KARBON Pinus merkusii Jungh. et de Vriese strain TAPANULI PADA SEBARAN ALAMINYA DI SUMATERA UTARA ALFAN GUNAWAN AHMAD SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR BOGOR 2012 IPB 2012 ALFAN GUNAWAN AHMAD E.461070041 PERNYATAAN MENGENAI DISERTASI DAN SUMBER INFORMASI Dengan ini saya menyatakan bahwa disertasi Analisis Perubahan Tutupan Lahan, Struktur Genetik, dan Kandungan Biomassa Karbon Pinus merkusii Jungh et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara adalah benar merupakan karya saya dengan arahan komisi pembimbing dan belum diajukan dalam bentuk apapun kepada perguruan tinggi mana pun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam Daftar Pustaka di bagian akhir disertasi ini. Bogor, September 2012 Alfan Gunawan Ahmad NIM. E.461070041 ABSTRACT ALFAN GUNAWAN AHMAD. Analysis of land cover changes, genetic structure, and carbon biomass stock of Pinus merkusii Jungh et de Vriese strain Tapanuli in Its Natural Distribution in North Sumatra. Under supervision of ULFAH JUNIARTI SIREGAR, HADI SUSILO ARIFIN, and CHAIRIL ANWAR SIREGAR. Pinus merkusii strain Tapanuli is currently considered as endangered because of declining population and habitat due to logging activity and land use changes. With recent development on carbon trade the natural populations of P. merkusii strain Tapanuli has the potential as carbon sink. The objective of the research were 1) To analyze the landcover changes in five locations of strain Tapanuli natural habitat, which occured in 1994, 2005, and 2011, 2) To analyze the genetic structure of those five natural populations using microsatellite markers 3) To formulate the allometric equation for carbon biomass estimation of strain Tapanuli. Five study locations in strain Tapanuli natural habitat were selected as follows: a) two protected forests, i.e. Dolok Tusam Timur and Dolok Tusam Barat, b) two open and cultivated area, i.e. Parinsoran and Lobugala village, and c). Mixed forests in Tolang hilly village. Analysis of land cover changes was based on Landsat imagery 7 ETM+ in 1994, 2005, and 2011. Microsatellite markers were generated from microsatellite primers developed previously on P. merkusii strain Aceh. Formulation of allometric equations was done using destructive sampling method combined with volumetric method. The results showed that 1) Land cover changes that occur in Tapanuli terrestrial ecosystem from 1994 to 2011 has led to increased extent of weeds-shrub land, and cause the site of natural populations of Tapanuli strain of P. merkusii into nutrient poor. The cumulative soil carbon stock in the five research sites are as follows: Dolok Tusam Timur 55,5 ton C/ha, Parinsoran 46,1 ton C/ha, Dolok Tusam Barat 65,8 ton C/ha, Lobugala 89 ton C/ha, dan Tolang 71,1 ton C/ha. 2) Heterozygosity levels of those populations were high, and Population of Parinsoran and Tolang into one group, Population of Lobugala into one grup. 3). The best allometric equation for estimation of biomass carbon content of P. merkusii strain Tapanuli as follows: allometric equation for above ground biomass is Y = 0,1900(DBH)2,2730; for below ground biomass is Y = 0,0283(DBH)2,4393 and allometric equation for total biomass estimation of P. merkusii strain Tapanuli is Y= 0,2451(DBH)2,2757, 3). Based on this equation the potential carbon estimated in five location of natural distribution of P. merkusii strain Tapanuli are as follows: Dolok Tusam Timur 187,8 ton C/ha, Parinsoran 48,9 ton C/ha, Dolok Tusam Barat 190,4 ton C/ha, Lobugala 93,2 ton C/ha, and Tolang 45,7 ton C/ha. Keyword: Tapanuli strain of Pinus merkusii, land cover changes, genetic structure, carbon biomassa, Diameter at Breast Height (DBH) RINGKASAN ALFAN GUNAWAN AHMAD. Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii Jungh. et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara. Dibawah bimbingan: ULFAH JUNIARTI SIREGAR, HADI SUSILO ARIFIN, dan CHAIRIL ANWAR SIREGAR. Pinus merkusii Jungh. et de Vriese adalah satu-satunya jenis pinus tropis di dunia yang penyebarannya mampu memasuki lintang selatan garis khatulistiwa. Di Indonesia, P. merkusii tersebar secara alami di tiga lokasi di Sumatera bagian Utara, yakni Aceh, Tapanuli, dan Kerinci. Pinus merkusii strain Tapanuli merupakan salah satu populasi alam tusam yang keberadaannya terus mendapatkan tekanan atau gangguan sehingga kelestariannya pun menjadi terancam. Karenanya, kegiatan pelestarian jenis P. merkusii strain Tapanuli pada ekosistem daratan Tapanuli merupakan kegiatan penting yang perlu diprioritaskan dan didukung oleh banyak pihak. Namun pada kenyataannya kegiatan pelestarian jenis P. merkusii strain Tapanuli sering terkendala dengan minimnya data dan informasi penting yang dapat digunakan sebagai acuan untuk menyusun rencana dan program. Sedikitnya ada 3 aspek penting yang perlu digali informasinya secara akurat dan aktual yakni aspek silvikultur, aspek genetik dan aspek biomassa karbon. Atas dasar inilah maka dilaksanakanlah penelitian dengan judul: ”Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii strain Tapanuli Jungh et de Vriese pada Sebaran Alaminya di Sumatera Utara”. Ada 3 tujuan dalam penelitian ini, yaitu: 1). Menganalisis karakteristik tutupan lahan, sifat kimia tanah, dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2). Menganalisis struktur populasi dan keragaman genetik tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit. 3). Menganalisis kandungan biomassa karbon tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan persamaan allometrik yang disusun berdasarkan metode destructive sampling. Analisis tutupan lahan dilakukan untuk mengetahui perubahan tutupan lahan, penggunaan lahan dan kondisi tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di ekosistem daratan Tapanuli. Analisis perubahan tutupan dilakukan melalui analisis citra Landsat 7 ETM+ (seri 7 Enhanced Thematic Mapper Plus) tahun 1994, 2005, dan 2011. Adapun analisis kondisi tapak tumbuh dilakukan berdasarkan hasil analisis sifat kimia tanah. Analisis genetik lima populasi alam P. merkusii strain Tapanuli yang tersebar di Tapanuli dilakukan dengan menggunakan penanda molekuler mikrosatellite. Sampel daun untuk analisis genetik diambil dari pohon Pinus merkusii yang tumbuh di 5 lokasi sebaran alam yang berbeda, yakni Kawasan Hutan Lindung Dolok Tusam Barat, areal perladangan di desa Parinsoran, Hutan Lindung Dolok Tusam Timur, areal perladangan di kampung Lobugala, dan areal perbukitan hutan campuran di desa Tolang – Kec. Aek Bilah – Kab. Tapanuli Selatan. Penyusunan persamaan allometrik dilakukan dengan modifikasi metode destructive sampling pada 36 pohon sampel dan metode volumetrik pada 8 pohon sampel. Sebaran kelas diameter pohon sampel ini ditentukan dengan mengacu pada sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam – Tapanuli. Metode destructive sampling mengacu pada metode yang dikembangkan oleh JIFPRO (2000), Siregar (2007) dan Siregar (2011). Berdasarkan hasil pengolahan dan analisis data maka ada 3 simpulan yang dihasilkan dari penelitian ini: a. Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui kondisi tutupan hutan di lima lokasi penelitian relatif stabil. Bahkan di lokasi Lobugala, tutupan hutannya meningkat. Selanjutnya berdasarkan analisis sifat kimia tanah dapat diketahui kandungan karbon tanah di lima lokasi penelitian berkisar antara 46,1- 89 ton C/ha. Kandungan karbon tanah tertinggi ditemukan di Lobugala, sedangkan yang terendah di Parinsoran. Adapun berdasarkan analisis struktur tegakan dapat diketahui bahwa kelima lokasi penelitian mengalami defisit permudaan alam P. merkusii strain Tapanuli. b. Berdasarkan hasil analisis genetik dapat diketahui nilai heterosigositas harapan (He) pada lima populasi alam P. merkusii strain Tapanuli berkisar antara 0,3779 hingga 0,4693. Nilai He tertinggi dimiliki oleh populasi alam P. merkusii strain Tapanuli yang tumbuh di Lobugala, sedangkan yang terendah dimiliki oleh populasi alam Dolok Tusam Barat. Namun demikian, berdasarkan nilai heterosigositas aktualnya, hanya populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang mengalami surplus heterosigositas. Selanjutnya berdasarkan kedekatan jarak genetiknya, kelima populasi alam P. merkusii strain Tapanuli mengelompok menjadi dua kelompok besar. Kelompok pertama terdiri atas populasi Dolok Tusam Timur dan Dolok Tusam Barat. Adapun kelompok kedua terdiri atas dua sub kelompok. Sub kelompok pertama terdiri atas populasi Parinsoran dan Tolang, sedangkan sub kelompok kedua hanya terdiri populasi Lobugala. c. Persamaan allometrik terbaik untuk pendugaan biomasa karbon P. merkusii strain Tapanuli menggunakan peubah bebas diameter setinggi dada (DBH) dengan model persamaan sebagai berikut: untuk pendugaan biomassa di bagian atas tanah adalah Y = 0,1900(DBH)2,2730 RMSE=0,177670; 2,4393 0,0283(DBH) untuk , pendugaan R² = 0,97980, R2adj=0,979317, biomassa akar adalah Y = 2 R² = 0,90240, R adj=0,900094 RMSE=0,436644; dan untuk pendugaan biomassa total adalah Y= 0,2451(DBH)2,2757 R² = 0,97840 R2adj= 0,977900 RMSE=0,183996. Stok karbon P. merkusii strain Tapanuli di 5 lokasi penelitian sbb: Dolok Tusam Timur 187,8 ton C/ha, Parinsoran 48,9 ton C/ha, Dolok Tusam Barat 190,4 ton C/ha, Lobugala 93,2 ton C/ha, dan Tolang 45,7 ton C/ha. Kata kunci: Pinus merkusii strain Tapanuli, tutupan lahan, keragaman genetik, biomassa karbon, Diameter at breast height (DBH) © Hak Cipta milik IPB, tahun 2012 Hak Cipta dilindungi Undang-Undang Dilarang mengutip sebagian atau seluruh karya tulis ini tanpa mencantumkan atau menyebutkan sumber. Pengutipan hanya untuk kepentingan pendidikan, penelitian, penulisan karya ilmiah, penyusunan laporan, penulisan kritik atau tinjauan suatu masalah, dan pengutipan tersebut tidak merugikan kepentingan yang wajar bagi IPB. Dilarang mengumumkan atau memperbanyak sebagian atau seluruh karya tulis ini dalam bentuk apa pun tanpa izin IPB. ANALISIS PERUBAHAN TUTUPAN LAHAN, STRUKTUR GENETIK, DAN KANDUNGAN BIOMASSA KARBON Pinus merkusii Jungh. et de Vriese strain TAPANULI PADA SEBARAN ALAMINYA DI SUMATERA UTARA ALFAN GUNAWAN AHMAD Disertasi sebagai salah satu syarat untuk memperoleh gelar Doktor pada Program Studi Silvikultur Tropika SEKOLAH PASCASARJANA INSTITUT PERTANIAN BOGOR 2012 Penguji luar pada Ujian Tertutup: Prof. Ir. Rusli MS. Harahap, M.Sc (Ahli Peneliti Utama – Badan Litbang Kehutanan – Kementrian Kehutanan RI – Bogor) Dr. Ir. Prijanto Pamoengkas, M.Sc.F.Trop. (Kepala Bagian Silvikultur – Fak Kehutanan IPB) Penguji luar pada Ujian Terbuka: Dr. Ir. Sunaryo, M.Sc. (Staf Ahli Menteri Kehutanan RI ) Dr. Ir. Supriyanto (Staf Pengajar - Fakultas Kehutanan IPB) Judul Disertasi : Analisis Perubahan Tutupan Lahan, Struktur Genetik, dan Kandungan Biomassa Karbon Pinus merkusii Jungh et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara Nama mahasiswa : Alfan Gunawan Ahmad NRP : E461070041 Disetujui, Komisi Pembimbing Dr. Ir. Ulfah Juniarti Siregar, M.Agr. Ketua Prof. Dr. Ir. Hadi Susilo Arifin, M.S. Anggota Dr. Ir. Chairil Anwar Siregar, M.Sc. Anggota Mengetahui Ketua Departemen Silvikultur Tropika Prof. Dr. Ir. Nurheni Wijayanto, M.S. Tanggal Ujian: 18 September 2012 Dekan Sekolah Pascasarjana Institut Pertanian Bogor Dr. Ir. Dahrul Syah, MSc.Agr. Tanggal lulus: PRAKATA Alhamdulillaah atas karunia-Nya, sehingga penulis dapat menyelesaikan Disertasi yang berjudul: Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii Jungh. et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara. Ucapan terima kasih penulis sampaikan kepada Dr. Ir. Ulfah Juniarti Siregar, M.Agr selaku ketua komisi pembimbing beserta anggota komisi pembimbing Prof. Dr. Ir. Hadi Susilo Arifin, M.S. dan Dr. Ir. Chairil Anwar Siregar, M.Sc yang telah dengan ikhlas dan sabar memberikan bimbingan dan arahan kepada penulis sehingga tugas akhir ini dapat diselesaikan dengan baik. Ucapan terima kasih juga penulis sampaikan kepada Prof. Ir. Rusli MS Harahap, M.Sc, dan Dr. Ir. Prijanto Pamoengkas, M.For.Sc selaku penguji luar komisi pada Ujian Tertutup serta Dr. Ir. Sunaryo, M.Sc dan Dr. Ir. Supriyanto selaku penguji luar komisi. Semoga Allah SWT menjadikan bimbingan, arahan dan masukan untuk perbaikan penulisan ilmiah ini sebagai amal sholih. Ucapan terima kasih juga penulis sampaikan kepada Rektor Universitas Sumatera Utara (USU) dan Dekan Fakultas Pertanian USU yang telah memberi ijin kepada penulis untuk tugas belajar pada Program Doktor – Sekolah Pascasarjana IPB. Penulis juga mengucapkan terima kasih kepada Dekan Sekolah Pascasarjana IPB yang telah memberi kesempatan bagi penulis untuk menyelesaikan penulisan disertasi dengan baik. Kepada Direktur South East Asian Regional Center for Tropical Biology (SEAMEO-BIOTROP) - Bogor, penulis juga menyampaikan terima kasih atas bantuan beasiswa penelitian DIPA tahun 2011 dan fasilitas laboratorium sehingga penulis dapat melaksanakan penelitian dengan baik. Penulis juga menyampaikan terima kasih kepada rekan-rekan berikut: Iksal Yanursyah, M.Si, dan Achmad Siddik Thoha, M.Si atas bantuannya di dalam pengolahan data citra satelit; Marwan Diapari Lubis, Ph.D, Arida Susilowati, M.Si, Anidah dan I Made Mayun atas bantuannya dalam pelaksanaan penelitian genetik; Dr. I Wayan Susi Dharmawan dan Sarifudin atas bantuannya dalam pelaksanaan penelitian biomassa karbon. Selain itu penulis juga mengucapkan terima kasih kepada Bp Darmawan Edi, S.Hut, Hendra Simorangkir, dan Zen Ziallagan atas bantuan tenaganya sehingga penelitian di lapangan dapat terlaksana dengan lancar. Kepada mas Muh Nur, M.Si dan Bejo Selamet, M.Si penulis juga mengucapkan terima kasih atas bantuannya mengedit format tulisan disertasi ini sesuai dengan ketentuan penulisan ilmiah. Tak lupa penulis juga mengucapkan terima kasih kepada Ayahanda Drs Muhammad Jasak dan Ibunda Ismundari serta Istri terkasih Diah Nurdiana, S.Si atas keikhlasan dan kesabarannya mendoakan serta mendampingi penulis sehingga tugas akhir ini dapat selesai dengan baik. Semoga disertasi ini bermanfaat. Bogor, September 2012 Alfan Gunawan Ahmad RIWAYAT HIDUP Penulis dilahirkan pada tanggal 02 April 1975 di Rembang - Jawa Tengah, dari pasangan ayahanda Drs. Muhammad Jasak dan Ibunda Ismundari, merupakan anak kedua dari empat bersaudara. Pada tahun 2000 penulis menikah dengan Diah Nurdiana, S.Si dan dikarunia tiga anak laki-laki bernama Hilmi Ahmad Muttaqin, Azam Ahmad Musyaffa, dan Hasan Ahmad Musthofa. Penulis menyelesaikan pendidikan jenjang Sarjana pada tahun 1998 di Program Studi Budidaya Hutan, Jurusan Manajemen Hutan, Fakultas Kehutanan – Institut Pertanian Bogor (IPB). Pada tahun 2006 penulis berhasil menyelesaikan pendidikan Program Magister di Program Studi Ilmu Pengetahuan Kehutanan, Sekolah Pascasarjana IPB dengan sponsor dari Beasiswa Program Pascasarjana (BPPS) Departemen Pendidikan Nasional RI. Kemudian pada tahun 2007 penulis kembali mendapat kesempatan melanjutkan tugas belajar pada Program Doktor di Mayor Silvikultur Tropika, Sekolah Pascasarjana Institut Pertanian Bogor dengan sponsor dari BPPS Depdiknas RI. Sejak tahun 1999 sampai sekarang, penulis bekerja sebagai staf pengajar di Program Studi Budidaya Hutan, Departemen Kehutanan – Fakultas Pertanian Universitas Sumatera Utara, Medan. Karya ilmiah berjudul Genetic Diversity Conservation of Pinus merkusii Jungh et de Vriese and Its Natural Habitat Landscape in North Sumatra, Indonesia yang merupakan bagian dari disertasi penulis telah dipresentasikan dalam Post Graduate Research Colloquium in Southeast Asian Landscape and Urbanism 2010 pada tanggal 8-9 Februari 2010 di Departemen Arsitektur Lanskap, Universiti Teknologi Malaysia (UTM), Skudai, Johor, Malaysia. Selain itu, dua buah makalah ilmiah yang isinya merupakan bagian disertasi ini juga telah diterima redaksi Jurnal ilmiah Biodiversitas dan akan diterbitkan pada Jurnal Biodiversitas Vol. 14, No. 1, January 2013. Kedua judul makalah tersebut adalah 1). Struktur Tegakan Pinus merkusii strain Tapanuli pada Sebaran Alaminya di Sumatera Utara, dan 2). Dinamika Tutupan Lahan pada Sebaran Alam Pinus merkusii strain Tapanuli. DAFTAR ISI Halaman DAFTAR TABEL ........................................................................... xiii DAFTAR GAMBAR ........................................................................... xv DAFTAR LAMPIRAN ........................................................................... xvii PENDAHULUAN ........................................................................... 1 ........................................................................... ........................................................................... ........................................................................... ........................................................................... ........................................................................... ........................................................................... ........................................................................... 1 4 5 5 7 7 8 Latar Belakang Tujuan Penelitian Manfaat Penelitian Perumusan Masalah Hipotesis Nilai Kebaruan Kerangka Pemikiran TINJAUAN PUSTAKA ........................................................................... Perkembangan Pengelolaan Hutan Lestari .......................................... Sekilas tentang REDD+ ...................................................................... Tinjauan Umum Tentang Pinus merkusii ........................................... Ekologi Lanskap Habitat Alami P. merkusii Strain Tapanuli ............. Perkembangan Penelitian Tentang Keragaman Genetika P. merkusii . Tinjauan Tentang Mikrosatelit ............................................................. Pendugaan Kandungan Biomassa Karbon P. merkusii strain Tapanuli Ancaman Kelestarian P. merkusii ....................................................... Permasalahan Pelestarian P. merkusii ................................................. 9 9 10 11 12 14 16 17 19 20 BAHAN DAN METODE .......................................................................... Waktu dan Tempat Penelitian ............................................................. Kondisi Umum Lokasi Penelitian ....................................................... Sub-topik Penelitian 1. Analisis Perubahan Tutupan Lahan, Sifat Kimiawi Tanah dan Struktur Tegakan Alam P. merkusii strain pada Sebaran Alaminya di Tapanuli – Sumatera Utara ............. Bahan dan Alat ........................................................................... Metode ........................................................................... 21 21 22 xi 23 23 23 Sub-topik Penelitian 2. Analisis Genetik Populasi Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit ........................................................................... Bahan dan Alat ........................................................................... Metode ........................................................................... 26 26 27 Sub-topik Penelitian 3. Analisis Kandungan Biomassa Karbon Tegakan alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli Sumatera Utara...................................................................... Bahan dan Alat ........................................................................... Metode ........................................................................... 31 31 32 HASIL DAN PEMBAHASAN .................................................................. Sub-topik Penelitian 1. Analisis Perubahan Tutupan Lahan, Sifat Kimiawi Tanah dan Struktur Tegakan Alam P. merkusii strain pada Sebaran Alaminya di Tapanuli – Sumatera Utara ............ Hasil ........................................................................... Pembahasan ........................................................................... 35 35 63 Sub-topik Penelitian 2. Analisis Genetik Populasi Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit ........................................................................... Hasil ........................................................................... Pembahasan ........................................................................... 68 68 74 Sub-topik Penelitian 3. Analisis Kandungan Biomassa Karbon Tegakan alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli - Sumatera Utara ................................................................... Hasil ........................................................................... Pembahasan ........................................................................... 81 81 91 PEMBAHASAN UMUM .......................................................................... 93 SIMPULAN ........................................................................... 97 SARAN ........................................................................... 98 DAFTAR PUSTAKA ........................................................................... 99 LAMPIRAN ........................................................................... 107 xii 35 DAFTAR TABEL Halaman 1. Lokasi sebaran populasi alam P. merkusii strain Tapanuli .................... 21 2. Posisi geografis, ketinggian tempat, dan kelerengan lima lokasi sebaran alami P.merkusii strain Tapanuli pada ekosistem daratan Tapanuli......................................................................................... 22 3. Jarak antara lokasi penelitian .................................................................. 22 4. Karakteristik primer mikrosatelit hasil pada P. merkusii di hutan tanaman, di Pulau Jawa (Nurtjahjaningsih 2005)................... ..... 29 5. Tahapan dalam proses PCR .......................................... .......................... 30 6. Nilai pH tanah pada kelima tapak tumbuh P. merkusii strain Tapanuli di Tapanuli - Sumatera Utara ................................................ .. 44 7. Persentase C organik, % N, dan C/N pada lima tapak tumbuh P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara.............. .......................... 45 8. . Stok karbon tanah pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli yang tersebar di kabupaten Tapanuli Utara dan Kabupaten Tapanuli Selatan – Sumatera Utara ..................................... 46 9. Kandungan P-potensial pada tapak tumbuh lima lokasi alam P. merkusii strain Tapanuli – Sumatera Utara ....................................... 47 10. Kandungan K-potensial pada tapak tumbuh lima lokasi alam P. merkusii strain Tapanuli – Sumatera Utara ....................................... 49 11. Kandungan P-tersedia pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara ................................................................................... 50 12. Kandungan K-tersedia pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara .................................................................................... 51 13. Kandungan kation Ca2+ dan Mg2+ pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara ...................................................................................... 52 14. Kandungan kation K+ dan Na+ pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara ...................................................................................... 53 15. Kandungan KTK pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara ... 54 16. Kandungan Kejenuhan Basa pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara.................. 55 17. Keragaman nilai frekuensi alel pada setiap lokus dan populasi alam P. merkusii strain Tapanuli yang tersebar di Tapanuli – Sumatera Utara ....................................................................................... 70 18. Keragaman genetik pada lima populasi alam P. merkusii strain Tapanuli di Sumatera Utara ................................................................... 71 19. Nilai Indeks Fiksasi (Fis) dari kelima populasi P. merkusii strain Tapanuli yang diteliti ................................................................... 72 20. Jarak genetik antar populasi P. merkusii strain Tapanuli ...................... 73 21. Model persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli yang diolah dari 36 data biomassa pohon hasil destructive sampling ..................................................................... 87 22. Model persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli yang diolah dari 44 data biomassa pohon hasil modifikasi destructive sampling + volumetrik ................. 87 23. Kandungan biomassa total dan karbon P. merkusii strain Tapanuli serta kerapatan pohon di lima lokasi penelitian .................................... 90 xiv DAFTAR GAMBAR Halaman 1. Kerangka Pemikiran Penelitian “Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii Jungh et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara ............................................ 8 2. Posisi lokasi penelitian di wilayah Kec. Pangaribuan dan Kec. Garoga – Tapanuli Utara serta Kec. Aek Bilah – Kab. Tapanuli Selatan ............................................................................................. 21 3. Bentuk permanen sampel plot (PSP) mengacu pada metode Forest Health Monitoring (FHM) (Mangol, 1997) .................................... 25 4. Perubahan Tutupan Lahan di lima lokasi penelitian (Keterangan : A = Dolok Tusam Timur, B = Parinsoran, C = Lobugala, D = Dolok Tusam Barat, E = Tolang) pada tahun 1994,2005, 2011. ............... 36 5. Sebaran spasial tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994. 2005, dan 2011. (Keterangan: DTT=Dolok Tusam Timur, PAR=Parinsoran, DTB=Dolok Tusam Barat, LOB=Lobugala, TOL=Tolang) ........... 37 6. Komposisi tutupan lahan pada lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994. 2005, dan 2011. (Keterangan: DTT=Dolok Tusam Timur, PAR=Parinsoran, DTB=Dolok Tusam Barat, LOB=Lobugala, TOL=Tolang) . .......................................... 38 7. Sebaran kelas diameter jenis P. merkusii strain Tapanuli dan non Pinus pada plot penelitian di Lokasi Dolok Tusam Timur ...... 56 8. Sebaran kelas diamter jenis P. merkusii strain Tapanuli dan non Pinus pada plot penelitian di Lokasi Parinsoran ...................... 57 9. Sebaran kelas diameter jenis P. merkusii strain Tapanuli dan non Pinus pada plot penelitian di Lokasi Dolok Tusam Barat ........ 57 10. Sebaran kelas diamter jenis P. merkusii strain Tapanuli dan non Pinus pada plot penelitian di Lokasi Lobugala ........................ 58 11. Sebaran kelas diamter jenis P. merkusii strain Tapanuli dan non Pinus pada plot penelitian di Lokasi Tolang ............................ 59 12. Presentase antara luas bidang dasar P. merkusii strain Tapanuli dan luas bidang dasar non P. merkusii ............................ 59 13. Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lokasi Dolok Tusam Timur ............ 60 14. Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lokasi Parinsoran ............................ 61 15. Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lokasi Dolok Tusam Barat ............. 61 16. Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lokasi Lobugala .............................. 62 17. Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lokasi Tolang ................................. 62 18. Contoh pita DNA hasil ekstraksi. Ket: (a) pita yang dihasilkan berdasarkan kesegaran sampel; menggunakan metode ekstraksi Dneasy Plant Mini Kit (50) dari QIAGEN, (b) ukuran besarnya pengenceran hasil ekstraksi DNA beserta kontaminasinya; menggunakan metode ekstraksi CTAB. .......................................... 68 19. Hasil amplifikasi DNA P. merkusii strain Tapanuli dengan primer mikrosatelit Pm01, Pm04, Pm05, Pm07, Pm08, Pm09a, Pm12. ............................................................................................... 69 20. Dendrogram pengelompokan lima populasi alam P. merkusii strain Tapanuli berdasarkan jarak genetik Nei (1972) menggunakan UPGMA .......................................................................................... 73 21. Grafik sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Hutan Lindung Dolok Tusam Barat .............................. 82 22. Perbandingan pola sebaran diameter antara hasil inventori kluster plot di hutan lindung Dolok Tusam dengan 36 sampel pohon untuk destructive sampling serta 44 sampel pohon untuk modifikasi destructive sampling + volumetrik ................................ 84 23. Grafik sebaran alokasi biomassa pada setiap bagian pohon dari 36 Pinus merkusii strain Tapanuli yang ditebang didalam kegiatan destructive sampling ......................................................... 85 24. Grafik model persamaan allometrik terbaik untuk pendugaan biomassa Pinus merkusii strain Tapanuli ........................................ 88 25. Grafik perbandingan antara nilai dugaan biomassa hasil persamaan allometrik Tapanuli dengan persamaan allometrik Cianten ............ 88 xvi DAFTAR LAMPIRAN Halaman 1. Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005 dan 2011 ............................ 107 2. Hasil analisis genetik dengan menggunakan Software Popgene 3.2. ................................................................................................... 108 3. Hasil inventarisasi sebaran diameter tegakan alam P. merkusii Strain Tapanuli di dalam kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat – Sumatera Utara .......................... 125 4. Sebaran persentase biomassa hasil destructive sampling 36 pohon P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara ................................................................................ 126 5. Data biomassa yang menjadi input peubah bebas X untuk Penyusunan persamaan allometrik P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara .......................................... 127 6. Perbandingan nilai dugaan biomassa P. merkusii strain Tapanuli antara hasil dari persamaan allometrik Tapanuli dengan persamaan allometrik Cianten (Siregar 2007) ................................ 127 1 PENDAHULUAN Latar Belakang Hutan menyerap dan menyimpan karbon lebih banyak dibanding ekosistem daratan lain dan memiliki peran penting didalam pencegahan (mitigasi) perubahan iklim. Namun ketika hutan ditebang habis atau terdegradasi maka karbon yang tersimpan tersebut akan terlepas ke atmosfer sebagai gas karbondioksida atau gas rumah kaca yang lain. Diperkirakan setiap tahun sebanyak 1-2 Milyar ton karbon dilepaskan ke atmosfer akibat deforestasi di kawasan tropis selama 20 tahun terakhir. Hal ini menjadikan deforestasi dan degradasi hutan sebagai sumber emisi terbesar gas rumah kaca pada sebagian besar negara tropis. Sebagai contoh, deforestasi di Afrika telah mendekati 70% total emisi gas rumah kaca dari semua sektor (ITTO 2011). Selain itu, deforestasi juga menyebabkan terjadinya perubahan kondisi ekosistem daratan pada skala bentang alam (lanskap) (Fitzsimmons 2001; Lira et al. 2012), dinamika nutrisi tanah hutan (Ellingson et al. 2000), struktur tegakan (Echeverria et al. 2012), kepadatan karbon (Fitzsimmons et al. 2001), hingga struktur genetik suatu jenis (Kangas 1990; Sebbenn et al. 2008). Hal ini menempatkan deforestasi sebagai bentuk gangguan yang paling mengancam kelestarian hutan dan kelangsungan hidup manusia di muka bumi ini (Myers 1996; WCFSD 1999). Pengurangan luas hutan akibat deforestasi dan bencana alam di muka bumi selama kurun waktu 1990-2000 adalah 14.2 juta ha/tahun, dan 15.2 juta ha/tahun untuk periode 2000 hingga 2005. Adapun laju afforestasi dan perluasan hutan alam selama periode 1990 hingga 2000 adalah 10,1 juta ha/tahun dan 8,8 juta ha/tahun untuk periode 2000-2005. Dengan demikan total bersih tutupan hutan yang hilang di muka bumi selama 15 tahun (1990-2005) adalah sebesar 72.9 juta hektar dengan rata-rata laju kehilangan hutan 4,9 juta ha/tahun (FAO 2010). Selanjutnya berdasarkan hasil survey Forest Watch Indonesia (2011), dapat diketahui bahwa dalam periode 2000-2009, hutan Indonesia mengalami deforestasi sebanyak 15.16 juta hektar. Pulau Sumatera menjadi penyumbang kedua deforestasi setelah Kalimantan, yakni sebesar 3.71 juta hektar. Laju 2 deforestasi nasional pada kurun waktu tersebut adalah 1.51 juta ha/tahun. Adapun laju deforestasi untuk pulau Sumatera sebesar 412 ribu ha/tahun. Laju deforestasi untuk Sumatera Utara antara tahun 2006-2009 adalah 44099.6 ha/tahun (Kemenhut 2010). Upaya pelestarian sisa sumberdaya hutan pun harus dapat dilakukan secara terencana, menyeluruh, dan terpadu sehingga mampu memenuhi berbagai kebutuhan hajat hidup manusia yang bersumber dari hutan. Upaya pelestarian sisa sumberdaya hutan selain dilakukan untuk mempertahankan keberadaan tegakan pohon, juga untuk mempertahankan fungsi sumberdaya hutan secara optimal dan berkesinambungan. Perhatian terhadap kelestarian keberadaan dan fungsi sumberdaya hutan inilah yang mendorong banyak pihak memberikan peluang metode dan pendanaan untuk kegiatan pelestarian tersebut. Skema Reducing Emission from Deforestation and Forest Degradation + (REDD+) merupakan salah satu peluang yang ditawarkan oleh negara maju untuk kegiatan pelestarian sumberdaya hutan yang merupakan upaya mitigasi untuk mengurangi pemanasan global dan perubahan iklim global melalui pengurangan emisi gas rumah kaca dari deforestasi dan degradasi hutan. Skema REDD+ ini merupakan salah satu hasil dari pertemuan para pihak (Conference of the Parties atau COP) ke 16 yang diselenggarakan oleh United Nation Framework Convention on Climate Change (UNFCCC) di Cancun, Mexico pada tahun 2010. Skema REDD+ memberikan peluang bagi negaranegara pemilik hutan tropis untuk mendapatkan insentif pendanaan sebagai bentuk kompensasi atas upayanya melakukan mitigasi perubahan iklim melalui pencegahan deforestasi dan degradasi hutan serta peningkatan serapan biomassa karbon melalui kegiatan konservasi (the role of conservation), pengelolaan hutan secara lestari (sustainable management of forest), dan peningkatan stok karbon di hutan negara berkembang (enhancement of forest carbon stocks in developing countries) (FCCC 2011). Melalui skema REDD+ diharapkan stok karbon yang terkandung di dalam hutan tropis dunia dapat tetap terjaga dengan baik sehingga emisi karbon akibat adanya deforestasi dapat berkurang. Bagi Indonesia, kesepakatan internasional para pihak tentang REDD+ tersebut harus dapat dipahami dan dioptimalkan dengan tepat. Pemerintah 3 Indonesia tidak boleh melihat skema REDD+ secara pragmatis saja yakni sebagai skema untuk mendapatkan kompensasi pendanaan dari negara maju atas partisipasi negara didalam kegiatan yang tercakup dalam REDD+. Lebih dari itu, secara substansional, pemerintah harus dapat melihat skema REDD+ sebagai salah satu bentuk metode keilmuan untuk pelestarian sisa sumberdaya hutan yang masih ada di negeri ini sehingga sumberdaya hutan tersebut mampu menjalankan fungsinya secara optimal dan berkesinambungan. Dengan demikian keterlibatan Indonesia di dalam melestarikan sisa sumberdaya hutan melalui pengurangan deforestasi dan degradasi hutan adalah keterlibatan secara aktif, profesional, dan bermartabat. Melalui mekanisme REDD+ tersebut, diharapkan sisa sumberdaya hutan yang masih ada di muka bumi mampu menjalankan fungsi konservasi secara menyeluruh, baik sebagai areal konservasi keanekaragaman hayati maupun sebagai areal konservasi biomassa karbon. Salah satu sisa sumberdaya hutan yang memiliki potensi sebagai kawasan konservasi keanekaragaman hayati dan konservasi biomassa karbon adalah kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat di Tapanuli Utara - Provinsi Sumatera Utara. Keberadaan P. merkusii strain Tapanuli yang merupakan jenis pohon daun jarum asli Tapanuli, menjadikan kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat sebagai kawasan yang bernilai konservasi tinggi. Adapun kondisi tegakan alam P. merkusii strain Tapanuli yang berdimensi besar (diameter mencapai > 120 cm, dan tinggi mencapai 40 m), menjadikan kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat sebagai kawasan hutan yang memiliki potensi tinggi sebagai kawasan konservasi biomassa karbon. Masyarakat mengenal P. merkusii strain Tapanuli dengan sebutan Tusam Tapanuli dan menamai kawasan hutan lindung tersebut dengan sebutan Dolok Tusam (Dolok dalam bahasa Batak artinya gunung, Tusam = Pinus). Ketersediaan data yang aktual dan akurat merupakan salah satu faktor penting agar upaya pelestarian P. merkusii strain Tapanuli dapat dilaksanakan secara optimal. Seiring dengan munculnya peluang mitigasi pemanasan global dan perubahan iklim global melalui pelestarian sumberdaya hutan maka data yang perlu disediakan tersebut sedikitnya meliputi tiga aspek yakni silvikultur, genetik, 4 dan biomassa karbon. Ketiga aspek inilah yang di dalam disertasi ini akan diulas lebih mendalam. Aspek silvikultur meliputi tutupan lahan, sifat kimia tanah, dan struktur tegakan. Aspek genetik mencakup struktur populasi dan keragaman genetik. Adapun aspek biomassa karbon menganalisis kandungan biomassa karbon berdasarkan persamaan allometrik yang dibentuk melalui metode destructive sampling. Melalui pembahasan ketiga aspek ini maka karakteristik tegakan alam P. merkusii strain Tapanuli yang tumbuh pada sebaran alaminya di Tapanuli – Sumatera Utara dapat tergambarkan dengan jelas, aktual, dan akurat. Tujuan Penelitian Tujuan penelitian ini adalah: 1. Menganalisis karakteristik tutupan lahan, sifat kimia tanah, dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2. Menganalisis struktur populasi dan keragaman genetik tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit. 3. Menganalisis kandungan biomassa karbon tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan persamaan allometrik yang disusun berdasarkan metode destructive sampling. Untuk mencapai ketiga tujuan di atas maka ada 3 sub-topik penelitian yang dilakukan sebagai berikut: 1. Analisis perubahan tutupan lahan, sifat kimiawi tanah, dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2. Analisis struktur populasi dan keragaman genetik tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan menggunakan penanda molekuler mikrosatelit. 3. Analisis kandungan biomassa karbon tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara dengan 5 menggunakan persamaan allometrik yang disusun berdasarkan metode destructive sampling. Manfaat Penelitian Manfaat penelitian ini adalah: 1. Memberikan data-data dasar (database) tentang struktur tegakan P. merkusii strain Tapanuli disertai kondisi biofisik dan kimiawi tanah, perubahan tutupan lahan serta proses regenerasi alamiah merupakan informasi penting yang diperlukan untuk perencanaan dan pelaksanaan pelestarian P. merkusii strain Tapanuli. 2. Status keragaman genetik dan struktur populasi alam P. merkusii strain Tapanuli merupakan informasi penting yang diperlukan untuk kegiatan pemuliaan dan pelestarian P. merkusii strain Tapanuli. 3. Hasil pendugaan kandungan karbon serta persamaan allometrik yang dapat digunakan sebagai salah satu metode praktis untuk pendugaan kandungan biomassa karbon P. merkusii strain Tapanuli dalam dalam rangka persiapan pelaksanaan program Reduction Emission from Deforestation and Forest Degradation in Indonesia (REDDI) di kawasan hutan lindung dan konservasi. Perumusan masalah Merujuk pada hasil-hasil penelitian terdahulu, dapat diketahui bahwa populasi alam P. merkusii strain Tapanuli merupakan salah satu strain P. merkusii yang saat ini sedang terancam kelestariannya. Rendahnya nilai Heterosigositas harapan (He = 0,206) pada populasi alam P. merkusii strain Tapanuli secara tidak langsung menunjukkan adanya gangguan terhadap populasi alam P. merkusii strain Tapanuli sehingga penyebaran dan luas daerah sebarannya semakin menyempit. Hal ini menjadikan populasi alam P. merkusii strain Tapanuli tersebut diisi oleh individu-individu pohon yang secara genetik seragam (Munawar 2002; Siregar & Hattemer 1999). Selain dari indikator genetik, peringatan bahwa populasi alam P. merkusii strain Tapanuli saat ini sedang terancam kelestariannya juga muncul dari The International Union for Conservation of Nature and Natural Resources (IUCN) yang memasukkan Pinus merkusii Junghn et de Vriese ke dalam kategori 6 Vulnerable dengan kode B1+2cde ver 2.3 dalam Red List of Threatened Species tahun 2012. Menurut IUCN (2012), kategori ini menunjukkan bahwa perkiraan luas areal yang ditumbuhi oleh P. merkusii saat ini tidak lebih dari 2000 Km2 atau jangkauan areal ditemukannya P. merkusii diperkirakan tidak lebih dari 20.000 Km2. Kondisi ini terjadi antara lain karena: 1). Kondisi habitat yang terfragmentasi, 2). Terjadinya penurunan kualitas tegakan secara terus menerus, yang antara lain disebabkan oleh menurunnya kualitas tempat tumbuh, menurunnya jumlah lokasi atau sub populasi, dan menurunnya jumlah pohon induk. Sehubungan dengan hal ini, maka upaya pelestarian populasi alam P. merkusii strain Tapanuli merupakan agenda mendesak yang perlu dilakukan dan didukung banyak pihak. Dalam upaya pelestarian populasi alam P. merkusii strain Tapanuli tersebut maka ada tiga hal menarik yang sekaligus menjadi pertanyaan dalam rumusan masalah penelitian ini, yakni: a. Ekosistem daratan Tapanuli hingga sekarang terus mengalami perubahan bentuk bentang alam akibat adanya perubahan tutupan lahan sebagai dampak dari perubahan penggunaan lahan yang dilakukan oleh manusia. Selain menyebabkan perubahan tutupan hutan, perubahan tutupan lahan yang terjadi pada ekosistem daratan Tapanuli juga akan mempengaruhi sifat kimia tanah dan struktur tegakan populasi alam P. merkusii strain Tapanuli. Atas dasar inilah maka perlu diketahui bagaimanakah karakter tutupan lahan, sifat kimia tanah, dan struktur tegakan alam P. merkusii strain tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. b. Saat ini ada tiga model penyebaran populasi alam P. merkusii strain Tapanuli yang dapat dijumpai di lapangan. Pertama, populasi alam P. merkusii strain Tapanuli yang tumbuh dan menyebar di dalam kawasan hutan lindung Dolok Tusam dengan kondisi tutupan lahan berupa hutan. Kedua, populasi alam P. merkusii strain Tapanuli yang tumbuh dan menyebar di areal perladangan dengan kondisi tutupan lahan terbuka. Ketiga, populasi alam P. merkusii strain Tapanuli yang tumbuh bersamaan dengan jenis pohon daun lebar dengan kondisi tutupan lahan tertutup. Bagaimanakah keragaman genetik dan 7 pola kekerabatan genetik diantara lima populasi alam P. merkusii strain Tapanuli yang tersebar di ekosistem daratan Tapanuli ? c. Populasi alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat terdiri atas tegakan alam dengan diameter besar sehingga kawasan hutan lindung tersebut memiliki potensi besar sebagai penyimpan biomassa karbon. Bagaimanakah model persamaan allometrik yang dapat digunakan untuk menduga kandungan biomassa karbon pada tegakan alam P. merkusii strain Tapanuli? Dan berapakah simpanan biomassa karbon pada lima lokasi yang menjadi sebaran alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara? Hipotesis Ada 3 hipotesis yang akan dijawab melalui penelitian ini, yakni: 1. Perubahan tutupan lahan pada ekosistem daratan Tapanuli akan menyebabkan terjadinya keragaman sifat kimia tanah dan struktur tegakan alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara. 2. Populasi alam P. merkusii strain Tapanuli yang tumbuh pada tapak tumbuh dengan kondisi tutupan lahan yang sama akan memiliki struktur genetik yang sama sehingga berada pada kelompok (cluster) yang sama. 3. Populasi alam P. merkusii strain Tapanuli yang secara genetik berada dalam satu kelompok yang sama akan memiliki kandungan biomassa karbon yang relatif sama juga. Nilai Kebaruan Ada 3 nilai kebaruan dalam penelitian ini, yaitu: 1. Mendapatkan faktor-faktor yang mempengaruhi sifat kimia tanah dan karakter struktur tegakan P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara 2. Diketahuinya nilai keragaman genetik dan pola pengelompokan diantara lima populasi alam P. merkusii strain Tapanuli yang tersebar di ekosistem daratan Tapanuli – Sumatera Utara 8 3. Terbentuknya model persamaan allometrik yang akurat dan praktis untuk pendugaan stok biomassa karbon pada populasi alami P. merkusii strain Tapanuli yang tersebar di Tapanuli – Sumatera Utara. Kerangka Pemikiran Sustainable Forest Management Reducing Emission from Deforestation and Forest Degradation + Perubahan Tutupan Lahan ekosistem daratan yang menjadi sebaran alam Pinus merkusii strain Tapanuli di Tapanuli - Sumut Aspek Silvikultur  Tutupan hutan  Sifat kimia tanah  Struktur tegakan Aspek Genetik Aspek Biomassa Karbon  Struktur populasi  Analisis keragaman genetik dengan menggunakan penanda molekuler mikrosatellite  Analisis cluster  Analisis model persamaan allometrik yang disusun dengan metode destructive sampling  Cadangan biomassa karbon pada populasi alami P. merkusii strain Tapanuli Database untuk konservasi P. merkusii strain Tapanuli Gambar 1 Kerangka penelitian “Analisis Perubahan Tutupan Lahan, Struktur Genetik dan Kandungan Biomassa Karbon Pinus merkusii Jungh et de Vriese strain Tapanuli pada Sebaran Alaminya di Sumatera Utara”. 9 TINJAUAN PUSTAKA Perkembangan Pengelolaan Hutan Lestari Permasalahan yang muncul di sekitar pengelolaan sumberdaya alam, termasuk di dalamnya sumberdaya hutan, akan senantiasa bergulir dan terus berkembang dari waktu ke waktu. Macam dan kualitas permasalahan ini akan semakin meningkat sejalan dengan perkembangan kebutuhan dan tuntutan manusia terhadap manfaat sumberdaya hutan sebagai akibat dari terus meningkatnya jumlah penduduk, kualitas hidup manusia serta kemajuan ilmu pengetahuan dan teknologi yang sangat pesat (Suhendang et al. 1996). Ketika manusia di muka bumi ini menjadikan kayu sebagai kebutuhan utama yang dapat terpenuhi dari hutan maka ketika itu pulalah kayu menjadi fokus utama tentang kelestarian pengelolaan sumberdaya hutan. Namun pada saat manusia di muka bumi ini sudah bisa merasakan bahwa oksigen, air, dan jasa lingkungan yang membuat hidup mereka nyaman tersebut harus dipenuhi dari hutan maka pada saat itu pula fokus kelestarian pengelolaan sumberdaya hutan pun berkembang. Selain mendapat tuntutan untuk memenuhi kebutuhan kayu, sumberdaya hutan juga dituntut untuk dapat memenuhi kebutuhan non kayu untuk kenyamanan kehidupan manusia. Pergeseran paradigma tentang pengelolaan hutan lestari tersebut juga dirasakan oleh International Tropical Timber Organization (ITTO) melalui beberapa kali revisinya tentang konsep Sustainable Forest Management (SFM). Pada awalnya di tahun 1990, ITTO mencanangkan konsep SFM yang berbasiskan kelestarian hasil kayu (Sustained yield and single-use management for timber). Namun dalam perkembangannya, ITTO menyempurnakan konsep SFM dengan memasukkan beberapa aspek selain kayu, antara lain: petunjuk dan pembentukan manajemen hutan tanaman tropis (ITTO, 1993), petunjuk tentang konservasi keanekaragaman hayati (ITTO 1993), petunjuk tentang pengelolaan api di hutan tropika (ITTO 1997), petunjuk untuk restorasi, pengelolaan, dan rehabilitasi untuk hutan tropika sekunder dan terdegradasi (ITTO 2002), petunjuk untuk konservasi dan keberlanjutan pemakaian keanekaragaman hayati di hutan produksi kayu tropis (ITTO 2009). Melalui serangkaian revisi tersebut pada tahun 2011, ITTO 10 mendefinisikan SFM secara umum sebagai suatu cara menggunakan sistem biologis yang tidak merugikan kapasitas mereka untuk memenuhi kebutuhan generasi mendatang. Keberlanjutan telah menjadi prioritas politik secara global, dan untuk hutan, pengelolaan hutan lestari telah berkembang menjadi alat penting. Sekilas Tentang REDD+ Sejak diputuskan pertama kali sebagai hasil resmi dari Converence of Parties (COP) ke 13 di Bali, istilah Reduction Emission from Deforestation and Forest Degradation (REDD) kini semakin sering didiskusikan oleh berbagai pihak dari beragam latar belakang pengetahuan. Hasil kesepakatan internasional itu pun kini juga menjadi pembicaraan tingkat nasional dan lokal. Bahkan cakupan pembahasannya bertambah sehingga istilah REDD kini berubah menjadi Reducing emissions from deforestation and forest degradation, and enhancing forest carbon stocks in developing countries (REDD+) (Angelsen 2009). Hasil rumusan para pihak di Bali mengatakan bahwa baik deforestasi maupun degradasi hutan merupakan sumber utama emisi dan bahwa dalam beberapa kasus degradasi hutan (misalnya tanah lahan gambut) dapat menimbulkan tingkat emisi yang tinggi. Disepakati bahwa diskusi dan kegiatan metodologi dalam Konvensi dengan demikian harus menangani kedua sumber itu bersama-sama, meskipun para pihak terus menyatakan besarnya kesulitan untuk mendefinisikan ‘degradasi’ hutan.’ Isu-isu ilmu pengetahuan dan hukum dengan definisi yang tepat dan dapat dipercaya mengenai hutan dan degradasi hutan juga merupakan hal yang sangat penting bagi masyarakat adat dan organisasi organisasi sosial. Secara khusus, definisi degradasi hutan dapat memberikan implikasi besar mengenai bagaimana kebijakan REDD berdampak pada hak dan kesejahteraan masyarakat adat dan komunitas lokal, dan bagaimana pemanfaatan hutan tradisional ditangani sesuai dengan sistem pemantauan dan verifikasi REDD nasional. Perluasan cakupan REDD menjadi REDD+ diputuskan dalam pertemuan SBSTA bulan Juni tahun 2009 di Bonn – Jerman. Keputusan tersebut ditetapkan dalam UNFCCC Decision 2/CP.13-11 yang antara lain berbunyi: .. policy approaches and positive incentives on issues relating to reducing emissions from 11 deforestation and forest degradation in developing countries; and the role of conservation, sustainable management of forests and enhancement of forest carbon stocks in developing countries. Sejak keputusan ini maka REDD+ menjadi istilah payung untuk aksi lokal, nasional maupun global dalam rangka penurunan emisi dari deforestasi dan degradasi hutan, dan peningkatan cadangan karbon hutan di negara berkembang. Simbol plus menandakan peningkatan cadangan karbon hutan, juga merujuk pada rehabilitasi dan regenerasi hutan, pengurangan degradasi, pengurangan emisi, peningkatan serapan karbon, pergerakan karbon, atau hanya sebatas penyerapan karbon dari atmosfer dan menyimpan di dalam pool karbon hutan (Angelsen 2009). Tinjauan Umum tentang Pinus merkusii Pinus merkusii merupakan jenis Pinus tropika alami dari Asia Tenggara, meliputi Myanmar, Thailand, Laos, Kamboja, Vietnam dan Indonesia. P. merkusii adalah satu-satunya jenis pinus yang tumbuh sampai di sebelah selatan garis khatulistiwa hingga 2o6’ LS (Cooling 1968; Soekotjo 1978). Sebaran alami P. merkusii di Indonesia berada pada 3 wilayah yang berbeda di Sumatera, yaitu Aceh, Tapanuli, dan Kerinci. Iklim di ketiga tempat ini termasuk tipe B menurut klasifikasi iklim Schmidt dan Fergusson, dengan curah hujan 1.2002.500 mm/tahun. Suhu udara maksimum bulanan 20-28oC, sedangkan suhu udara minimum 15-28oC (Fandeli 1977). Berdasarkan taksonominya, klasifikasi P. merkusii sebagai berikut: Divisi : Spermatophyta Sub division : Gymnospermae Kelas : Coniferae Ordo : Pinales Famili : Pinaceae Genus : Pinus Species : Pinus merkusii Jungh et de Vriese Menurut Dallimore dan Jackson (1948), P. merkusii Jungh et de Vriese sama dengan P. finlaysoniana Wallich, P. latteri Mason, P. merkiana Gordon dan P. 12 sumatrana Jungh. Cooling (1968) mengatakan bahwa tusam mempunyai toleransi yang luas terhadap iklim dan dapat tumbuh pada daerah-daerah yang mempunyai masa 6 bulan kering sampai ke daerah-daerah basah. Jenis pinus ini ditemukan dari dekat permukaan laut sampai kira-kira 1000 meter. Di Sumatera, tegakan alam bisa juga tumbuh antara 500 sampai 2000 meter dan mungkin lebih tinggi. Iklim dan tanah sangat bervariasi menurut lokasi. Di Sumatera, tanah pada umumnya berasal dari bahan volkanik dan iklimnya basah dengan musim kering yang pendek dan curah hujan 1500 sampai 2500 mm (Lamb & Cooling 1967). Pohon P. merkusii berbatang utama tunggal (monopodial), yaitu terdiri atas batang utama yang tinggi, lurus, dan meruncing ke atas. Cabang sekundernya kecil dan banyak sekali cabang yang tersusun melingkar (verticillate) yang nampak memencar luas. Batangnya tidak mempunyai saluran xylem (xylem), dan sebagai gantinya adalah trakeida (tracheid). Kayunya mempunyai saluran getah (Suhaendi 1988). Ekologi Lanskap Habitat Alami P. merkusii strain Tapanuli Ekologi lanskap merupakan suatu cabang ilmu yang relatif baru dan memiliki peranan penting sebagai dasar untuk pengelolaan suatu ekosistem secara optimal dan berkesinambungan. Arifin et al. (2009) menyatakan bahwa secara garis besar ekologi lanskap mempelajari dasar-dasar tentang struktur, fungsi, dan perubahan-perubahan serta aplikasinya, yaitu penggunaan dasar-dasar tersebut dalam formulasi dan pemecahan masalah-masalah. Struktur merupakan salah satu aspek ekologi yang mengkaji tentang hubungan spasial antara ekosistemekosistem yang berbeda atau kehadiran elemen-elemen lebih khusus, distribusi energi, material, dan spesies dalam hubungannya terhadap ukuran, bentuk, jumlah, jenis dan konfigurasi ekosistem. Adapun fungsi menunjukkan interaksi antara elemen spasial, yaitu aliran energi, material dan spesies dalam komponen ekosistem. Proses interaksi yang terjadi dari waktu ke waktu menyebabkan kondisi struktur dan fungsi mosaik ekologis di dalam suatu lanskap atau ekosistem mengalami perubahan-perubahan. Seiring dengan kemajuan ilmu pengetahuan, kini berbagai ilmuwan lintas kepakaran mulai memasukkan ekologi lanskap sebagai salah satu perangkat penting untuk pengelolaan sumberdaya hayati yang berkelanjutan di muka bumi 13 ini. Terkait dengan hal ini, berbagai data ekologis pada suatu ekosistem merupakan informasi penting untuk pengelolaan populasi alami suatu jenis tumbuhan atau satwa secara optimal dan berkelanjutan (Arifin & Nakagoshi 2011; Saroinsong et al. 2007). Populasi alami P. merkusii strain Tapanuli pertama kali ditemukan oleh Dr Junghuhn pada tahun 1841 di hutan alam Dolok Suanon – Tapanuli, Sumatera Utara. Sejak saat itu pemerintah kolonial Belanda segera mengukuhkan Suaka Alam Dolok Saut seluas 39 Ha di Tapanuli. Hutan alam Tusam di Tapanuli tersebar secara berkelompok dalam luasan yang tidak layak diusahakan serta bercampur dengan hutan alam lainnya di gunung-gunung. Bahkan di Dolok Tusam, jenis tusam tersebut banyak dicampur dengan kemenyan. Penduduk di sekitar hutan menanami areal hutan tusam dengan kemenyan tanpa merusak pohon yang ada (Harahap 2000a). Dolok Tusam yang merupakan salah satu ekosistem alami P. merkusii strain Tapanuli terletak di Kabupaten Tapanuli Utara – Provinsi Sumatera Utara. Dolok Tusam merupakan areal yang akan ditunjuk menjadi cagar alam berada di dekat Kampung Lobu Gala, dengan ketinggian 1200 – 1300 mdpl. Tanahnya termasuk satuan dari kompleks podsolik merah kuning, latosol, dan litosol, dengan bahan induk batuan beku endapan dan metamorf, termasuk fisiografi pegunungan patahan. Geologi termasuk efusiva liparit dan permo-karbon (Kemenhut 1984 b). Curah hujan sekitar 2088 mm per tahun dan digolongkan pada tipe curah hujan B menurut klasifikasi Schmidt dan Ferguson di Siborong-borong (Harahap 2000b). Pinus merkusii strain Tapanuli memiliki sifat morfologi yang relatif lebih bagus dibanding strain Aceh, antara lain batangnya lurus, percabangan ramping, bebas cabangnya tinggi, dan getahnya banyak. Karakteristik inilah yang menjadikan P. merkusii strain Tapanuli diminati oleh banyak pihak sehingga hal ini memicu dan memacu peningkatan permintaan kayu tusam Tapanuli dari waktu ke waktu. Hasil pengamatan empiris di pos kehutanan di Simarjarunjung Kabupaten Simalungun, setiap hari rata-rata 10 truk tronton dengan kapasitas 2025 m3 kayu tusam lewat. Truk-truk tersebut membawa kayu tusam dari Tapanuli Utara dan sekitarnya dengan tujuan industri pengolahan kayu di Pematang Siantar, Tebing Tinggi, dan Medan (Harahap & Aswandi 2008). Fenomena 14 pembalakan ini telah mengakibatkan terjadinya perubahan kondisi lanskap ekosistem alami P. merkusii strain Tapanuli. Karenanya, perlu segera diantisipasi agar kondisi lanskap ekologinya mengalami perbaikan sehingga dinamika pertumbuhan tegakan hutannya (khususnya P. merkusii strain Tapanuli) dapat kembali tumbuh dengan sehat dan normal. Perkembangan Penelitian tentang Keragaman Genetika Pinus merkusii Kegiatan penelitian tentang keragaman genetik P. merkusii di Indonesia sudah sejak lama dilakukan oleh Suhaendi (1988) yang memulai penelitian keragaman genetik secara konvensional. (1988) melakukan pendugaan Di dalam penelitiannya, Suhaendi parameter-parameter genetika-ekologi dari beberapa sifat kuantitatif dalam hutan tanaman P. merkusii Jungh et de Vriese strain Tapanuli dan strain Aceh. Hasil penelitian Suhaendi (1988) menunjukkan bahwa dari 12 sifat pohon yang diamati, diketahui ada 7 sifat pohon dalam setiap strain yang dikendalikan secara kuat oleh faktor genetik, yakni: diameter batang, bentuk batang, tebal kulit batang, produksi getah, berat jenis, diameter serat dan lebar lumen sel serat kayu. Pengendalian genetik yang kuat juga terdapat pada tinggi batang bebas cabang dalam strain Tapanuli, dan pada tinggi pohon total serta kadar selulosa kayu dalam strain Aceh. Penelitian dengan topik yang sama juga dilakukan oleh Harahap (2000b), yang melakukan penelitian tentang keragaman sifat dan data ekologi populasi alam P. merkusii di Aceh, Tapanuli, dan Kerinci. Hasil penelitian ini menunjukkan bahwa pada lokasi tempat tumbuh yang berbeda terdapat perbedaan sangat nyata pada beberapa sifat pohon berikut: panjang serat, tebal dinding serat, panjang daun, berat kering daun, panjang kerucut, dan tebal kulit. Perbedaan lokasi memberikan pengaruh nyata terhadap sifat berat jenis kayu. Adapun untuk sifat diameter lumen, diameter serat, jumlah biji, dan diameter kerucut, tidak berbeda nyata pada lokasi tempat tumbuh yang berbeda. Seiring dengan kemajuan teknologi biomolekuler, penelitian keragaman genetik dengan penanda morfologi seperti yang dilakukan Suhaendi (1988) dan Harahap (2000b) mulai beralih ke penanda biokimia. Salah satunya menggunakan isozim. Analisis isozim untuk mengetahui besarnya keragaman genetik Tusam telah dilakukan oleh Kartikawati (1996 dan 1998) dan Indrioko (1996). Hasil 15 penelitian tersebut menunjukkan bahwa dari 8 sistem enzim yang digunakan ternyata hanya 3 sistem enzim dengan 7 (tujuh) loci yang polimorfik untuk tusam yaitu Esterase (EST) dengan Est-1, Est-2, Est-3 loci; Glutamate Oxaloacetate Transaminase (GOT) dengan Got-1, Got-2 loci; dan Shikimate dehydrogenase (ShDH) dengan Shd-1 dan Shd-2 loci (Munawar 2002). Obyek penelitian Kartikawati (1996) dan Indrioko (1996) tersebut adalah hutan tanaman P. merkusii yang ada di Jawa. Hasil penelitiannya menunjukkan bahwa Tusam yang sudah berkembang luas di Jawa ternyata hanya berasal dari sebagian provenans yang ada di Aceh. Hasil penelitian Harahap (2000b) tentang keragaman sifat dan data ekologi populasi alami P. merkusii serta hasil uji asal benih P. merkusii di Sumatera Utara lebih mempertegas lagi bahwa tusam yang telah berkembang luas selama ini adalah berasal dari populasi Aceh. Adapun tusam yang berasal dari populasi Tapanuli dan Kerinci belum dibudidayakan dalam skala luas, antara lain disebabkan oleh keterbatasan ketersediaan benih. Kartikawati dan Na’im (1999) kembali melakukan uji keragaman genetik dengan menggunakan penanda isozim. Di dalam penelitiannya mereka menguji keragaman genetik dari tiga populasi P. merkusii yang berbeda yakni populasi alami P. merkusii dari hutan alam di Aceh, populasi P. merkusii dari hutan tanaman di Jawa, ( populasi P. merkusii dari kebun benih di Jember, Jawa Timur) . Ada 3 (tiga) sistem enzim yang digunakan dalam penelitian mereka yakni Esterase (EST), Glutamate Oxaloacetate Transaminase (GOT) dan Shikimate Dehydrogenase (ShDH). Hasil penelitian ini menunjukkan bahwa populasi alami Aceh memiliki keragaman genetik tertinggi (nilai He=0.304) dibanding populasi hutan tanaman (nilai He = 0.276) dan kebun benih (nilai He = 0.266). Analisis keragaman genetik P. merkusii dengan menggunakan penanda genetik isozym kembali dilakukan oleh Siregar dan Hattemer (1999). Penelitian ini menguji keragaman genetik dari dua populasi alam P. merkusii di Sumatera dan satu populasi hutan tanaman di Jawa. Sampel yang diuji keragaman genetiknya berupa biji. Ada delapan lokus isoenzym yang digunakan untuk penelitian ini yakni: GOT-B, GOT-C, GOT-D, PGM-A, PGM-B, SKDH-A, NDH-A, dam FHD-A. Hasil analisis penelitian ini menunjukkan bahwa nilai beberapa parameter genetik antara populasi alami P. merkusii Aceh dengan hutan 16 tanaman di Jawa relatif sama. Namun demikian, nilai beberapa parameter genetik hutan tanaman P. merkusii di Pulau Jawa lebih tinggi dibanding populasi alaminya di Aceh. Selain itu, hasil penelitian ini juga menujukkan bahwa nilai keragaman genetik P. merkusii yang ada di Indonesia lebih tinggi dibandingkan dengan P. merkusii yang ada di Thailand (Szmidt et al. 1996). Penelitian tentang analisis keragaman genetik dengan penanda genetik isozim juga dilakukan oleh Munawar (2002). Di dalam penelitiannya, Munawar (2002) melakukan studi keragaman genetik Tusam (P. merkusii Jungh. et de Vriese) di hutan alam Tapanuli dan Kerinci. Hasil penelitian tersebut menunjukkan bahwa provenansi Kerinci memiliki nilai Heterozigositas harapan (He) paling kecil (0.042) dibanding populasi alam Tapanuli (0.206), Aceh (0.304) dan Jawa (0.276). Keragaman genetik populasi alam Tapanuli lebih rendah dibanding poopulasi Aceh dan Jawa. Fenomena ini terjadi antara lain karena populasi alami P. merkusii di Kerinci sudah terpecah-pecah berupa kumpulan individu-individu dalam jumlah dan luasan yang sempit sehingga terjadi seleksi mundur (dysgenic selection) dan telah banyak terjadi kawin kerabat (inbreeding) (Munawar 2002). Penggunaan penanda genetik mikrosatelit untuk menganalisis keragaman genetik P. merkusii di Indonesia pertama kali dilakukan oleh Nurtjahjaningsih et al. (2005). Di dalam penelitiannya, Nurtjahjaningsih et al. (2005) mencoba mengembangkan penanda genetik mikrosatelit untuk mendapatkan informasi genetik dari kebun benih P. merkusii yang ada di Pulau Jawa. Hasil penelitian tersebut menunjukkan bahwa dari 10 primer yang dikembangkan dari P. merkusii, 5 diantaranya bersifat kodominan dan polimorfik. Jumlah alel per lokus berkisar antara 3 sampai 6 dan nilai heterosigositas harapan berkisar antara 0.389 sampai 0.728. Kelima penanda mikrosatelite tersebut dapat digunakan untuk analisis genetik populasi dan pola perkawinan. Tinjauan Tentang Mikrosatelit Mikrosatelit atau yang juga dikenal dengan Short Tandem Repeats (STRs) atau Variable Number of Tandem Repeats (VNTR) merupakan untaian basa nukleotida 1-6 pasang basa yang berulang dan tersebar di dalam genom, baik 17 genom inti maupun genom organel. Tipe pengulangan basa dari mono-, di-, tri-, tetra-, dan penta-nukleotida. Mikrosatelit genom organel terdiri mikrosatelit kloroplas (cpSSRs) dan mikrosatelit mitokondrion (mtSSRs) dengan tipe mononukleotida. Mikrosatelit yang berasal dari genom organel ini banyak digunakan untuk studi pewarisan karena sifat dari genom organel yang hanya diturunkan secara uniparental. Mikrosatelit telah banyak dipergunakan untuk meneliti berbagai tanaman dan ada sekitar 8000 konten penulisan jurnal tentang mikrosatelit (Zane et al. 2002). Mikrosatelit memiliki keunggulan dalam berbagai studi genetika karena pola pewarisan mengikuti hukum Mendel, tingkatan polimorfik tinggi, bersifat kodominan, keakuratan yang tinggi dan berlimpah di genom. Marka ini banyak digunakan untuk studi genetik populasi, ekologi, pemuliaan tanaman dan aliran gen (gene flow). Penanda mikrosatelit dipilih karena merupakan penanda kodominan yang mampu mengidentifikasi genotipe homozigot dan heterozigot dalam populasi, memiliki reproducibility yang tinggi, tingkat polimorfisme tinggi, multialelik, dan terdistribusi merata dalam genom (Karhu 2001 dan Weising et al. 2005 ). Pada pinus lain di daerah temperate penggunaan mikrosatelit telah umum digunakan, namun pada P.merkusii baru pada tahun 2005 dikembangkan (Nurtjahjaningsih et al.2005). Hasil penelitian menemukan sepuluh lokus yang mampu diisolasi dimana lima lokus bersifat polimorfik dan kodominan, dua lokus bersifat monomorfik, dua lokus bersifat multiband dan satu lokus tidak mampu mengamplifikasi. Selanjutnya Nurtjahjaningsih et al. (2005) merekomendasikan penggunaan lima primer (pm01, pm05,pm07, pm09a dan pm12) untuk deteksi mikrosatelit pada P. merkusii. Pendugaan Kandungan Biomassa Karbon Pinus merkusii strain Tapanuli Berbagai bentuk tekanan terhadap ekosistem hutan yang menjadi habitat alami populasi P. merkusii strain Tapanuli selain berpengaruh terhadap struktur genetik jenis P. merkusii juga berpengaruh terhadap kondisi pertumbuhan tegakannya. Biomassa merupakan salah satu parameter yang dapat digunakan untuk mengetahui besarnya kondisi pertumbuhan suatu jenis tumbuhan di dalam suatu ekosistem. Hal ini mengacu pada IPCC (2003) yang mengartikan biomassa 18 sebagai total berat atau volume organisme dalam suatu area atau volume tertentu. Pengertian ini diperkuat oleh Brown (1997), yang mendefinisikan biomassa sebagai total jumlah materi hidup di atas permukaan suatu pohon dan dinyatakan dengan satuan ton berat kering per satuan luas. Mengingat sebagian besar komponen biomassa tumbuhan terdiri atas karbon dan seiring dengan menguatnya upaya mitigasi perubahan iklim global maka istilah biomassa karbon kini menjadi lebih populer dibanding istilah biomassa. Pendugaan biomassa tegakan dan pohon telah diakui sebagai salah satu tahapan penting dalam rangka penilaian stok karbon hutan sesuai dengan Protokol Kyoto untuk pengurangan gas rumah kaca (Brown 2002; Korner 2005; Pili et al, 2006). Salah satu pendekatan untuk mengkuantifikasi simpanan biomassa karbon adalah melalui penelaahan terhadap perubahan-perubahan yang berasal dari plot inventarisasi hutan jangka panjang. Model regresi digunakan untuk mengkonversi data inventarisasi tersebut menjadi nilai dugaan biomassa bagian atas (above ground biomass) (Chave et al. 2005). Aplikasi persamaan allometrik yang dikombinasikan dengan data inventarisasi hutan merupakan suatu pendekatan yang cukup efektif untuk menghitung besarnya biomassa hutan dan simpanan karbon hutan pada suatu skala regional (Xiang et al. 2011). Pinus merkusii strain Tapanuli merupakan tusam yang memiliki morfologi dan beberapa sifat pohon lebih baik dibanding tusam Aceh yang selama ini telah banyak dibudidayakan. De Veer dan Govers (1953) ; Soerianegara dan Djamhuri (1979) diacu dalam Suhaendi (1988) dan Harahap (2000b) telah mencatat beberapa keunggulan sifat pohon tusam Tapanuli tersebut, yakni: bentuk batang lurus dan ramping, daun tebal dan berwarna hijau tua dan mengkilap, sistem percabangan: cabang-cabang lebih kecil, membentuk sudut lancip terhadap batang; ruas batang lebih panjang dan jaraknya lebih teratur, kulit batang tipis dan berwarna muda, beralur dangkal, umumnya licin; produksi getah lebih banyak. Beberapa keunggulan sifat pohon tersebut secara tidak langsung mengindikasikan bahwa pertumbuhan P. merkusii strain Tapanuli lebih unggul dibanding pertumbuhan P. merkusii strain Aceh sehingga jumlah biomassa karbonnya pun lebih besar. Saat ini belum ada penelitian yang secara khusus melakukan penghitungan biomassa karbon P. merkusii strain Tapanuli, serta mendapatkan 19 persamaan allometrik yang selanjutnya dapat digunakan untuk pendugaan kandungan biomassa karbonnya. Beberapa penelitian yang telah berhasil mendapatkan persamaan allometrik untuk pendugaan kandungan biomassa karbon dari P. merkusii dilakukan pada hutan tanaman di Jawa yang merupakan P. merkusii strain Aceh. Hasil penelitian Basuki et al. (2004) menunjukkan bahwa tegakan pinus umur 16 tahun dengan kerapatan 1200 pohon/ha dapat mengandung 126.8 C-organik/ha atau setara dengan penyerapan 464.9 ton CO2/ha. Persamaan allometrik untuk pendugaan kandungan biomassa karbon P. merkusii telah dihasilkan Siregar (2007) di Jawa Barat yakni: Y = 0.0936 X 2.4323 untuk biomasa Pinus merkusii di atas tanah Y = 0.0103 X 2.6036 untuk biomasa Pinus merkusii di bawah tanah Y = 0.1031X2.4587 untuk biomasa total Pinus merkusii Inisial X menunjukkan diameter batang Pinus merkusii yang diukur pada ketinggian 1,3 meter (setinggi dada orang dewasa). Ancaman Kelestarian Pinus merkusii Pinus merkusii strain Tapanuli merupakan satu dari tiga strain P. merkusii yang memiliki nilai ekonomi kayu relatif tinggi karena bentuk kayunya yang relatif lebih lurus, percabangan ramping, kulit batang tipis, dan getah lebih sedikit. Hal inilah yang menyebabkan jenis P. merkusii strain Tapanuli diburu oleh para penebang liar. Hasil pengamatan sepintas di pos kehutanan di Simarjarunjung Kabupaten Simalungun, setiap hari rata-rata 10 truk tronton dengan kapasitas 2025 m3 kayu tusam lewat. Truk-truk tersebut membawa kayu tusam dari Tapanuli Utara dan sekitarnya dengan tujuan industri pengolahan kayu di Pematang Siantar, Tebing Tinggi, dan Medan (Harahap & Aswandi 2008). Selain ancaman dari kegiatan penebangan, kelestarian P. merkusii juga mendapat ancaman dari faktor alami, seperti serangan hama, penyakit, atau kebakaran. Di Indonesia tanaman ini diserang oleh beberapa hama diantaranya adalah Melionia basalis (Geometridae, Lepidoptera), Eumeta variagatus (Psehidae, Lepidoptera), Dyorictria rubella (Pyralidae, Lepidoptera) dan juga Coptotermes traviens (Husaeni 1996). Resiko terhadap munculnya serangan hama, penyakit, atau kebakaran tersebut semakin meningkat seiring dengan terjadinya fenomena perubahan iklim global. Munculnya jenis hama baru akibat pengaruh perubahan iklim global tersebut ditengarai kuat telah terjadi di wilayah 20 ekosistem hutan tropis, seperti hama kutu lilin yang menyerang tegakan hutan tanaman Pinus (P. merkusii) di Pulau Jawa (Rahmatsyah & Haneda 2007). Permasalahan pelestarian Pinus merkusii Sedikitnya ada 2 permasalahan pelestarian P. merkusii yang sering dijumpai di lapangan yakni keterbatasaan ketersediaan anakan alami di lapangan dan masih terbatasnya teknologi perbenihan P. merkusii strain Tapanuli. Permudaan alami P. merkusii strain Tapanuli sulit didapatkan pada tegakan yang tertutup. Akan tetapi permudaan alami banyak ditemui pada daerah yang terbuka seperti pada bekas tanah longsor (Yafid et al. 2005). Sementara itu teknologi perbenihan P. merkusii strain Tapanuli dan Kerinci relatif belum berkembang dibandingkan P. merkusii strain Aceh yang telah diteliti hasil persilangan terkendali dan dibangun tegakan kebun benihnya (Harahap 2000c; Hendrati et al. 1997). Keterbatasan teknologi perbenihan tersebut kemungkinan besar terkait dengan adanya gejala ketidaksesuaian diri secara genetik (genetic self incompatibility akibat pengaruh dari pembentukan strobili jantan dan strobili betina pada waktu yang berbeda pada satu pohon yang sama (Burley 1976; Harahap & Mukti 1976). 21 METODOLOGI Waktu dan Tempat Penelitian Penelitian dilaksanakan selama sembilan bulan (Agustus 2011 – Mei 2012). Penelitian ini dilaksanakan di lima lokasi yang menjadi sebaran populasi alam P. merkusii strain Tapanuli, seperti pada Tabel 1. Adapun posisi lokasi penelitian di dalam peta Sumatera Utara disajikan pada Gambar 2. Tabel 1 Lokasi sebaran populasi alam P. merkusii strain Tapanuli Sebaran Populasi Kawasan hutan lindung Dolok Tusam Timur Areal perladangan milik penduduk Kawasan hutan lindung Dolok Tusam Barat Areal perladangan milik penduduk Hutan campuran di perbukitan Lokasi Kecamatan Garoga, Kabupaten Tapanuli Utara Desa Parinsoran, Kecamatan Garoga, Kabupaten. Tapanuli Utara Kecamatan Pangaribuan, Kabupaten Tapanuli Utara Kampung Lobugala, Desa Pansurnatolu, Kecamatan Pangaribuan, Kabupaten Tapanuli Utara Desa Tolang, Kecamatan Aek Bilah, Kabupaten Tapanuli Selatan Gambar 2 Posisi lokasi penelitian di wilayah Kecamatan Pangaribuan dan Kecamatan Garoga – Tapanuli Utara serta Kecamatan Aek Bilah – Kabupaten Tapanuli Selatan. 22 Kondisi Umum Lokasi Penelitian Kelima lokasi penelitian merupakan sebaran alam P. merkusii strain Tapanuli yang terletak di kawasan perbukitan dengan kondisi topografi berat dengan ketinggian tempat berkisar antara 800 – 1300 mdpl. Posisi geografis kelima lokasi yang diteliti berada diantara 99o07’00” – 99o27’00” Bujur Timur dan 1o47’00” – 2o07’00” Lintang Utara. Secara lebih terperinci informasi mengenai kondisi ekologis kelima lokasi sebaran alam P. merkusii strain Tapanuli yang diteliti disajikan pada Tabel 2. Tabel 2 Posisi geografis, ketinggian tempat, dan kelerengan lima lokasi sebaran alam P. merkusii strain Tapanuli pada ekosistem daratan Tapanuli yang diteliti No. LOKASI Koordinat geografis Ketinggian Lintang Utara Bujur Timur (mdpl) 1. DOLOK TUSAM TIMUR 2. PARINSORAN 01o59'29,8" 099o15'10,0" Kelerengan Klasifikasi 1096 25 - 45% atau lebih curam - sangat curam o o 1031 8-25% landai - agak curam o o 1269 15 - 45% atau lebih agak curam - sangat curam o o 02 00'41,2" 099 15'34,4" 3. DOLOK TUSAM BARAT Satuan 01 57'16,2" 099 15'50,1" 4. LOBUGALA 01 56'49,2" 099 14'39,4" 1175 8-25% landai - agak curam 5. TOLANG 01o54'30,3" 099o25'02,2" 1059 25 - 45% atau lebih curam - sangat curam Pada Tabel 2 dapat diketahui urutan lokasi sebaran alam P. merkusii strain Tapanuli dari yang tertinggi hingga yang terendah sebagai berikut: Dolok Tusam Barat, Lobugala, Dolok Tusam Timur, Tolang, dan Parinsoran. Adapun berdasarkan kondisi topografinya, sebagian besar lokasi sebaran alam P. merkusii strain Tapanuli berada pada lokasi dengan kelerengan agak curam hingga sangat curam. Hanya di Parinsoran dan Lobugala, populasi alam P. merkusii strain Tapanuli berada pada kelerangan landai hingga agak curam. Berdasarkan hitungan jarak datar yang diukur dari software Geographical Information System (GIS) dapat diketahui jarak datar antar lokasi penelitian (Tabel 3). Tabel 3 Jarak antar lokasi penelitian Lokasi Dolok Tusam timur Parinsoran Dolok Tusam Barat Lobugala Tolang Dolok Tusam timur ***** 2.3 4.2 5.1 20.5 Jarak datar (km) Parinsoran Dolok Tusam Barat Lobugala Tolang ***** 6.3 7.3 20.9 ***** 19.7 ***** ***** 2.3 17.5 23 Sub-topik Penelitian 1: Analisis Perubahan Tutupan Lahan, Sifat Kimiawi Tanah, dan Struktur Tegakan Populasi Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara Bahan dan Alat Bahan utama penelitian ini adalah citra Landsat 7 ETM+ (Enhanced Thematic Mapper) liputan tahun 1994, 2005, dan 2011 dan peta Rupa Bumi Indonesia (RBI) provinsi Sumatera Utara. Bahan lain berupa bahan tulis menulis dan beberapa software yang terkait, yakni: software ERDAS Imagine dan ArcView GIS. Adapun peralatan yang diperlukan untuk penelitian ini adalah: komputer, kompas, GPS, ring tanah untuk pengambilan contoh tanah, kamera digital, tally sheet. Metode 1. Analisis tutupan lahan pada ekosistem hutan Tapanuli – Sumatera Utara Perubahan tutupan lahan dianalisis dengan menggunakan pengolahan citra satelit (Image Processing) elit dan analisa spasial. Sumber data untuk menganalisis perubahan tutupan lahan yaitu citra Landsat tahun 1994, 2005, dan 2011. Jenis citra yang digunakan adalah citra Landsat 7 ETM+ (seri 7 Enhanced Thematic Mapper Plus) yang memiliki resolusi menengah (1 pixel = 30 x 30 m) dengan daerah liputan cukup luas bila dibandingkan dengan citra SPOT-5 dan Quickbird. Klasifikasi penutupan lahan secara digital dilakukan dengan menggunakan metode maximum likelihood classification (MLC). Tahapan pengolahan data citra dan analisis perubahan tutupan lahan adalah sebagai berikut : a. Persiapan Citra Satelit dibuat dalam format image (img) dan dibuat dalam bentuk Citra Komposit (layer stack) dengan kombinasi Band 542. Band 542 umum digunakan untuk klasifikasi lahan untuk penentuan tutupan lahan dan penggunanaan lahan karena menggambarkan perbedaan lahan bervegetasi dan non vegetasi dengan lebih jelas. 24 b. Cropping Area Citra Satelit dipotong (cropping) sesuai dengan batas area yang akan diklasifikasi melalui metode Subset Image. c. Klasifikasi Citra Klasifikasi citra menggunakan gabungan tiga metode yaitu Unsupervised Classification, Supervised Classification (Maximum Likelihood) (Richards 1986), dan Visual Interpretation. Tiga metode tersebut lebih menghasilkan hasil klasifikasi citra yang mendekati kondisi lapangan atau hasil groundcheck. Pada kelas penggunaan lahan yang sulit dipisahkan berdasarkan karakteristik pixel-nya dilakukan deliniasi manual sesuai metode interpretasi visual (penafsiran visual). Kelebihan dari teknik interpretasi visual ini dibandingkan dengan interpretasi otomatis adalah dasar interpretasi tidak semata-mata kepada nilai kecerahan, tetapi konteks keruangan pada daerah yang dikaji juga ikut dipertimbangkan (Lillesand & Kiefer 1990). Dalam interpretasi manual ini peranan interpreter dalam mengontrol hasil klasifikasi menjadi sangat dominan, sehingga hasil klasifikasi yang diperoleh relatif lebih masuk akal. d. Mengidentifikasi dan analisis obyek atau tipe vegetasi dari dengan menggunakan informasi spasial seperti ukuran, bentuk, tekstur, pola, bayangan asosiasi dan situs sesuai dengan konteks keruangan. Hasil identifikasi dan analisis obyek akan menentukan klasifikasi penutupan lahan yang terbagi menjadi lima kelas. e. Konversi Format Raster ke Vektor Proses ini untuk memudahkan dalam analisis spasial menggunakan Geographic Information System (GIS) f. Membuat antar waktu tampilan visual peta perubahan tutupan lahan analisis spasial pada masing-masing lokasi atau plot penelitian (5 lokasi). Selanjutnya untuk mendapatkan luas perubahan tutupan lahan dibuat matrik perubahan tutupan lahan antar waktu (1994, 2005dan 2011). 25 2. Analisis sifat kimia tanah dan struktur tegakan pada tapak tumbuh Pinus merkusii strain Tapanuli Kondisi tapak tumbuh dianalisis melalui analisis sifat kimia tanah pada lima lokasi sebaran alam P. merkusii strain Tapanuli. Contoh tanah diambil dari 4 lapisan kedalaman tanah yakni: 0-5 cm, 5-10 cm, 10- 20 cm, 20-30 cm pada setiap kluster plot penelitian dengan menggunakan ring tanah. Plot pengamatan untuk analisis struktur tegakan berbentuk kluster plot yang penempatannya menggunakan metode purposive sampling. Setiap lokasi diwakili oleh 1 kluster plot yang terdiri atas 4 sub plot berbentuk lingkaran dengan luas masing-masing sub plot 0.1 ha sehingga luas per kluster plot adalah 0.4 ha. Kluster plot yang berbentuk lingkaran ini dipilih dengan pertimbangan kemudahan dan kepraktisan penggunaannya di lapangan. Penggunaan kluster plot ini diturunkan dari metode Forest Health Monitoring (FHM) yang membagi habis permukaan bumi dengan bentuk heksagon. Setiap heksagon memiliki luas 2400 hektar sehingga intensitas sampling untuk setiap kluster plot adalah 0.016 % (Mangold 1997) seperti disajikan pada Gambar 3. Parameter yang diamati adalah diameter dan tinggi tegakan P. merkusii strain Tapanuli. Gambar 3 Bentuk Permanen Sampel Plot (PSP) mengacu pada metode Forest Health Monitoring (FHM) (Mangold 1997). 26 Setiap kluster plot terdiri atas 4 annular-plot dan 4 sub-plot. Annular-plot dan sub-plot nomor 1 berada di pusat, sedang annular-plot dan sub-plot lainnya berada pada azimuth tertentu dari annular-plot dan sub-plot nomor 1. Posisi annular-plot dan sub-plot nomor 2 berada pada azimuth 360o dari posisi annularplot dan sub-plot nomor 1. Posisi annular-plot dan sub-plot nomor 3 berada pada azimuth 120o dari posisi annular-plot dan sub-plot nomor 1. Posisi annular-plot dan sub-plot nomor 4 berada pada azimuth 240o dari posisi annular-plot dan subplot nomor 1. Antara titik pusat annular plot 1 dengan titik pusat annular plot yang lain berjarak 36.6 m. Setiap annular-plot memiliki luas 0.1 ha sehingga luas dalam 1 kluster plot adalah 0.4 m. Adapun total luas lingkaran kluster (di dalam dan di luar plot) menjadi 1 ha. Di dalam setiap sub-plot terdapat mikroplot dengan radius 2.07 m pada jarak 3.66 m dan azimuth 90o dari titik pusat sub-plot. Sub-topik Penelitian 2: Analisis Genetik Populasi Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara dengan Menggunakan Penanda Molekuler Mikrosatelit Bahan dan alat Bahan yang digunakan dalam penelitian ini adalah daun tanaman Pinus merkusii strain Tapanuli. Untuk proses ekstraksi, bahan kimia yang digunakan adalah buffer ekstrak, PVP 2%, Chloroform IAA, phenol, isopropanol dingin, NaCl, Etanol 95%, buffer TE, aquabidest, H2O, primer mikrosatelit, Qiagen Taq polymerase, agarose, buffer TAE 1x, blue juice 10x, marker, Etidium bromida. Acrilamide, APS, Temed, Formalin, NaOH, NH4OH, Asetat 1%, Amonia, AgNO3. Sedangkan alat yang digunakan adalah sarung tangan karet, gunting, tube 1.5 ml, tube 0.2 ml spidol permanen, mortar, pestel, pipet mikro, tips, rak tube, vortex, mesin sentrifugasi, waterbath, freezer, timbangan analitik, desikator, mesin PCR, bak elektroforesis, cetakan agar, microwave, gelas ukur, ultraviolet transilluminator, alat foto DNA. 27 Metode 1. Pengambilan Sampel Unit sampel untuk analisis genetik ini adalah populasi. Di dalam penelitian ini ada 5 populasi alam P. merkusii strain Tapanuli yang menyebar pada lokasi yang berbeda tetapi masih di dalam ekosistem hutan Tapanuli. Informasi kelima lokasi sebaran disajikan pada Tabel 1. Jumlah pohon yang dijadikan sampel untuk setiap lokasi populasi alam diupayakan mencapai 24-30 individu pohon, sedangkan sampel yang diambil untuk analisis genetika ini berupa daun. Prosedur pengambilan sampel di lapangan adalah sebagai berikut: a. Daun diambil dari setiap individu pohon sebanyak 2 – 5 pucuk daun. b. Daun tersebut selanjutnya dimasukkan ke dalam plastik klips yang berisi silika gel. c. Dalam satu lokasi diharapkan dapat dijumpai 24 - 30 d. Setiap pohon yang daunnya diambil diukur tinggi, diameter dan letak geografisnya dengan menggunakan alat ukur e. Jarak antar pohon sampel dalam satu populasi minimal 30 meter f. Data mengenai tinggi, diameter dan letak geografis, serta pemetaan pohon induk maupun anakan dicatat kedalam lembar data (datasheet). 2. Ekstraksi DNA Metode yang digunakan untuk ekstraksi DNA ini adalah metode CTAB (Cetyl Trimethyl Ammonium Bromide) yang telah dimodifikasi. Daun dipotong dengan ukuran 2 X 2 cm, kemudian digerus dengan menambahkan nitrogen cair di dalam pestel/mortar yang bersih. Hasil gerusan kemudian dimasukkan ke dalam tabung mikro 2 ml dan ditambahkan larutan buffer ekstrak sebanyak 500 – 700 µl. Agar daun hasil gerusan tercampur dengan larutan penyangga dan PVP 2% secara merata maka tabung yang berisi hasil gerusan tersebut di vortex. Setelah itu diinkubasi dalam dalam water bath selama 45 menit – 1 jam sambil dibolak-balik setiap 15 menit. Suhu optimal yang digunakan dalam proses inkubasi berkisar antara 65-700C. Apabila proses inkubasi melebihi suhu optimal maka DNA yang ada dalam tube akan rusak. Setelah proses inkubasi, tabung mikro tersebut diangkat dan didinginkan selama 15 menit kemudian ditambahkan kloroform sebanyak 500 µl dan fenol 28 sebanyak 10 µl, lalu sentrifugasi pada kecepatan 13000 rpm selama 2 menit. Hasil sentrifugasi (supernatan) akan terpisah menjadi dua fase yaitu bagian atas merupakan fase air yang berisi asam nukleat dan bagian bawah yaitu fase organik yang berisi pelarut organik. Fase air menggunakan pipet mikro dipisahkan dari fase organik dengan lalu dipindahkan kedalam tabung mikro baru. Kemudian ditambahkan chloroform 500 µl dan fenol 10 µl sebanyak dua kali secara berulang yang bertujuan untuk memperoleh DNA yang memiliki tingkat kemurnian tinggi. Supernatan yang telah terpisah dari fase organik, ditambahkan isoproponal dingin sebanyak 500 µl dan NaCl atau NaOAc sebanyak 500 µl dan 300 µl. Campuran ini disimpan dalam freezer selama 45 menit – 1 jam. Hasil pengendapan tersebut disentrifuge pada kecepatan 13000 rpm selama 2 menit kemudian cairan dalam tabung mikro dibuang. Hasil pengendapan akan berupa pelet DNA. Pelet DNA ini kemudian ditambahkan etanol 100% sebanyak 300 µl dan disentrifuge selama 2 menit pada kecepatan 13000 rpm, kemudian cairan etanol tersebut dibuang. Setelah itu pelet DNA yang tersisa dalam tabung mikro dikeringkan dalam desikator dengan posisi terbalik selama 10 menit lalu ditambahkan larutan TE sebanyak 20 µl difortex kemudian disimpan didalam freezer. Selama proses pengeringan pelet DNA, disiapkan agarose 1% (0.33 gram agarose dalam 33 ml TAE). Untuk proses elektroforesis, diambil 3 µl DNA ditambahkan 2 µl blue juice 10 X dan kemudian di running pada tegangan 100 selama ± 30 menit. DNA akan bergerak kearah positif (anoda). Hasil elektroforesis kemudian direndam dalam larutan etidium Bromide (ETBR) 10 µl per 200 ml aquades selama 3 – 5 menit dan selanjutnya dilihat pada UV transiluminator. 3. Seleksi Primer Primer adalah rantai pendek DNA yang dihasilkan secara buatan biasanya antara 10 – 25 nukleotida. Primer berfungsi sebagai titik mula terjadinya sintesis oleh enzim yang disebut DNA polymerase yang diperoleh dari bakteri Thermus aquaticus. Enzim ini biasa disebut juga Taq DNA polymerase. Enzim ini sesuai untuk proses amplifikasi karena dapat bertahan pada suhu tinggi hingga 950C 29 meskipun suhu optimum bagi aktifitas enzim adalah 720C. Setelah terjadi annealing selanjutnya dilakukan perbanyakan fragmen DNA melalui proses ekstensi pada suhu 720C. Seleksi primer dimaksudkan untuk mencari primer acak yang menghasilkan penanda polimorfik, karena tidak semua primer nukleotida dapat menghasilkan produk amplifikasi (primer positif) dan dari primer positif tidak semuanya menghasilkan fragmen DNA polimorfik. Proses penyeleksian primer yang digunakan dalam metoda mikrosatellite mengikuti primer yang pernah diuji oleh Nurtjahjaningsih et al. (2005), karena belum ada penelitian pendahuluan terhadap jenis P. merkusii alami yang dapat mengamplifikasi DNA tanaman ini. Dalam penelitian ini digunakan 7 primer yang dipilih dari hasil temuan mikrosatelit pada P. merkusii di hutan tanaman (Nurtjahjaningsih et al. 2005). Informasi tentang ketujuh primer mikrosatelit tersebut tersaji pada Tabel 4. Tabel 4 Karakteristik primer mikrosatelit dari Pinus merkusii di hutan tanaman, di Pulau Jawa (Nurtjahjaningsih et al. 2005) No Lokus Ukuran Produk (bp) Suhu annealing (oC) Motif Pengulangan Sekuen primer (5'-3') Nomor Akses ke Bank Gen 1. pm01 111-117 56 (TG)12 F: AGAGAAGGCACGATTTTGTC R: TCCCACTAATCACTTTGAAAG AB201535 2. pm04 92 56 (TG)10 F: CTCTAAGTAGGACAAGGCCT R: CATAATCCAAGGAGTCAAGG AB201536 3. pm05 112-118 52 (TG)9 F: GAGTCTAATTGCAAACCCCA R: TGGAGATCTACCACTTTTTC AB201537 4. pm07 284-309 52 (AC)8 (AT)4 F: GAATCTAAGCATATGAAATGAG R: CTTGTTAATGCTACTAGTTATG AB201538 5. pm08 132 59 (AT)2 (GT)11 F: GCTTCAATCTATTGACCCCAT R: TAAAGGGGCAGCTGCTACAACCAATGG AB201539 6. pm09a 81-99 52 (AT)5 (GT)18(AT)2 F: CCTTCTCATTTCGATATGCAC R: ATTAAAGGTTATATGGGGCT AB201540 7. pm12 181-193 59 (GT)5 CT(GT)5(AT)5 F: GAACAATCATTGCGGGTCCCG R: TATGCTGCGTTTATATGTATAAGTGTC AB201541 4. PCR (Polymerase Chain Reaction) Proses PCR membutuhkan 4 komponen utama yaitu H2O, HotStar Mix, primer dan DNA. DNA hasil proses ektraksi sebelum dilakukan proses amplifikasi PCR harus dilakukan pengenceran dengan menggunakan aquabidest. Besarnya perbandingan antara DNA dengan aquabidest tergantung dari tebal dan tipisnya DNA hasil ekstraksi. Untuk proses PCR, DNA 1.5 µl dicampurkan dengan HotStar Mix 7.5 µl, Nuclease-free water 2.5 µl dan primer 1.5 µl) disentrifugasi selama 5-10 detik 30 kemudian dimasukkan kedalam mesin PCR. Tahapan serta suhu PCR seperti disajikan dalam Tabel 5. Tabel 5 Tahapan dalam proses PCR Metode Mikrosatelit Tahapan Suhu (0C) Waktu (menit) 95 95 53 72 72 2 1 2 2 5 Pre- Denaturation Denaturation Annealing Extention Final Extention Jumlah siklus 1 35 1 Pengujian polimorfisme dilakukan dengan melihat pita hasil PCR yang divisualisasi berdasarkan hasil elektroforesis. Hasil pengujian ini dikatakan polimorfisme jika pola pita yang dihasilkan mempunyai sekurang-kurangnya lebih dari satu variasi, sedang hasil pengujian dikatakan monomorfik jika tidak memperlihatkan adanya variasi pada pola pita hasil elektroforesis. 5. Analisis Data Hasil PCR yang telah dielektroforesis difoto dan dianalisis dengan melakukan skoring pita yang muncul. Pada metode RAPD pola pita yang muncul diterjemahkan kedalam data biner berdasarkan ada atau tidak adanya pita, sedangkan untuk data mikrosatelit dihitung berdasarkan banyaknya alel yang ditemukan sesuai panjang basa. Hasil perhitungan pita-pita DNA tersebut kemudian dianalisis untuk mengetahui keragaman dalam populasi maupun antar populasi. Parameter keragaman genetik yang dihitung dalam penelitian ini adalah (Finkelday 2005) : a. Persentase Lokus Polimorfik (PLP) Suatu lokus gen dikatakan polimorfik jika sekurang-kurangnya ada dua varian yang berbeda (alel). Sedang untuk monomorfik tidak memperlihatkan variasi genetik. Persentase lokus polimorfik dihitung dengan rumus; Persentase Lokus Polimorfik (PLP) =  ( LP) X 100%  ( LP)   ( LM ) dimana Σ (LP) ; jumlah lokus polimorfik Σ(LM) ; jumlah lokus monomorfik b. Jumlah alel yang teramati (na) =  Alel  Lokus 31 c. Jumlah alel yang efektif (ne) = 1  pi 2 i dimana, pi2 ; frekuensi genetik tipe ke i d. Heterozigositas harapan (He) = 1 –  pi 2 i dimana ; pi2 = frekuensi genetik tipe ke i ( HT  HS ) e. Diferensiasi genetik (Gst) = HT dimana; HT = keragaman populasi total, HS = keragaman populasi tunggal Parameter keragaman genetik yang diukur seperti jumlah alel yang diamati (na), jumlah alel yang efektif (ne), jumlah lokus polimorfik, persen lokus polimorfik (PLP) dan heterozigitas harapan (He), diolah dengan software Pop Gene 1.32. Jarak genetika antara populasi dihitung menggunakan koefisien Dice dan pembuatan dendogram menggunakan unweighted pair-group method arithmetic (UPGMA) berdasarkan jarak genetik Nei dengan perangkat lunak numerikcal taxonomy and multivariate system (NTSYS) versi 1.80. Sub-topik Penelitian 3: Analisis Kandungan Biomassa Karbon Tegakan Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli –Sumatera Utara Bahan dan Alat Bahan utama yang diperlukan untuk penelitian ini adalah tegakan populasi alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam – Tapanuli Utara – Sumatera Utara. Bahan lain yang dibutuhkan untuk penelitian ini adalah tally sheet, tali plastik, dan bahan-bahan yang dibutuhkan untuk kegiatan survey vegetasi di lapangan. Adapun alat-alat yang diperlukan untuk penelitian pada ini meliputi peralatan survey (GPS, kompas, meteran, haga hypsometer, phy band, kamera digital), bor kayu, peralatan untuk pencatatan data (pensil, pulpen, alas tulis, penghapus), dan peralatan untuk analisis data (komputer, kalkulator, beberapa software). 32 Metode Penyusunan model persamaan alometrik untuk pendugaan kandungan biomassa karbon pada populasi alam P. merkusii strain Tapanuli ini menggunakan metode destructive sampling (pembongkaran dan pengukuran biomassa sampel), yang urutan tahapannya sebagai berikut: 1. Pemilihan lokasi penelitian Lokasi penelitian untuk pendugaan kandungan biomassa karbon P. merkusii strain Tapanuli dipusatkan di dalam kawasan hutan lindung Dolok Tusam – Tapanuli Utara. Kegiatan pembuatan plot inventory untuk pendataan struktur tegakan P. merkusii strain Tapanuli yang akan diduga kandungan biomassa karbonnya dilakukan di dalam dan di luar kawasan hutan lindung Dolok Tusam – Tapanuli Utara. Adapun untuk kegiatan destructive sampling dilakukan di luar kawasan hutan lindung Dolok Tusam – Tapanuli Utara. 2. Penilaian struktur tegakan populasi alam P. merkusii strain Tapanuli Penilaian struktur tegakan ini bertujuan untuk mengetahui struktur kelas diameter pohon P. merkusii strain Tapanuli yang tersebar di dalam populasi alaminya tersebut. Data tentang struktur kelas diameter ini penting untuk menentukan jumlah dan lokasi pohon yang akan dijadikan sebagai sampel yang akan dibongkar dan diukur dalam metode destructive sampling. 3. Pelaksanaan destructive sampling Destructive sampling merupakan metode pengukuran kandungan biomassa pohon dengan cara memanen dan mengukur kandungan biomassa pada semua bagian pohonnya, meliputi bagian atas tanah dan bagian bawah tanah. Penyusunan persamaan allometrik dilakukan dengan metode destructive sampling pada 36 pohon sampel (rentang diameter 13-82 cm) dan metode volumetrik pada 8 pohon sampel (diameter 75.0 cm, 79.5 cm, 86.0 cm, 95.0 cm, 104.0 cm, 110.9 cm, 115.5 cm, 120.6 cm). Sebaran kelas diameter pohon sampel ini ditentukan dengan mengacu pada sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam – Tapanuli. Metode destructive sampling mengacu pada metode yang dikembangkan oleh Japan International Forestry Promotion & Cooperation Center (JIFPRO 2000), Siregar 33 (2007) dan Siregar (2011) yang secara umum tahapan kegiatannya sebagai berikut: a. Penentuan pohon P. merkusii strain Tapanuli yang dipilih sebagai sampel, b. Sebelum ditebang, terlebih dahulu diukur diameter batang dan tinggi total batangnya, c. Penebangan sampel pohon P. merkusii strain Tapanuli terpilih, d. Pemisahan dan penimbangan berat segar dari setiap bagian pohon (batang, cabang, ranting, daun, buah, dan akar. e. Pembagian bagian batang sampel pohon P. merkusii strain Tapanuli yang telah ditebang menjadi beberapa sortimen, f. Pengukuran berat segar dari setiap sortimen batang yang ditebang tersebut, g. Pengambilan sampel kayu dari setiap bagian pohon P. merkusii strain Tapanuli yang telah ditebang tersebut sebanyak 250 gram, h. Mengeringkan sampel daun, ranting, dan buah dengan menggunakan oven pada suhu 85oC selama 2 hari. i. Mengeringkan sampel batang dan cabang dengan menggunakan oven pada suhu 85oC selama 4 hari. j. Penghitungan berat kering total (JIFPRO 2000): BKT = (BKS x BST)/ BSS, dengan keterangan: BKT: Berat Kering Total (Kg), BKS: Berart Kering Sampel (gram), BST: Berat Segar Total (Kg), BSS: Berat Segar Sampel (gram), k. Menyusun persamaan allometrik P. merkusii strain Tapanuli dengan menggunakan bantuan software Microsoft Office Excel (2007), dan software statistik (JMP) serta formula persamaan allometrik lokal sebagai berikut: Y = a(DBH)b; Y= a(DBH x Tinggi Total)b; Y= a(DBHxKerapatan jenis kayu)b; Y=a(DBHxTinggi TotalxKerapatan jenis kayu)b, Keterangan: Y= biomassa (Kg), DBH= Diameter setinggi dada (cm), a dan b = nilai koefisien persamaan; l. Uji perbandingan persamaan allometrik hasil penelitian ini dengan persamaan allometrik lain yang sudah ada, m. Pemilihan model terbaik persamaan allometrik berdasarkan nilai parameter statistik berikut: Koefisien Determinasi (R2), Koefisien Determinasi yang 34 disesuaikan (R2 adjusted), nilai Root Mean Square Error (RMSE) dan pengujian keberartian model regresi. Model yang dipih adalah model dengan nilai RMSE terkecil, R2 dan R2 Adjusted yang terbesar dan pengujian keberartian persamaan regresi. Persamaan allometrik yang terpilih selanjutnya dibandingkan dengan persamaan allometrik yang sudah ada. 35 HASIL DAN PEMBAHASAN Sub-topik Penelitian 1 Analisis Perubahan Tutupan Lahan, Sifat Kimia Tanah, dan Struktur Tegakan Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara Hasil Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli Tutupan lahan (land cover) secara garis besar diartikan sebagai tutupan kondisi biofisik dari permukaan bumi (FAO 2005). Berdasarkan hasil analisis citra landsat 7 ETM+ tahun 1994, 2005, dan 2011, diketahui ada lima bentuk tutupan lahan di sekitar lokasi penelitian yakni 1). Hutan, 2). Ilalang-semak, 3). Kebun, 4). Ladang, dan 5). Padi-ladang. Sebaran dari kelima bentuk tutupan lahan yang ada di setiap lokasi penelitian pada tiga waktu yang berbeda yakni 1994, 2005, dan 2011 disajikan pada Gambar 4. Kelima bentuk tutupan lahan inilah yang selanjutnya dianalisis komposisinya, kecenderungan perubahannya, dan hubungannya dengan sifat kimia tanah dan kondisi struktur tegakannya. Adapun peta perubahan tutupan lahan di lima lokasi penelitian yang dihasilkan dari analisis citra landsat 7 ETM+ tahun 1994, 2005, dan 2011 disajikan pada Gambar 5. Persentase luas antar kelas tutupan lahan di lima lokasi penelitian pada tiga tahun yang berbeda disajikan pada Gambar 6, sedangkan data luas setiap tipe tutupan lahannya disajikan pada Lampiran 1. Dari lima lokasi penelitian, hanya Lobugala yang memiliki luas hutan yang terkecil yakni kurang dari 300 ha baik pada tahun 1994, tahun 2005 maupun tahun 2011. Di Lobugala, tutupan lahan terbesar berupa padi-ladang dengan luasan sebesar 1169 ha di tahun 1994, 1097 ha di tahun 2005 dan 1.135 ha di tahun 2011. Luasan padi-ladang mencapai sekitar 50% pada tiga tahun yang berbeda yaitu 49.68 % - 51.15% (Gambar 5). Pada empat lokasi selain di Lobugala yaitu Parinsoran, Dolok Tusam Timur, Dolok Tusam Barat dan Tolang, hutan menempati area terluas diantara kelas tutupan lahan lainnya. Luasan hutan dari tahun ke tahun relatif stabil di keempat lokasi tersebut. Dalam periode waktu antara tahun 1994, 2005 dan 2011, luas 36 hutan pada empat lokasi penelitian semuanya berkurang namun tidak terlalu nyata. Seperti di Parinsoran, luas hutan pada tahun 1994 sebesar 2020 ha kemudian berkurang menjadi 2011 ha pada tahun 2005 dan di tahun 2011 berkurang lagi menjadi 2004 ha. 2.500,00 1994 2005 2011 Luas (ha) 2.000,00 1.500,00 1.000,00 500,00 0,00 A Tutupan Lahan Gambar 4 Perubahan Tutupan Lahan di lima lokasi penelitian (Keterangan : A = Dolok Tusam Timur, B = Parinsoran, C = Lobugala, D = Dolok Tusam Barat, E = Tolang) pada tahun 1994,2005, 2011. 37 1994 2005 2011 DTT PAR DTB LOB TOL = Hutan Gambar 5 = Ilalang-semak = Kebun = Ladang = Padi-ladang Sebaran spasial tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994. 2005, dan 2011. (Keterangan: DTT=Dolok Tusam Timur, PAR=Parinsoran, DTB=Dolok Tusam Barat, LOB=Lobugala, TOL=Tolang). 38 1994 2005 4,24% 3,72% 2,38% 1,63% 2,38% 3,76% 1,23% 4,21% 2011 3,52% 2,27% 4,55% 1,94% DTT 88,02% 88,42% 87,71% PAR 31,23% 33,29% 40,52% 40,52% 11,73% 10,19% 11,11% 0,59% 1,59% 7,18% 6,48% 6,24% 8,23% DTB 39,83% 8,99% 13,86% 16,47% 32,89% 4,95% 9,13% 10,55% 5,08% 5,15% 7,89% 5,39% 8,72% 5,55% 72,27% 12,67% LOB 72,11% 72,27% 12,85% 12,85% 6,51% 5,56% 8,79% 11,03% 51,15% 48,02% 49,68% 18,63% 5,66% 4,51% 8,82% 9,39% 9,06% 14,67% 12,78% 13,84% 0,68% 0,99% 1,94% 71,60% 71,80% = Hutan Gambar 6 20,07% 18,58% 4,03% TOL 11,84% 11,74% = Ilalang-semak = Kebun = Ladang 70,22% = Padi-ladang Komposisi tutupan lahan pada lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994. 2005, dan 2011. (Keterangan: DTT=Dolok Tusam Timur, PAR=Parinsoran, DTB=Dolok Tusam Barat, LOB=Lobugala, TOL=Tolang). 39 Berdasarkan Gambar 6, komposisi penutupan lahan di lima lokasi penelitian nampak beragam. Ada tiga lokasi penelitian yang lebih dari 50% tutupan lahannya berupa hutan, yakni Dolok Tusam Timur, Dolok Tusam Barat, dan Tolang. Adapun 2 lokasi yang lain yaitu Parinsoran dan Lobugala, tutupan lahannya didominasi non-hutan meliputi kebun, padi-ladang, dan ladang. Lahan yang ditutupi oleh ilalang-semak juga ditemukan di semua lokasi penelitian dengan persentase komposisi yang berbeda. Secara berturutan persentase tutupan lahan ilalang-semak di tahun 2011 yaitu Dolok Tusam Barat (8.72%), Parinsoran (7.18%), Lobugala (5.56%), Tolang (1.94%), dan Dolok Tusam Timur (1.94%). Penurunan persentase tutupan hutan paling tinggi terjadi di perbukitan hutan campuran di Desa Tolang – Kec. Aek Bilah – Kabupaten Tapanuli Selatan, yakni sebesar 1.58% kemudian disusul Dolok Tusam Timur (turun 0.71%), Parinsoran (turun 0.69%), dan Dolok Tusam Barat (turun 0.16%). Adapun tutupan hutan di lokasi Lobugala meningkat sebesar 0.18% atau 4.14 ha. Hampir di semua lokasi penelitian ditemukan adanya peningkatan luas tutupan lahan berupa ilalang-semak selama kurun waktu 1994 hingga 2011. Hanya di lokasi Lobugala yang ditemukan adanya penurunan luas tutupan ilalangsemak yakni sebesar 0.95%. Adapun peningkatan luas tutupan ilalang-semak di empat lokasi yang lain sebagai berikut: Parinsoran (5.59%), Dolok Tusam Barat (3.33%), Tolang (1.26%), dan Dolok Tusam Timur (0.71%). Berdasarkan komposisi tutupan lahan seperti pada Gambar 6, dari tahun 1994 hingga 2011 secara keseluruhan ditemukan bahwa hampir di semua lokasi penelitian terjadi penurunan persentase luas tutupan lahan hutan yang tidak terlalu besar yaitu berkisar dari 0.16% - 1.58%. Perubahan tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli Perubahan tutupan lahan pada lokasi penelitian terjadi secara fluktuatif selama kurun waktu 1994, 2005, dan 2011. Secara lebih rinci perubahan tutupan lahan di lokasi penelitian sebagai berikut: a. Dolok Tusam Timur Di Dolok Tusam Timur, selama rentang waktu 1994-2011 telah terjadi penurunan luas tutupan hutan dengan laju 0.96 ha/tahun, tutupan lahan ladang 40 menurun dengan laju 0.32 ha/tahun, dan tutupan lahan berupa kebun menurun dengan laju 0.14 ha/tahun. Sebaliknya tutupan lahan ilalang-semak bertambah luas dengan laju 0.96 ha/tahun dan tutupan lahan padi-ladang juga meningkat dengan laju 0.46 ha/tahun. Berdasarkan laju perubahan tutupan lahan ini, ternyata laju peningkatan luas tutupan padi-ladang sebesar 0.46 ha/tahun sama dengan laju penurunan tutupan ladang sebesar 0.32 ha/tahun ditambah dengan laju penurunan luas tutupan untuk kebun sebesar 0.14 ha/tahun. Hal ini menunjukkan adanya pergeseran pola penggunaan lahan dari ladang dan kebun ke padi-ladang di areal sebaran P. merkusii strain Tapanuli di Dolok Tusam Timur selama kurun waktu 1994 hingga 2011. Selain itu, laju penurunan luas tutupan hutan ternyata sama dengan laju peningkatan luas tutupan lahan ilalang-semak yakni 0.96 ha/tahun. Hal ini menunjukkan bahwa perubahan lahan menjadi ilalang-semak merupakan salah satu bentuk gangguan terhadap kawasan hutan lindung Dolok Tusam Timur. Secara tidak langsung kondisi ini juga menunjukkan bahwa kegiatan pengelolaan lahan untuk kebun, ladang, dan padi-ladang selama 17 tahun di Dolok Tusam Timur tidak merubah tutupan hutan. b. Parinsoran Di Parinsoran, secara umum dapat diketahui bahwa pada tahun 2011 tutupan hutan dan ladang mengalami penurunan luas masing-masing sebesar 1.72% dan 45.39% dibanding pada tahun 1994. Adapun tutupan kebun dan padi-ladang serta tutupan ilalang-semak pada tahun 2011 mengalami penambahan luas masing-masing sebesar 8.99%, 5.31% dan 352.76%. Selama periode 1994-2011, tutupan hutan berkurang dengan laju 0.4 ha/tahun dan tutupan ladang mengalami penurunan dengan laju 10.04 ha/tahun. Adapun tutupan padi-ladang mengalami peningkatan luas dengan rata-rata laju 2.23 ha/tahun dan tutupan lahan kebun juga mengalami peningkatan luas dengan laju 1.23 ha/tahun. Selain itu, pada periode 1994-2011 ditemukan juga tutupan ilalang–semak dengan laju 7.52 ha/tahun. Hasil analisis perubahan pola tutupan lahan yang terjadi di lokasi Parinsoran antara tahun 1994, 2005, dan 2011, secara umum dapat diketahui bahwa lahan yang berubah menjadi ilalang-semak ditemukan pada areal perladangan dan hutan di tahun 2011. Laju pertambahan lahan yang menjadi ilalang-semak sebesar 7.52 41 ha/tahun diperkirakan berasal dari alih fungsi hutan ke non hutan dengan laju 0.94 ha/tahun dan adanya areal perladangan yang tidak dikelola lagi dengan laju 6.58 ha/tahun. Penambahan luas areal padi-ladang dengan laju 2.23 ha/tahun dan kebun dengan laju 1.23 ha/tahun diperkirakan juga berasal dari alih fungsi ladang. Hal ini terjadi kemungkinan terkait dengan peningkatan kebutuhan masyarakat terhadap pangan dan hasil kebun. c. Dolok Tusam Barat Di Dolok Tusam Barat, secara garis besar dapat diketahui bahwa tutupan hutan, kebun, dan padi-ladang di seputar kawasan hutan lindung Dolok Tusam Barat mengalami penurunan luas. Adapun tutupan lahan berupa ladang dan ilalang-semak mengalami peningkatan luas. Selama 17 tahun (1994-2011) tutupan hutan menurun dengan laju 0.21 ha/tahun, tutupan kebun juga menurun dengan laju 3.76 ha/tahun. Selain itu, tutupan padi-ladang juga mengalami penurunan luas dengan laju 1.72 ha/tahun. Sebaliknya, tutupan ilalang-semak mengalami peningkatan luas dengan laju 4.48 ha/tahun dan tutupan ladang juga mengalami peningkatan luas dengan laju 1.2 ha/tahun. Berdasarkan laju perubahan tutupan lahan ini, maka secara garis besar dapat diketahui pergeseran tutupan hutan yang terjadi di Dolok Tusam Barat antara 1994 hingga 2011 terdiri atas 3 pola yakni: kebun menjadi ladang, padi-ladang menjadi ladang, dan padi-ladang menjadi ilalang-semak. Pola pergeseran tutupan lahan ini secara umum terjadi pada areal budidaya pertanian yang berada di luar kawasan hutan lindung Dolok Tusam Barat. d. Lobugala Berdasarkan hasil analisis citra landsat 7 ETM+ seperti disajikan pada Gambar 5, dapat diketahui bahwa tutupan padi-ladang (warna biru muda) lebih mendominasi dibanding tutupan untuk kebun (hijau muda) dan ladang (coklat muda). Berdasarkan data perubahan luas tutupan lahan seperti tercantum pada Lampiran 1, secara umum dapat diketahui bahwa selama periode 1994 hingga 2011 terjadi perubahan pola tutupan lahan dari padi-ladang ke ladang dan kebun. Hal ini nampak dari adanya pola kecenderungan meningkatnya tutupan ladang dan kebun, sementara di sisi lain tutupan padi-ladang cenderung menurun. Demikian juga tutupan ilalang-semak pun ikut menurun. Selama periode 1994- 42 2011, tutupan ladang dan kebun masing-masing meningkat dengan laju 1.94 ha/tahun dan 1.08 ha/tahun. Adapun tutupan padi-ladang dan tutupan ilalangsemak masing-masing turun dengan laju 1.98 ha/tahun dan 1.28 ha/tahun. Mencermati pola tutupan lahan yang tercermin dari perubahan warna pada Gambar 5, secara umum dapat diketahui ada beberapa pola perubahan tutupan lahan yakni a). dari tutupan ilalang-semak menjadi padi-ladang, b). dari kebun menjadi ilalang-semak terus menjadi ladang, c). dari lahan ladang menjadi kebun, d). dari lahan padi-ladang menjadi ladang, dan e). dari padi-ladang menjadi ilalang-semak. Beragamnya pola perubahan tutupan lahan dan banyaknya jumlah patch dalam peta tutupan lahan secara tidak langsung menunjukkan bahwa lokasi Lobugala merupakan areal sebaran P. merkusii strain Tapanuli yang terdiri atas beberapa sub ekosistem. e. Tolang Berdasarkan perubahan warna pada Gambar 6, secara garis besar dapat diketahui beberapa pola perubahan tutupan lahan yang terjadi di lokasi Tolang – Kec. Aek Bilah – Tapanuli Selatan, sebagai berikut: a). Dari hutan menjadi lahan ilalang-semak, b). Dari hutan menjadi padi-ladang, c). Dari hutan menjadi ladang, d). Dari ladang menjadi ilalang-semak, dan d). Dari kebun menjadi padi-ladang. Selanjutnya berdasarkan data perubahan tutupan lahan yang terjadi di lokasi Tolang antara tahun 1994 hingga 2011 dapat diketahui bahwa ada 2 bentuk tutupan lahan yang mendapat tekanan, yaitu tutupan kebun dan hutan. Kuatnya tekanan inilah yang menjadikan tutupan kebun dan tutupan hutan mengalami penurunan luas pada periode 1994 - 2011 masing-masing dengan laju 2.53 ha/tahun dan 2.12 ha/tahun. Berdasarkan data luas tutupan lahan di desa Tolang seperti tercantum pada Lampiran 1, dapat diketahui bahwa jumlah patch untuk setiap bentuk tutupan lahan sebagian besar mengalami peningkatan antara tahun 1994, 2005, dan 2011. Banyaknya jumlah patch tersebut secara tidak langsung menggambarkan tingkat fragmentasi lahan yang terjadi pada sebaran alam P. merkusii strain Tapanuli di areal perbukitan Tolang. Mengacu pada data di Gambar 5 dan Lampiran 1 dapat diketahui juga adanya 3 bentuk tutupan lahan yang mengalami peningkatan luas selama periode 43 1994 – 2011, yaitu: a). Tutupan padi-ladang mengalami peningkatan luas sebesar 37,25 ha (40.44%), dengan laju peningkatan luas sebesar 2.19 ha/tahun, b). Tutupan ladang mengalami peningkatan luas sebesar 13.17 ha atau 6.54% , dengan laju peningkatan luas 0.77 ha/tahun, c). Tutupan ilalang-semak mengalami peningkatan luas sebanyak 28.69 ha dengan laju peningkatan sebesar 1.69 ha/tahun. Karakteristik kimiawi tapak tumbuh P. merkusii strain Tapanuli Tapak tumbuh merupakan salah satu faktor yang ikut mempengaruhi keberhasilan pertumbuhan suatu jenis pohon pada suatu tempat. Analisis terhadap sifat kimia tanah merupakan salah satu cara untuk menilai kualitas tapak tumbuh. Beberapa sifat kimia tanah yang dianalisis untuk penilaian kualitas kelima tapak tumbuh populasi alam P. merkusii strain Tapanuli sebagai berikut: pH tanah, persentase C organik, persentase N, C-N rasio, P potensial, K potensial, P tersedia, K tersedia, Kation-kation yang dapat dipertukarkan, Kapasitas Tukar Kation, dan Kejenuhan Basa. a. pH tanah Nilai pH tanah adalah sifat kimia tanah yang menunjukkan besarnya kandungan ion H+ di dalam tanah dan berguna sebagai indikator tingkat kemasaman atau alkalinitas tanah. Semakin tinggi kandungan ion H+ di dalam tanah maka semakin kecil nilai pH nya dan semakin masam tanah tersebut. Nilai pH tanah ditentukan berdasarkan kandungan ion H+ dan OH- yang memiliki hubungan berbanding terbalik (Pritchett 1979; Tan 1994). Hasil analisis pH tanah pada kelima tapak tumbuh P. merkusii strain Tapanuli yang diteliti ditampilkan pada Tabel 6. Berdasarkan data pada Tabel 6, dapat diketahui bahwa semua tapak tumbuh populasi alam P. merkusii strain Tapanuli berada pada kategori masam hingga sangat masam. 44 Tabel 6 No 1 2 3 4 5 Nilai pH tanah pada kelima tapak tumbuh P. merkusii strain Tapanuli di Tapanuli - Sumatera Utara. Kedalaman tanah (cm) 0 - 05 Dolok Tusam Timur 05-10 10-20 20-30 Rata-rata 0 - 05 Parinsoran 05-10 10-20 20-30 Rata-rata 0 - 05 Dolok Tusam Barat 05-10 10-20 20-30 Rata-rata 0 - 05 Lobugala 05-10 10-20 20-30 Rata-rata 0 - 05 Tolang 05-10 10-20 20-30 Rata-rata Lokasi pH H2 O 3.9 4.3 4.5 4.5 4.3 Kriteria sangat masam sangat masam masam masam sangat masam 4.8 4.7 4.7 4.4 masam masam masam sangat masam 4.7 masam 4.3 4.6 4.7 5.0 sangat masam masam masam masam 4.7 masam 5.0 5.0 4.8 4.8 masam masam masam masam 4.9 masam 4.4 4.4 4.5 4.6 sangat masam sangat masam masam masam 4.5 masam b. Persentase C organik, Persentase N, dan C-N rasio Persentase C organik adalah sifat kimia tanah yang menunjukkan besarnya bahan organik yang terkandung di dalam tanah. Kandungan bahan organik penting untuk diketahui karena menjadi salah satu faktor yang menentukan kesuburan tanah. Melalui proses dekomposisi bahan organik, berbagai unsur hara 45 yang diperlukan untuk pertumbuhan tanaman dapat tersedia di dalam tanah (Foth 1999). Hasil analisis % C organik, % N, dan C/N pada lima tapak P. merkusii strain Tapanuli yang tumbuh di kawasan Tapanuli – Sumatera Utara disajikan pada Tabel 7. Berdasarkan data pada Tabel 6 dapat diketahui bahwa sebagian besar lokasi penelitian memiliki persentase C organik tinggi. Hanya ada satu lokasi yang persentase C organiknya rendah yakni Parinsoran. Tabel 7 Persentase C organik, % N, dan C/N pada lima tapak tumbuh P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara Kedalaman tanah No Lokasi %C Kriteria %N Kriteria C/N Kriteria 0 - 05 5.6 sangat tinggi 0.4 sedang 14.0 sedang 05-10 3.3 tinggi 0.2 rendah 15.0 sedang 10-20 2.0 sedang 0.2 rendah 13.0 sedang (cm) 1 2 3 4 5 Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 20-30 0.6 sangat rendah 0.1 rendah 12.0 Rata-rata 2.9 sedang 0.2 rendah 13.5 sedang 0 - 05 2.1 sedang 0.2 rendah 10.1 rendah 05-10 1.7 rendah 0.1 rendah 13.2 sedang 10-20 2.2 sedang 0.2 rendah 10.3 rendah sedang 20-30 1.0 rendah 0.1 rendah 10.4 Rata-rata 1.8 rendah 0.2 rendah 11.0 rendah 0 - 05 5.8 sangat tinggi 0.3 sedang 19.3 tinggi 05-10 3.5 tinggi 0.3 sedang 13.9 sedang 10-20 2.8 sedang 0.2 rendah 12.0 sedang sedang 20-30 2.0 rendah 0.2 rendah 9.6 rendah Rata-rata 3.5 tinggi 0.2 rendah 13.7 sedang 0 - 05 7.4 sangat tinggi 0.4 sedang 16.7 tinggi 05-10 6.3 sangat tinggi 0.5 sedang 11.9 sedang 10-20 3.7 tinggi 0.3 sedang 10.9 rendah 20-30 1.9 rendah 0.2 rendah 11.3 Rata-rata 4.8 tinggi 0.4 sedang 12.7 sedang 0 - 05 4.8 tinggi 0.3 sedang 14.7 sedang 05-10 4.4 tinggi 0.3 sedang 14.1 sedang 10-20 2.8 sedang 0.2 rendah 14.9 sedang 20-30 1.4 rendah 0.1 rendah 10.8 rendah Rata-rata 3.4 tinggi 0.2 rendah 13.6 sedang sedang Persentase N merupakan sifat kimia tanah yang menunjukkan ketersediaan unsur N di dalam tanah. Adapun C-N rasio menggambarkan kesetimbangan hubungan antara unsur C dan N di dalam tanah. Proses dekomposisi bahan 46 organik di dalam tanah dapat dilihat dari nilai C-N rasionya. Semakin tinggi nilai C-N rasio tanah maka bahan organik yang ada di dalam tanah tersebut semakin lama terdekomposisi. Sebaliknya semakin rendah nilai C-N rasio tanah maka proses dekomposisi bahan organik tersebut semakin cepat (Foth 1999). Mengacu data pada Tabel 6, dapat diketahui bahwa rata-rata persentase N untuk semua lokasi penelitian termasuk kategori sedang. Adapun untuk nisbah C/N, hasil analisis menunjukkan bahwa rata-rata nisbah C/N di semua lokasi masuk dalam kriteria sedang. Selanjutnya berdasarkan nilai kandungan % C organik tersebut, maka dapat diketahui stok karbon tanah di lima lokasi penelitian seperti disajikan pada Tabel 8. Rata-rata stok karbon dari kelima lokasi penelitian berkisar antara 46.1 ton C/ha (Parinsoran) sampai dengan 89.0 ton C/ha (Lobugala). Tabel 8 Stok karbon tanah pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli yang tersebar di Kabupaten Tapanuli Utara dan Kabupaten Tapanuli Selatan – Sumatera Utara No Lokasi Kedalaman (cm) pH %C %N C/N KTK Bulk Density (gram/cm3) Stok Karbon (Ton C /ha) 1. Dolok Tusam Timur 0-5 3.90 5.61 0.41 14.00 11.00 0.570 16.0 5-10 10-20 20-30 4.30 4.50 4.50 3.34 1.95 0.58 0.23 0.15 0.05 15.00 13.00 12.00 2.66 2.14 2.23 0.794 0.966 1.259 rata-rata 4.30 2.87 0.21 13.50 4.50 0.897 0-5 5-10 10-20 20-30 4.80 4.70 4.70 4.40 2.12 1.72 2.16 1.04 0.21 0.13 0.21 0.10 10.00 13.00 10.00 10.00 6.84 2.64 2.24 2.78 0.737 0.815 0.964 1.005 rata-rata 4.70 1.76 0.16 11.00 3.60 0.880 13.3 18.8 7.30 55,40 (kumulatif) 7.8 7.0 20.8 10.4 46,10 (kumulatif) 0-5 4.30 5.79 0.30 19.00 2.35 0.516 14.9 5-10 10-20 20-30 4.60 4.70 5.00 3.48 2.76 2.02 0.25 0.23 0.21 14.00 12.00 10.00 2.16 1.55 1.05 0.733 0.793 0.804 rata-rata 4.70 3.51 0.25 13.71 1.80 0.712 0-5 5-10 10-20 20-30 5.00 5.00 4.80 4.80 7.36 6.29 3.72 1.92 0.44 0.53 0.34 0.17 17.00 12.00 11.00 11.00 7.28 5.25 2.84 2.31 0.608 0.655 0.779 0.888 rata-rata 4.90 4.82 0.37 12.71 4.40 0.732 0-5 5-10 10-20 20-30 4.40 4.40 4.50 4.60 4.84 4.38 2.84 1.41 0.33 0.31 0.19 0.13 15.00 14.00 15.00 11.00 4.88 4.14 2.27 2.65 0.741 0.797 0.787 0.947 rata-rata 4.50 3.37 0.24 13.65 3.50 0.818 12.8 21.9 16.3 65,80 (kumulatif) 22.4 20.6 29.0 17.0 89,00 (kumulatif) 17.9 17.5 22.3 13.4 71,10 (kumulatif) 2. Parinsoran 3. Dolok Tusam Barat 4. 5. Lobugala Tolang 47 c. P-potensial P-potensial adalah jumlah total unsur hara P di dalam tanah yang tidak semua kandungannya dapat diserap oleh akar tanaman. Dalam proses biogeokimia tanah, kandungan P-potensial dalam tanah merupakan substrat yang akan digunakan dalam proses mineralisasi sehingga unsur hara P dapat tersedia bagi akar tanaman. Semakin besar kandungan P-potensial dalam tanah maka semakin besar peluang kandungan P-tersedia dalam tanah tersebut (Foth 1999). Tabel 9 menyajikan kandungan P-potensial di lima lokasi penelitian. Tabel 9 Kandungan P-potensial pada tapak tumbuh di lima lokasi sebaran alam P. merkusii strain Tapanuli – Sumatera Utara No 1 2 3 4 5 Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Kedalaman tanah (cm) 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata P2O5 (mg/100g) Kriteria 18.0 13.0 13.0 9.0 rendah rendah rendah sangat rendah 13.3 6.0 4.0 2.0 1.0 rendah sangat rendah sangat rendah sangat rendah sangat rendah 3.3 11.0 9.0 8.0 9.0 sangat rendah rendah sangat rendah sangat rendah sangat rendah 9.3 10.0 8.0 5.0 3.0 sangat rendah rendah sangat rendah sangat rendah sangat rendah 6.5 14.0 13.0 11.0 10.0 sangat rendah rendah rendah rendah rendah 12.0 rendah 48 Hasil analisis sifat kimia tanah menunjukkan bahwa kandungan P-potensial di kelima lokasi yang diteliti termasuk ke dalam kategori rendah dan sangat rendah. Kandungan P-potensial tertinggi ditemukan pada lokasi Dolok Tusam Timur. Secara lebih rinci, kandungan P-potensial di lima lokasi yang diteliti disajikan pada Tabel 9. Kandungan P-potensial di semua lokasi penelitian cenderung mengalami penurunan seiring dengan peningkatan kedalaman tanah. Semakin dalam tanah, kandungan P-potensial akan semakin sedikit. d. K-potensial Kalium (K) termasuk salah satu unsur hara makro yang penting bagi pertumbuhan tanaman, antara lain sebagai pengaktif dari sejumlah besar enzim yang penting untuk proses fotosintesis dan respirasi (Salisbury & Ross 1995). Kalium ditemukan dalam jumlah banyak di dalam tanah, tetapi hanya sebagian kecil yang dapat digunakan oleh tanaman, yaitu yang larut di dalam air atau yang dapat dipertukarkan (dalam koloid tanah). Kalium dalam bentuk yang tidak tersedia bagi tanaman (K-potensial) terdapat dalam mineral-mineral primer tanah seperti Feldspars dan Micas (Foth 1999). Dalam proses biogeokimia, kandungan K-potensial mencerminkan jumlah total unsur hara K dalam tanah yang dapat dimineralisasi menjadi unsur hara K tersedia sehingga akar tanaman dapat menyerapnya. Semakin besar kandungan K-potensial dalam tanah maka peluang kandungan unsur hara K tersedia juga semakin besar. Berdasarkan hasil analisis sifat kimia tanah seperti disajikan pada Tabel 10, dapat diketahui bahwa ada 2 lokasi sebaran alam P. merkusii strain Tapanuli yang memiliki kandungan K-potensial tinggi yakni Dolok Tusam Timur dan Parinsoran. Adapun kandungan K-potensial di Dolok Tusam Barat dan Lobugala masing-masing termasuk ke dalam kategori sedang. Kandungan K-potensial terendah ditemukan di lokasi Tolang. 49 Tabel 10 Kandungan K-potensial pada tapak tumbuh di lima lokasi sebaran alam P. merkusii strain Tapanuli – Sumatera Utara No 1 2 3 4 5 Kedalaman tanah (cm) 0 - 05 Dolok Tusam Timur 05-10 10-20 20-30 Rata-rata 0 - 05 Parinsoran 05-10 10-20 20-30 Rata-rata 0 - 05 Dolok Tusam Barat 05-10 10-20 20-30 Rata-rata 0 - 05 Lobugala 05-10 10-20 20-30 Rata-rata 0 - 05 Tolang 05-10 10-20 20-30 Rata-rata Lokasi K2O (mg/100 g) Kriteria 57.0 47.0 50.0 76.0 tinggi tinggi tinggi sangat tinggi 57.5 tinggi 50.0 40.0 37.0 44.0 tinggi sedang sedang tinggi 42.8 tinggi 31.0 27.0 28.0 31.0 sedang sedang sedang sedang 29.3 sedang 35.0 26.0 25.0 28.0 sedang sedang sedang sedang 28.5 sedang 14.0 12.0 10.0 6.0 rendah rendah rendah sangat rendah 10.5 rendah e. P-tersedia Phospor merupakan unsur hara esensial yang sering menjadi unsur pembatas dalam pertumbuhan tanaman karena rendahnya larutan P di dalam tanah yang dapat langsung diserap oleh akar tanaman (Foth 1999). Oleh karena itu, kandungan unsur hara P dalam bentuk yang tersedia bagi tanaman merupakan salah satu faktor yang menentukan tingkat kesuburan tanah pada suatu areal tanam. Kandungan P-tersedia hasil analisis tanah pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli disajikan pada Tabel 11. Kandungan 50 rata-rata P-tersedia di lima lokasi penelitian berkisar antara sedang sampai sangat rendah. Tabel 11 Kandungan P-tersedia pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara No 1 2 3 4 5 Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Kedalaman tanah (cm) Bray 1 P2O5 (ppm) Kriteria 0 - 05 21.1 sangat tinggi 05-10 13.1 tinggi 10-20 5.5 rendah 20-30 2.8 sangat rendah Rata-rata 10.6 sedang 0 - 05 6.4 rendah 05-10 5.9 rendah 10-20 3.2 sangat rendah 20-30 1.8 sangat rendah Rata-rata 4.3 sangat rendah 0 - 05 8.5 sedang 05-10 3.4 sangat rendah 10-20 3.2 sangat rendah 20-30 2.7 sangat rendah Rata-rata 4.5 sangat rendah 0 - 05 4.9 rendah 05-10 4.2 rendah 10-20 3.0 sangat rendah 20-30 2.6 sangat rendah Rata-rata 3.7 sangat rendah 0 - 05 7.2 rendah 05-10 6.7 rendah 10-20 4.6 rendah 20-30 5.2 rendah Rata-rata 5.9 rendah f. K-tersedia Kalium (K) merupakan salah satu unsur hara esensial yang konsentrasinya di dalam jaringan tanaman pada umumnya berkisar antara 1 sampai 5%. Tanaman menyerap kalium dalam bentuk ion K+. Kalium di dalam tanah ditemukan dalam beberapa bentuk, antara lain: feldspar orthoclase dan microcline [KalSi3O8], muscovite [KAl3Si3O10(OH)2], biotite [K(MgFe)3AlSi3O10(OH)2], dan phlogopite 51 [KMg2Al2Si3O10(OH)2], akan tetapi hanya sebagian kecil saja yang tersedia bagi akar tanaman (Tisdale et al. 1985). Sumber K-tersedia bagi tanaman berasal dari K yang dapat dipertukarkan (diikat oleh koloid liat atau humus) dan K dalam larutan (bentuk ion K+) (Foth 1990). Berdasarkan hasil analisis sifat kimia tanah (Tabel 12) dapat diketahui bahwa kandungan K-tersedia untuk semua tapak populasi alam P. merkusii strain Tapanuli tergolong sangat tinggi. Tabel 12 Kandungan K-tersedia pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Morgan Kedalaman tanah No Lokasi K2O (ppm) Kriteria (cm) 1 2 3 4 5 Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 0 - 05 05-10 10-20 20-30 Rata-rata 198.0 78.0 76.0 63.0 sangat tinggi sangat tinggi sangat tinggi sangat tinggi 103.8 196.0 131.0 147.0 89.0 sangat tinggi sangat tinggi sangat tinggi sangat tinggi sangat tinggi 140.8 sangat tinggi 96.0 47.0 46.0 48.0 sangat tinggi tinggi tinggi tinggi 59.3 sangat tinggi 168.0 103.0 72.0 56.0 sangat tinggi sangat tinggi sangat tinggi sangat tinggi 99.8 sangat tinggi 127.0 113.0 78.0 47.0 91.3 sangat tinggi sangat tinggi sangat tinggi tinggi sangat tinggi g. Kation-Kation yang dapat dipertukarkan (exchangable cations) Pertukaran antara kation-kation yang ada di dalam larutan tanah dengan kation lain yang terjerap pada bahan-bahan yang bermuatan negatif seperti koloid liat atau koloid organik merupakan peristiwa penting yang erat kaitannya dengan 52 kesuburan tanah. Kation-kation yang dapat ditukarkan dalam proses pertukaran kation tersebut merupakan sumber unsur hara bagi tanaman. Ada 4 kation yang sering ditemukan di dalam jerapan koloid tanah, yaitu Ca2+, Mg2+, K+, dan Na+ (Foth 1990). Hasil analisis kimia tanah mengenai kandungan kation-kation yang dapat dipertukarkan (exchangable cations) pada kelima lokasi penelitian disajikan pada Tabel 13 dan 14. Kandungan kation-kation yang dapat dipertukarkan (Ca2+,Mg2+ K+, dan Na+ ) berada pada kriteria rendah dan sangat rendah. Tabel 13 Kandungan kation-kation Ca2+, Mg2+ pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara Kedalaman tanah No 1 Lokasi Dolok Tusam Timur (cm) 0 - 05 05-10 2 3 4 5 Parinsoran Dolok Tusam Barat Lobugala Tolang Jenis kation Ca Kriteria Mg (cmolc/kg) 0.48 sangat rendah 0.49 rendah (cmolc/kg) Kriteria 0.33 sangat rendah 0.18 sangat rendah 10-20 0.33 sangat rendah 0.18 sangat rendah 20-30 0.33 0.37 sangat rendah Rata-rata sangat rendah 0.18 0.26 sangat rendah 0 - 05 2.00 sangat rendah 0.56 rendah 05-10 0.44 sangat rendah 0.22 sangat rendah 10-20 0.35 sangat rendah 0.14 sangat rendah 20-30 0.67 sangat rendah 0.08 sangat rendah Rata-rata 0.87 sangat rendah 0.25 sangat rendah 0 - 05 0.4 sangat rendah 0.12 sangat rendah 05-10 0.6 sangat rendah 0.12 sangat rendah 10-20 0.5 sangat rendah 0.06 sangat rendah 20-30 0.3 sangat rendah 0.08 sangat rendah Rata-rata 0.46 sangat rendah 0.10 sangat rendah 0 - 05 0.33 rendah 0.11 rendah 05-10 0.20 rendah 0.23 rendah 10-20 0.14 rendah 0.20 rendah 20-30 0.11 rendah 0.12 sangat rendah Rata-rata 0.20 rendah 0.17 rendah 0 - 05 0.7 sangat rendah 0.45 rendah 05-10 0.9 sangat rendah 0.26 sangat rendah 10-20 0.4 sangat rendah 0.27 sangat rendah 20-30 0.7 sangat rendah 0.2 sangat rendah Rata-rata 0.67 sangat rendah 0.30 sangat rendah sangat rendah 53 Tabel 14 Kandungan kation-kation K+, Na+ pada lima tapak tumbuh populasi alam P. merkusii strain Tapanuli yang tersebar di wilayah Tapanuli – Sumatera Utara Kedalaman tanah No 1 2 3 4 5 K Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Jenis kation Kriteria Na Kriteria (cm) (cmolc/kg) (cmolc/kg) 0 - 05 0.38 rendah 0.24 rendah 05-10 0.15 rendah 0.10 rendah 10-20 0.15 rendah 0.10 rendah 20-30 0.12 rendah 0.10 rendah Rata-rata 0.20 rendah 0.14 rendah 0 - 05 0.38 rendah 0.24 rendah 05-10 0.25 rendah 0.24 rendah 10-20 0.29 rendah 0.14 sangat rendah 20-30 0.17 rendah 0.14 sangat rendah Rata-rata 0.27 0.19 rendah 0 - 05 0.19 rendah 0.13 rendah 05-10 0.09 sangat rendah 0.18 rendah 10-20 0.09 sangat rendah 0.13 rendah 20-30 0.09 sangat rendah 0.11 rendah Rata-rata 0.12 rendah 0.14 rendah 0 - 05 0.3 rendah 0.11 rendah 05-10 0.2 rendah 0.23 rendah 10-20 0.1 rendah 0.2 rendah 20-30 0.1 rendah 0.12 sangat rendah Rata-rata 0.20 rendah 0.17 rendah 0 - 05 0.3 rendah 0.13 rendah 05-10 0.2 rendah 0.05 sangat rendah 10-20 0.2 sangat rendah 0.08 sangat rendah 20-30 0.1 sangat rendah 0.1 sangat rendah Rata-rata 0.18 rendah 0.09 sangat rendah rendah h. Kapasitas Tukar Kation (KTK) Pertukaran antara kation-kation yang ada di dalam larutan tanah dengan kation lain yang terjerap pada bahan-bahan yang bermuatan negatif seperti koloid liat atau koloid organik merupakan peristiwa penting yang erat kaitannya dengan kesuburan tanah. Kation-kation yang dapat ditukarkan dalam proses pertukaran kation tersebut merupakan sumber unsur hara bagi tanaman. Ada 4 kation yang sering ditemukan di dalam jerapan koloid tanah, yaitu Ca2+, Mg2+, K+, dan Na+ 54 (Foth 1990). Hasil analisis kapasitas tukar kation (KTK) tanah pada lokasi penelitian disajikan pada Tabel 15. Rata-rata KTK di semua lokasi termasuk dalam kriteria sangat rendah. Tabel 15 Kandungan KTK pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara No 1 2 3 4 5 Kriteria Kedalaman tanah KTK (cm) (cmolc/kg) 0 - 05 11.03 rendah 05-10 2.66 sangat rendah 10-20 2.14 sangat rendah 20-30 2.23 sangat rendah Rata-rata 4.5 sangat rendah 0 - 05 6.84 rendah 05-10 2.64 sangat rendah 10-20 2.24 sangat rendah 20-30 2.78 sangat rendah Rata-rata 3.6 sangat rendah 0 - 05 2.35 sangat rendah 05-10 2.16 sangat rendah 10-20 1.55 sangat rendah 20-30 1.05 sangat rendah Rata-rata 1.8 sangat rendah 0 - 05 7.28 rendah 05-10 5.25 rendah 10-20 2.84 sangat rendah 20-30 2.31 sangat rendah Rata-rata 4.4 sangat rendah 0 - 05 4.88 sangat rendah 05-10 4.14 sangat rendah 10-20 2.27 sangat rendah 20-30 2.65 sangat rendah Rata-rata 3.5 sangat rendah Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 55 i. Kejenuhan Basa (%) Persentase kejenuhan basa merupakan salah satu sifat kimia tanah yang memiliki kaitan erat dengan tingkat kemasaman tanah, ketersediaan hara, dan kesuburan tanah. Kejenuhan basa menunjukkan persentase dari kapasitas tukar kation total yang ditempati oleh kation-kation basa seperti kalsium, magnesium, kalium, dan natrium (Tisdale et al. 1985). Berdasarkan hasil analisis kimia tanah dapat diketahui bahwa persentase kejenuhan basa (KB) di lima lokasi penelitian berkisar antara rendah dan sedang seperti disajikan pada Tabel 16. Tabel 16 Kandungan Kejenuhan Basa pada tapak tumbuh lima populasi alam P. merkusii strain Tapanuli di Tapanuli – Sumatera Utara No 1 2 3 4 5 Lokasi Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Kedalaman tanah KB Kriteria (cm) (%) 0 - 05 14 sangat rendah 05-10 29 rendah 10-20 36 rendah 20-30 33 rendah Rata-rata 28.0 rendah 0 - 05 46 sedang 05-10 44 sedang 10-20 41 sedang 20-30 38 sedang Rata-rata 42.3 sedang 0 - 05 37 sedang 05-10 44 sedang 10-20 49 sedang 20-30 59 tinggi Rata-rata 47.3 sedang 0 - 05 60 tinggi 05-10 52 tinggi 10-20 40 sedang 20-30 38 sedang Rata-rata 47.5 sedang 0 - 05 32 rendah 05-10 35 rendah 10-20 39 sedang 20-30 40 sedang Rata-rata 36.5 sedang 56 Analisis struktur tegakan alam P. merkusii strain Tapanuli Hasil inventarisasi tegakan untuk setiap plot pada masing-masing lokasi dibedakan menjadi dua kategori yaitu tanaman pinus dan non pinus. Dimensi pohon yang diukur untuk setiap plot adalah diameter dan tinggi. Hasil penelitian di Dolok Tusam Timur menunjukkan bahwa untuk vegetasi non pinus didominasi oleh kelas diameter dibawah 30 cm. Sedangkan untuk vegetasi pinus didominasi oleh kelas diameter 20 – 70 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Dolok Tusam Timur disajikan pada Gambar 7. 70 60 Jumlah 50 40 30 Non Pinus 20 Pinus 10 0 Kelas Diameter (cm) Gambar 7 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Dolok Tusam Timur. Hasil penelitian di Parinsoran menunjukkan bahwa untuk vegetasi non pinus didominasi oleh kelas diameter dibawah 10 cm. Sedangkan untuk vegetasi pinus didominasi oleh kelas diameter 20 – 30 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Parinsoran disajikan pada Gambar 8. 57 40 35 30 Jumlah 25 20 Non Pinus 15 Pinus 10 5 0 Kelas Diameter (cm) Gambar 8 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Parinsoran. Kelas diameter pohon non pinus yang mendominasi di Dolok Tusam Barat adalah diameter di bawah 30 cm. Sedangkan untuk vegetasi pinus didominasi oleh kelas diameter di atas 40 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Parinsoran disajikan pada Gambar 9. 60 50 Jumlah 40 30 Non Pinus 20 Pinus 10 0 Kelas Diameter (cm) Gambar 9 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Dolok Tusam Barat 58 Kelas diameter pohon dibawah 30 cm adalah yang mendominasi plot penelitian di Lobugala untuk kategori jenis non pinus. Sedangkan untuk vegetasi pinus, yang mendominasi adalah kelas diameter diatas 30 cm. Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Lobugala disajikan pada Gambar 10. 100 90 80 Jumlah 70 60 50 40 Non Pinus 30 Pinus 20 10 0 Kelas Diameter (cm) Gambar 10 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Lobugala Hasil analisis terhadap sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non pinus pada plot penelitian di lokasi Tolang disajikan pada Gambar 11. Kelas diameter pohon yang mendominasi plot penelitian di Lobugala untuk kategori jenis non pinus adalah diameter dibawah 30 cm. Sedangkan untuk vegetasi pinus, yang mendominasi adalah kelas diameter diatas 30 cm. 59 70 60 Jumlah 50 40 30 Non Pinus 20 Pinus 10 0 Kelas Diameter (cm) Gambar 11 Sebaran kelas diameter jenis Pinus merkusii strain Tapanuli dan non Pinus pada plot penelitian di lokasi Tolang Mengacu pada Gambar 7-11 dapat diketahui bahwa secara umum kurva sebaran kelas diameter mengikuti pola sebaran J terbalik dengan komposisi kelas diameter kecil (0-30 cm) didominasi oleh jenis non pinus dan untuk kelas diameter besar didominasi oleh jenis P. merkusii strain Tapanuli. Populasi alam P. merkusii strain Tapanuli yang tumbuh di lima lokasi sebaran alaminya memiliki kerapatan tegakan yang berbeda-beda. Gambar 12 Persentase luas bidang dasar Pinus merkusii strain Tapanuli dan luas bidang dasar non pinus 60 Kerapatan tegakan tertinggi ditemukan pada populasi alam P. merkusii strain Tapanuli yang tumbuh pada kawasan hutan lindung Dolok Tusam Timur yakni 117 individu/hektar. Adapun kelimpahan individu jenis non pinus jauh lebih banyak dibanding kelimpahan jenis P. merkusii strain Tapanuli. Namun mengingat jenis P. merkusii strain Tapanuli mendominasi kelas diameter besar maka wajar jika luas bidang dasar P. merkusii strain Tapanuli mendominasi tapak tumbuhnya. Dominasi P. merkusii strain Tapanuli pada tapak tumbuhnya disajikan pada Gambar 12. Hasil analisis tahapan perkembangan pohon untuk lolasi Dolok Tusam Timur, Parinsoran, Dolok Tusam Barat, Lobugala dan Tolang secara berturutturut disajikan pada Gambar 13, Gambar 14, Gambar 15, Gambar 16 dan Gambar Jumlah 17. 50 45 40 35 30 25 20 15 10 5 0 Non Pinus Pinus Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 13 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Dolok Tusam Timur Perkembangan pohon P. merkusii strain Tapanuli di Dolok Tusam Timur menunjukkan dominansi kelas pohon. Kelas pancang, tiang, dan semai relatif rendah. Perkembangan pohon kelas pancang, tiang dan semai terlihat sangat rendah dibandingkan kelas pohon. Hal ini memberikan gambaran tahapan perkembangan pohon yang relatif tidak seimbang dan kurang mewakili sesuai tingkat pertumbuhannya (Gambar 13). 61 70 60 Jumlah 50 40 Non Pinus 30 Pinus 20 10 0 Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 14 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Parinsoran Tingkat perkembangan pohon P. merkusii strain Tapanuli pada sebaran di Parinsoran didominasi oleh kelas pohon. Kemudian berturut-turut kelas tiang, pancang dan semai. Grafik ini juga menunjukkan tingkat perkembangan pohon yang tidak merata (Gambar 14). Gambaran yang sama juga terlihat di daerah Dolok Tusam Barat, namun sebaliknya tingkat perkembangan pohon didominasi Jumlah oleh kelas semai (Gambar 15). 100 90 80 70 60 50 40 30 20 10 0 Non Pinus Pinus Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 15 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Dolok Tusam Barat 62 100 90 80 Jumlah 70 60 50 Non Pinus 40 Pinus 30 20 10 0 Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 16 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Lobugala Pada Gambar 16. tingkat perkembangan pohon P. merkusii strain Tapanuli di daerah Lobugala didominasi oleh kelas pohon sementara kelas tiang, pancang dan semai relatif sangat sedikit. Kondisi yang relatif sama juga terlihat di daerah Tolang (Gambar 17). Hal ini menunjukkan tingkat perkembangan P. merkusii strain Tapanuli di kedua wilayah tersebut juga tidak merata. 70 60 Jumlah 50 40 Non Pinus 30 Pinus 20 10 0 Semai Pancang Tiang Pohon Tingkat Perkembangan Gambar 17 Grafik tingkat perkembangan pohon pada sebaran alami P. merkusii strain Tapanuli di Tolang Populasi alam P. merkusii strain Tapanuli secara umum memiliki problem regenerasi. Kelima lokasi yang diteliti ternyata didominasi oleh kelas pohon tanpa didukung oleh ketersediaan permudaan yang mencukupi dan mewakili semua 63 tingkatan pertumbuhan. Hanya lokasi Dolok Tusam Barat saja yang memiliki permudaan pada tingkat semai namun dengan jumlah yang sangat sedikit yakni hanya 250 semai/ha. Semai P. merkusii strain Tapanuli banyak ditemukan pada lantai hutan yang relatif bersih dari serasah dan pada longsoran tanah di tebingtebing di hutan. Sebaliknya pada lantai hutan yang dipenuhi oleh serasah, tidak ditemukan semai P. merkusii strain Tapanuli. Pembahasan Perubahan penutupan dan penggunaan lahan telah diidentifikasi sebagai salah satu penentu utama terjadinya perubahan global yang memberikan dampak besar terhadap ekosistem, biogeokimia global, perubahan iklim, dan kerentanan manusia (Foley et al. 2005). Perubahan tutupan lahan selalu memiliki peran utama di dalam ilmu perubahan lahan (Turner et al. 2007). Perubahan lahan dapat mempengaruhi sifat biologi, kimia, dan fisik tanah (Ross et al. 1999; Chen et al. 2000; Parfitt et al. 2003) yang arah dan besarnya perubahan tergantung pada sejarah pola penggunaan lahan, kondisi iklim, jenis tanah, dan jenis vegetasi (Guo & Gifford 2002). Perubahan tutupan lahan juga mempengaruhi kondisi komunitas hutan (Turner et al. 2003). Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui bahwa kondisi tutupan hutan di semua lokasi penelitian antara tahun 1994 hingga 2011 relatif dalam keadaan stabil. Kestabilan kondisi hutan ini antara lain nampak dari bentuk tutupan hutan pada peta tutupan lahan (Gambar 5) yang relatif tetap dan tidak mengalami fragmentasi selama 17 tahun. Hal ini antara lain nampak dari rendahnya persentase penurunan tutupan hutan yang terjadi antara 1994 hingga 2011 di lokasi penelitian. Bahkan di lokasi Lobugala, tutupan hutannya mengalami peningkatan persentase luas. Kestabilan kondisi hutan ini terjadi baik di lokasi yang masuk ke dalam kawasan hutan lindung (Dolok Tusam Timur dan Dolok Tusam Barat) dan lokasi yang berada di luar kawasan hutan negara (Parinsoran, Lobugala, dan Tolang). Berdasarkan dominasi luas bidang dasar, maka keberadaan tegakan alam P. merkusii strain Tapanuli memiliki peran penting di dalam menciptakan kondisi hutan yang stabil. Hampir di semua lokasi penelitian, luas bidang dasar tegakan 64 alam P. merkusii strain Tapanuli mendominasi luas tapak tumbuhnya. Hanya di perbukitan desa Tolang – Kec. Aek Bilah, luas bidang dasar tegakan alam P. merkusii strain Tapanuli kurang dari 50%. Namun kondisi hutan di perbukitan desa Tolang tersebut masih tetap stabil dikarenakan hutan campurannya relatif tidak terganggu. Mengacu pada data hasil inventarisasi tegakan, dapat diketahui bahwa struktur tegakan alam P. merkusii strain Tapanuli didominasi oleh pohonpohon dengan kelas diameter besar. Hal inilah yang menjadikan tegakan alam P. merkusii strain Tapanuli memiliki luas bidang dasar yang mampu mendominasi tapak tumbuhnya. Selain menyebabkan terjadinya kondisi tutupan hutan yang stabil, dominasi tegakan alam P. merkusii strain Tapanuli juga menyebabkan terjadinya penumpukan seresah pada lantai hutan. Hal ini terkait dengan sifat daun P. merkusii strain Tapanuli yang lambat mengalami proses dekomposisi. Indikasi lambatnya proses dekomposisi serasah ini juga nampak dari nilai C/N yang tergolong sedang hingga tinggi hampir di semua lokasi tapak tumbuh yang diteliti. Tebalnya serasah dan bahan organik pada lantai hutan tersebut juga menyebabkan terhambatnya proses regenerasi alam P. merkusii strain Tapanuli yang ada di dalam hutan. Hal ini nampak dari sedikitnya jumlah semai P. merkusii strain Tapanuli yang berhasil ditemukan dalam kegiatan analisis struktur tegakan. Rendahnya jumlah semai P. merkusii strain Tapanuli yang berhasil ditemukan tersebut disinyalir karena biji-biji yang jatuh secara alami tidak langsung menyentuh permukaan tanah, tetapi tersangkut di dalam seresah. Akibatnya bijibiji tersebut tidak mampu berkecambah. Hasil pengamatan di lapangan dapat diketahui bahwa semai alam P. merkusii strain Tapanuli bermunculan pada tebing-tebing yang mengalami longsor. Longsoran tanah yang umumnya berupa lapisan permukaan tanah yang terbuka menjadi media tumbuh yang optimal bagi biji P. merkusii strain Tapanuli untuk berkecambah. Berdasarkan hasil analisis perubahan lahan dapat diketahui juga bahwa tutupan lahan berupa ilalang-semak cenderung mengalami peningkatan pada sebagian besar lokasi penelitian. Hanya di Lobugala lahan yang ditutupi ilalangsemak mengalami penurunan luas. Meningkatnya lahan yang ditutupi ilalangsemak inilah yang diduga kuat memberikan dampak negatif terhadap kualitas 65 tapak tumbuh. Hal ini antara lain terkait dengan sifat ilalang-semak yang memarginalkan lahan. Pada umumnya lahan-lahan yang ditutupi oleh ilalangsemak akan mengalami penurunan kualitas tanahnya, baik secara kimiawi, fisika, maupun biologis. Secara kimiawi lahan-lahan yang ditutupi oleh ilalang-semak akan memiliki tingkat kesuburan tanah yang rendah dikarenakan terjadinya defisiensi unsur hara di dalam tanah. Secara fisik, pada umumnya lahan-lahan yang ditutupi oleh ilalang-semak akan menjadi lebih padat. Adapun secara biologi, lahan-lahan yang ditutupi oleh ilalang-semak akan menjadi lahan-lahan yang lebih tandus karena tidak optimalnya proses biogeokimia di dalam tanah. Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui bahwa sebagian besar lokasi penelitian mengalami peningkatan luas lahan yang ditutupi ilalang-semak. Hanya lokasi Lobugala yang mengalami penurunan luas lahan ilalang-semak. Parinsoran menempati urutan pertama lokasi yang mengalami peningkatan luas lahan tertinggi yakni 5.59% antara tahun 1994 hingga 2011. Keberadaan ilalang-semak ini akan semakin menjadikan tapak tumbuh lima populasi alam P. merkusii strain Tapanuli semakin miskin hara. Ilalang-semak tersebut muncul sebagai dampak adanya lahan-lahan yang tidak terolah dengan baik dan berkesinambungan. Ilalang-semak juga menyebabkan terhambatnya regenerasi alam P. merkusii strain Tapanuli. Lahan yang tertutupi oleh ilalang-semak akan menyebabkan lantai hutannya tertutup sehingga menghambat terjadinya biji-biji P. merkusii strain Tapanuli yang jatuh ke lantai hutan langsung menyentuh tanah. Kondisi inilah yang barangkali menjadi sebab tidak ditemukannya semai P. merkusii pada plot penelitian yang berlokasi di areal terbuka. Selain ilalang-semak, penambahan luas tutupan lahan ladang juga dapat menyebabkan terjadinya hambatan regenerasi alami P. merkusii strain Tapanuli. Hal ini terkait dengan teknik dan sistem berladang yang dilakukan oleh masyarakat. Secara garis besar masyarakat setempat memulai kegiatan perladangan dengan cara membuka lahan melalui pembakaran. Sebenarnya kegiatan pembakaran dalam pembukaan ladang tersebut dapat merangsang terjadinya perkecambahan biji P. merkusii strain Tapanuli yang ada di lantai hutan atau yang tersangkut di semak-semak. Namun karena setelah kegiatan 66 pembakaran tersebut dilakukan pembersihan lahan (land clearing) maka biji-biji P. merkusii strain Tapanuli yang kemungkinan sudah siap berkecambah kembali menjadi dorman atau rusak tersapu oleh alat pembersih lahan ke bagian tepi lahan yang dibuka untuk ladang. Kondisi inilah yang barangkali menyebabkan pertumbuhan dan perkembangan P. merkusii strain Tapanuli pada areal terbuka menyebar secara individual dan tidak beraturan pada tepi areal perladangan. Berdasarkan hasil analisis sifat kimia tanah, dapat diketahui bahwa kelima lokasi sebaran alam P. merkusii strain Tapanuli yang diteliti memiliki sifat kimia yang relatif sama. Secara keseluruhan kelima lokasi yang diteliti memiliki sifatsifat kimia tanah yang mirip dengan ciri-ciri kimia tanah podsolik merah kuning yang memiliki tingkat kesuburan tanah rendah. Nilai pH tanah adalah sifat kimia tanah yang menunjukkan besarnya kandungan ion H+ di dalam tanah dan berguna sebagai indikator tingkat kemasaman atau alkalinitas tanah. Semakin tinggi kandungan ion H+ di dalam tanah maka semakin kecil nilai pH nya dan semakin masam tanah tersebut. Nilai pH tanah ditentukan berdasarkan kandungan ion H+ dan OH- yang memiliki hubungan berbanding terbalik (Pritchett 1979; Tan 1993). Namun demikian berdasarkan kandungan %C organiknya, ternyata sebagian besar lokasi memiliki kadar C tinggi. Hanya lokasi Parinsoran yang kadar C organiknya rendah. Tingginya persentase C organik pada sebagian besar lokasi penelitian memberikan harapan bahwa tapak tumbuh kelima populasi alam P.merkusii strain Tapanuli dapat dikelola dengan baik. Mengacu pada data struktur tegakan, dapat diketahui bahwa hampir semua populasi alam P. merkusii strain Tapanuli mampu tumbuh dan berkembang sehingga mendominasi tapak tumbuhnya. Hal ini menandakan bahwa sifat kimia tanah tidak menjadi kendala pertumbuhan dan perkembangan bagi populasi alam P. merkusii strain Tapanuli. Persentase C organik adalah sifat kimia tanah yang menunjukkan besarnya bahan organik yang terkandung di dalam tanah. Kandungan bahan organik penting untuk diketahui karena menjadi salah satu faktor yang menentukan kesuburan tanah. Melalui proses dekomposisi bahan organik, berbagai unsur hara yang diperlukan untuk pertumbuhan tanaman dapat tersedia di dalam tanah. Persentase N merupakan sifat kimia tanah yang menunjukkan ketersediaan unsur 67 N di dalam tanah. Adapun C-N rasio menggambarkan kesetimbangan hubungan antara unsur C dan N di dalam tanah. Proses dekomposisi bahan organik di dalam tanah dapat dilihat dari nilai C-N rasionya. Semakin tinggi nilai C-N rasio tanah maka bahan organik yang ada di dalam tanah tersebut semakin lama terdekomposisi. Sebaliknya semakin rendah nilai C-N rasio tanah maka proses dekomposisi bahan organik tersebut semakin cepat (Foth 1990). Secara umum dapat dinyatakan bahwa stabilitas tutupan hutan menyebabkan hambatan bagi regenerasi alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan. Adapun Tutupan ilalang-semak dan praktek pembukaan ladang secara berulang dengan cara membakar dan land clearing menjadi hambatan bagi regenerasi alam P. merkusii strain Tapanuli pada areal terbuka. Semai dianggap cukup bila terdapat penyebaran 40% dengan jumlah semai 1000 batang/ha (Smith 1963). Jumlah semai P. merkusii strain Tapanuli yang ditemukan di lokasi Lobugala tersebut ternyata jauh di bawah jumlah semai P. merkusii yang tumbuh di Ban Wat Chan, Thailand Utara yakni berkisar antara 11042 hingga 34250 batang/ha (Koskela et al. 1995). Hasil penelitian Harahap (2000b) menyatakan bahwa jumlah biji per kerucut diantara ketiga strain P. merkusii ternyata tidak jauh berbeda. Rata-rata jumlah biji per kerucut untuk P. merkusii strain Aceh adalah 5.7 untuk P. merkusii strain Tapanuli 8.86 dan P. merkusii strain Kerinci adalah 6.71. Berdasarkan informasi ini maka dapat dinyatakan bahwa rendahnya jumlah permudaan alam pada kelima populasi alam P. merkusii strain Tapanuli bukan disebabkan oleh faktor rendahnya kemampuan produksi biji. Bahkan dari hasil penelitian Harahap (2000c) tersebut, kemampuan rata-rata produksi biji untuk P. merkusii strain Tapanuli lebih tinggi dibanding P. merkusii strain Aceh dan P. merkusii strain Kerinci. Dengan demikian, rendahnya permudaan P. merkusii strain Tapanuli ini diduga kuat berasal dari faktor luar (non genetik). Berdasarkan kajian literatur, dapat diketahui bahwa semai P. merkusii strain Tapanuli sangat rentan dengan serangan hama Milionia basalis (De Veer & Govers 1953 diacu dalam Harahap 2000c). Kerentanan terhadap serangan hama inilah yang mungkin menyebabkan kemampuan tumbuh (survival rate) semai rendah. 68 Sub-topik Penelitian 2 Analisis Genetik Populasi Alam P. merkusii strain Tapanuli Pada Sebaran Alaminya di Tapanuli – Sumatera Utara Dengan Menggunakan Penanda Molekuler Mikrosatelit Hasil Hasil Isolasi DNA Optimasi isolasi DNA yang dilakukan terhadap 78 contoh daun yang berhasil dikumpulkan dari lima lokasi sebaran alam P. merkusii strain Tapanuli memperlihatkan tampilan DNA yang cukup jelas, demikian juga dengan kegiatan pengenceran yang dilakukan. Pengenceran 10x dan 5x menghasilkan pita DNA yang tebal, sedangkan pengenceran 2x dan 3x menghasilkan pita yang relatif tipis (Gambar 18). 2x GP4 GP5 Gambar 18 GP8 GP10 10x 5x 3x 10x 2x contoh DNA murni a b Contoh pita DNA hasil ekstraksi. Ket: (a) pita yang dihasilkan berdasarkan kesegaran sampel; menggunakan metode ekstraksi Dneasy Plant Mini Kit (50) dari QIAGEN, (b) ukuran besarnya pengenceran hasil ekstraksi DNA beserta kontaminasinya; menggunakan metode ekstraksi CTAB. Hasil Amplifikasi DNA Dengan Primer Mikrosatelit Tujuh primer mikrosatelit yang digunakan dalam penelitian ini merujuk pada primer mikrosatelit yang telah berhasil diuji oleh Nurtjahjaningsih et al. (2005), yakni Pm01, Pm04, Pm05, Pm07, Pm08, Pm09a, dan Pm12. Hasil seleksi primer menunjukkan bahwa amplifikasi DNA contoh dengan ketujuh primer yang diseleksi mampu menghasilkan produk amplifikasi yang polimorfik . 69 Hasil amplifikasi DNA menunjukkan adanya pita-pita DNA poliformik yang muncul dari 2 alel (Gambar 19) dimana posisi pita DNA yang muncul berada di bawah posisi primer mikrosatelit yang menjadi rujukan. Contoh pada primer Pm 04 yang menghasilkan fragmen berukuran 92 bp (Nurtjahjaningsih et al. 2005). Dalam hal ini ukuran pita yang muncul dari amplifikasi berkisar pada 65 dan 75 bp. Perbedaan ukuran fragmen yang dihasilkan saat ini dengan yang sebelumnya dengan primer mikrosatelit yang menjadi rujukan mungkin terjadi karena adanya perbedaan contoh penelitian yang digunakan. Nurtjahyaningsih et al. (2005) menggunakan bahan tanaman dari P. merkusii strain Aceh yang dikembangkan di dalam hutan tanaman di pulau Jawa, sedangkan penelitian ini menggunakan bahan tanaman yang bersumber dari populasi alam di Tapanuli – Sumatera Utara. Perbedaan genotip diantara kedua bahan tanaman yang dianalisis memungkinkan terjadinya perbedaan ukuran fragmen DNA yang muncul. Pm07 Pm09a Pm012 200 bp 150 bp Pm08 Pm01 Pm04 Pm05 100 bp 50 bp Gambar 19 Hasil amplifikasi DNA P. merkusii strain Tapanuli dengan primer mikrosatellite Pm01, Pm04, Pm05, Pm07, Pm08, Pm09a, Pm12 Pita-pita yang muncul tersebut selanjutnya diskoring dan ditentukan secara manual ukuran fragmennya berdasarkan posisi marka yang digunakan dan diolah dengan menggunakan software POPGENE 1.32 yang rincian hasilnya tersaji dalam Lampiran 6. Berdasarkan hasil pengolahan data ini secara umum dapat diketahui keragaman genetik baik di dalam populasi maupun antar populasi. 70 Keragaman Alel Populasi Alam P. merkusii Strain Tapanuli Nilai frekuensi alel pada lima populasi P. merkusii strain Tapanuli yang diteliti berkisar antara 0.0312 hingga 0.9167 (Tabel 17). Nilai frekuensi alel terendah dimiliki oleh populasi alam P. merkusii strain Tapanuli yang tumbuh di desa Tolang – Kec. Aek Bilah – Kab. Tapanuli Selatan, sedangkan nilai frekuensi alel tertinggi dijumpai pada populasi alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam Barat. Tabel 17. Keragaman nilai frekuensi alel pada setiap lokus dan populasi alam P. merkusii strain Tapanuli yang tersebar di Tapanuli – Sumatera Utara. Primer/Locus Panjang fragmen Alel Populasi DTT 111-117 Pm01 92 112-118 Pm05 284-309 132 81-99 181-193 Pm12 0.5294 0.2812 0.1667 2 3 0.5000 0.0882 0.8125 0.0938 0.4706 - 0.3750 0.3438 0.5417 0.2917 1 0.7059 0.3125 0.7647 0.1875 0.2500 0.6875 0.2353 - 0.8125 - 0.7500 - 0.2941 - - 1 0.4412 0.2500 0.6176 0.2500 0.0833 2 3 0.4412 0.1176 0.6250 0.1250 0.3824 0.9118 0.5000 0.2500 0.6250 0.2917 1 0.2353 0.3438 0.0882 0.0938 0.4167 0.7647 0.2500 0.4062 - 0.4062 0.5000 0.4167 0.1667 0.2941 0.8125 0.2059 0.7500 0.8333 0.1875 0.7941 - 0.2500 - 0.1667 - 0.7500 0.2059 0.7188 0.6667 0.7059 0.2500 0.7941 0.0312 0.2500 0.1667 0.1667 1 0.2940 0.0938 - 0.0938 0.0833 2 3 0.2941 0.6765 0.7500 0.1562 0.5000 0.5000 0.8125 0.0938 0.9167 - - 1 0.7059 - 1 2 3 Pm09a TOL 0.0938 2 3 Pm08 LOB 0.4118 2 3 Pm07 DTB 1 2 3 Pm04 PAR 0.2941 - - Berdasarkan data pada Tabel 17 dapat juga diketahui bahwa lokus Pm05 merupakan lokus yang memiliki alel yang tersebar merata pada semua populasi. 71 Hal ini menandakan bahwa primer Pm05 lebih optimal didalam mengamplifikasi DNA contoh P. merkusii strain Tapanuli dibanding primer yang lain. Keragaman Genetik Dalam Populasi Beberapa parameter yang biasa digunakan untuk menilai keragaman genetik dalam populasi adalah jumlah lokus polimorfik, jumlah alel teramati (Na), jumlah alel efektif (Ne) dan nilai heterosigositas harapan (He). Nilai keragaman genetik (He) tertinggi sebesar 0.4693 ditemukan pada populasi Lobugala, sedangkan nilai He terendah sebesar 0.3779 dimiliki oleh populasi Dolok Tusam Barat (Tabel 18). Tabel 18 Keragaman genetik pada lima populasi alam P. merkusii strain Tapanuli di Sumatera Utara No. Populasi 1. 2. 3. 4. 5. Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang Rata-rata N 34 32 34 32 24 31 PLP (%) 100 100 100 100 100 100 Na Ne Ha He 2.4286 2.5714 2.0000 3.0000 2.5714 2.5143 1.9069 1.8531 2.0000 1.4755 1.9093 1.8290 0.2269 0.1696 0.3950 0.3661 0.3571 0.3029 0.4614 0.4316 0.3779 0.4693 0.4345 0.4349 Keterangan : N = Jumlah total individu; PLP = Persentase Lokus Polimorfik; Na = Jumah alel yang diamati; Na = Jumah alel efektif (Kimura and Crow (1964); He = Diferensiasi genetik Nei (1973)/Heterozigositas harapan Hasil tersebut menunjukkan bahwa keragaman genetik di dalam populasi alam P. merkusii strain Tapanuli di Lobugala paling tinggi dibanding empat populasi yg lainnya, sedangkan keragaman genetik dalam populasi yang terendah ditemukan pada populasi alam P. merkusii strain Tapanuli yang berasal dari lokasi hutan lindung Dolok Tusam Barat. Untuk melihat peluang inbreeding pada tiap lokasi dan kemungkinan pengaruhnya terhadap peningkatan keragaman individu dalam populasi P. merkusii strain Tapanuli yang diteliti, maka dilakukan pendekatan dengan melihat nilai fiksation indeksnya (Fis), seperti disajikan pada Tabel 19. 72 Tabel 19 Nilai Indeks Fiksasi (Fis) dari kelima populasi P. merkusii strain Tapanuli yang diteliti No Populasi Ratarata Primer Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 1. Dolok Tusam Timur -0.3353 -0.2812 1.0000 1.0000 1.0000 1.0000 0.8707 0.6077 2. Parinsoran -0.1636 0.5294 0.4269 1.0000 1.0000 1.0000 0.5362 0.6184 3. Dolok Tusam Barat -0.6528 -0.6190 -0.0968 0.0192 0.4603 -0.2593 0.8824 -0.0380 4. Lobugala -0.1327 0.0000 -0.0847 0.5897 0.6667 0.8512 0.2242 0.3021 5. Tolang 0.0175 -0.4497 -0.3333 1.0000 1.0000 0.6667 -0.0909 0.2586 Berdasarkan data Fis pada Tabel 19 di atas dapat diketahui bahwa hanya populasi P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat saja yang memiliki nilai Fis (-). Dengan demikian dapat dinyatakan bahwa dari kelima populasi yang diteliti, hanya populasi P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang menunjukkan kelebihan jumlah heterozigot. Hal ini menandakan juga bahwa populasi P. merkusii strain Tapanuli di Dolok Tusam Barat walaupun memiliki nilai keragamannya terendah namun sangat berpeluang untuk menghasilkan individu-individu dengan sifat heterozigot karena frekuensi alel yang seimbang sesuai harapan dibandingkan keempat lokasi yang lain. Diferensiasi Genetik Antar Populasi Diferensiasi genetik antar populasi menggunakan parameter jarak genetik. dapat diidentifikasi dengan Jarak genetik mengukur perbedaan struktur genetik antar dua populasi pada suatu lokus gen tertentu (Finkeldey 2005). Pebedaan genetik dari dua atau lebih populasi pada umumnya dianalisis dengan sebuah matrik dimana elemen-elemennya berupa jarak genetik dan pasangan kombinasi dari masing-masing populasi (Finkeldey 2005). Nilai jarak genetik diantara lima populasi P. merkusii strain Tapanuli yang diteliti berkisar dari 0.0194 hingga 0.6572. Nilai jarak genetik terendah (0.0194) diperoleh pada hubungan antara populasi Dolok Tusam Barat dengan populasi Dolok Tusam Timur. Hal ini menunjukkan bahwa antara populasi Dolok Tusam Barat dengan Dolok Tusam Timur memiliki tingkat kekerabatan yang paling dekat dibanding dengan ketiga populasi yang lain. Adapun nilai jarak genetik tertinggi (0.6572) ditemukan pada hubungan antara populasi Tolang dengan Dolok Tusam Barat (Tabel 20). 73 Tabel 20 Jarak genetik antar populasi P. merkusii strain Tapanuli Pop Dolok Tusam Timur Parinsoran Dolok Tusam Barat Lobugala Tolang 1 **** 0.2799 0.0194 0.3107 0.4363 2 3 4 5 **** 0.4217 0.0896 0.0517 **** 0.4279 0.6572 **** 0.0660 **** Hal ini menandakan bahwa antara populasi Tolang dengan Dolok Tusam Barat memiliki tingkat kekerabatan yang paling jauh dibanding dengan ketiga populasi alam P. merkusii strain Tapanuli yang lainnya. Semakin dekat kekerabatan dua populasi maka kedua populasi tersebut semakin banyak memiliki kesamaan dalam hal struktur genetiknya. Demikian juga sebaliknya, semakin jauh kekerabatan dua populasi maka struktur genetik diantara kedua populasi itu pun akan semakin banyak perbedaannya. Hasil analisis kelompok dengan bantuan software Popgene 1.32 (Gambar 19) menunjukkan bahwa lima populasi P. merkusii strain Tapanuli yang diteliti dibagi menjadi 2 kelompok besar. Kelompok pertama menempatkan populasi Dolok Tusam Timur dan Dolok Tusam Barat ke dalam 1 kelompok. Adapun kelompok kedua, menempatkan populasi Parinsoran dan Tolang ke dalam sub kelompok pertama, dan populasi Lobugala ke dalam kelompok sendiri. Berdasarkan analisis kelompok ini, dapat diketahui ternyata populasi Lobugala merupakan populasi P. merkusii strain Tapanuli yang memiliki struktur genetik paling berbeda dengan struktur genetik keempat populasi lainnya. Dolok Tusam Timur Dolok Tusam Barat Parinsoran Tolang Lobugala Gambar 20 Dendrogram pengelompokan lima populasi alam P. merkusii strain Tapanuli berdasarkan jarak genetik Nei (1972) menggunakan UPGMA 74 Pembahasan Amplifikasi DNA Dengan Penanda Mikrosatelit Hasil seleksi primer menunjukkan bahwa amplifikasi DNA contoh dengan ketujuh primer (pm01, pm04, pm05, pm07, pm08, pm09a, pm12) yang diseleksi mampu menghasilkan produk amplifikasi dengan fragment DNA polimorfik . Kemampuan amplifikasi primer mikrosatelit untuk amplifikasi DNA telah teruji pada penelitian sebelumnya (Li et al.2002; Lagercrantz et al. 1993; Wang et al. 1994; Vendramin & Hansen 2005). Dibandingkan dengan gymospermae, transfer mikrosatelit pada jenis pinus relatif lebih sulit (Scot et al. 2006; Auckland 2002). Sebagai contoh pada loblolly pine hanya sekitar 60% saja loci mikrosatelit yang teramplifikasi, namun kebanyakan dengan pola polimorfik (Devey et al. 1999; Kutil & William 2001). Struktur Genetik Populasi P. merkusii Strain Tapanuli Struktur genetik adalah sebaran mutlak atau frekuensi relatif dari tipe-tipe genetik tertentu pada satu lokus gen. Secara garis besar, ada 2 tipe struktur genetik dari suatu populasi, yakni struktur dari genotip yang sesungguhnya merupakan penyebaran frekuensi dari genotip-genotip yang terdapat pada suatu populasi dan struktur dari allel yakni penyebaran frekuensi dari alel-alel dalam suatu populasi (Finkelday 2005). Keragaman alel diantara populasi dan lokus merupakan salah satu ukuran yang dapat digunakan untuk menggambarkan struktur genetik populasi suatu jenis. Nilai frekuensi alel pada lima populasi P. merkusii strain Tapanuli yang diteliti berkisar antara 0.0312 hingga 0.9167. Nilai frekuensi alel terendah dimiliki oleh populasi alam P. merkusii strain dari Logubala pada lokus pm09a, alel ke 2 sedangkan nilai frekuensi alel tertinggi dijumpai populasi Tolang yaitu alel no 2 pada pm12. Hal tersebut membuktikan bahwa pada lokasi dengan keragaman terjaga (kawan lindung) memiliki struktur genetik yang lebih komplek, sehingga memungkinkan diperoleh sifat-sifat tertentu melalui kegiatan pemuliaan. 75 Keragaman Genetik Populasi P. merkusii Strain Tapanuli Hasil analisis genetik dengan penanda mikrosatelit pada kelima populasi strain Tapanuli memperlihatkan nilai keragaman genetik tertinggi (He:0,4693 ) diperoleh pada populasi Lobugala (kawasan perladangan) , sedangkan keragaman terendah (He:0.3779) diperoleh pada populasi Dolok Tusam Barat (kawasan hutan lindung). Nilai tersebut sedikit berbeda dengan hasil penelitian awal yang dilakukan Nurtjahjaningsih (2007) mengenai keragaman populasi induk dan anakan di KBS Sumedang (0.501), KBS Baturaden (0.468) dan KBS Sempolan (0.528) dengan penanda mikrosatelit. Nilai tersebut lebih tinggi dibanding penelitian pada populasi aceh dengan menggunakan penanda allozyme He:0.304 (Kartikawati 1998; Na’iem 2000), lebih tinggi dibandingkan penelitian Siregar (2000) pada hutan tanaman pinus di Jawa dengan penanda Isozym (He:0.389) dan penelitian Na’iem & Munawar (2002) pada strain Kerinci (He: 0.042) dan Tapanuli (He: 0.219) dengan penanda allozyme. Namun masih dalam kisaran keragaman dengan penanda mikrosatelit umumnya pada pinus (He: 0.50-0.80). Hal tersebut dapat dipahami karena populasi strain Taapanuli sudah terbagi-bagi dalam beberapa sub populasi yang sempit dan terpisah-pisah sehingga memungkinkan terjadinya efek kawin kerabat yang tidak menguntungkan untuk pemuliaan dimasa mendatang. Perbedaan tingginya nilai keragaman genetik pada lima populasi yang diteliti memperlihatkan terjadinya perubahan sumber genetik pada kelima lokasi tersebut. Kawasan Dolok Tusam Barat dan Dolok Tusam Timur merupakan kawasan hutan lindung yang belum tersentuh oleh kegiatan reboisasi maupun rehabilitasi sehingga kondisi keragaman genetiknya masih terjaga seperti alaminya. Sedangkan pada lokasi lain (Lobuga, Tolang dan Parinsoran) telah terjadi input aktifitas manusia seperti kegiatan perladangan dan perkebunan sehingga memungkinkan terjadinya perubahan nilai keragaman genetiknya. Khusus pada daerah Lobugala yang merupakan lokasi dengan tingkat keragaman tinggi, berdasarkan sejarah lahannya pada lokasi tersebut pernah dilakukan kegiatan rehabilitasi dengan mengintroduksi bibit dari luar populasi (Simorangkir 15 Maret 2012, komunikasi pribadi) yang menyebabkan tingginya keragaman genetik pada lokasi tersebut dibandingkan populasi lain. 76 Lebih lanjut Hardiyanto (1993, 2000) menjelaskan bahwa sampai saat ini populasi tusam di Sumatera terutama Tapanuli telah mengalami penurunan yang cukup drastis karena kegiatan pembalakan dan terdesak oleh kegiatan pertanian dan perkebunan sehingga memungkinkan terjadinya seleksi mundur (disgenic selection) dan tingginya inbreeding. Hasil perhitungan nilai indeks fiksasi (Fis) memperlihatkan pada lokasi yang terfragmentasi memiliki nilai Fis yang cukup tinggi (Fis:+ 0.2586-0.606) mengindikasikan peluang inbreeding yang cukup tinggi, sedangkan pada Dolok Tusam Barat memiliki nilai indeks fiksasi rendah (Fis:-0.0380) yang mengindikasikan peluang inbreeding yang rendah. Angka minus menunjukkan bahwa persen heterosigot lebih besar daripada homosigot, sedangkan nilai Fis (+) menunjukkan semakin besarnya homosigositasnya yang berarti kemungkinan terjadi inbreeding semakin besar (Munawar 2002). Hal ini menandakan juga bahwa populasi P. merkusii strain Tapanuli di Dolok Tusam Barat walaupun memiliki nilai keragamannya terendah namun sangat berpeluang untuk menghasilkan individu-individu dengan sifat heterozigot sesuai harapan dibandingkan keempat lokasi yang lain. Hasil nilai Fis pada keempat populasi yang lain memperlihatkan peluang kejadian inbreeding yang cukup besar. Populasi P. merkusii strain Tapanuli di Parinsoran merupakan populasi yang paling tinggi peluang terjadinya inbreeding. Liu et al. (2012) menyatakan bahwa pada umumnya pinus merupakan jenis yang melakukan perkawinan secara outbreeding, namun ada beberapa hal yang dapat membuat pinus melakukan perkawinan kerabat (inbreeding), yakni pada saat populasi suatu jenis mengalami fragmentasi. Hal ini seperti ditemui pada Pinus rzedowskii (Delagado et al. 1999), dan Pinus pinceana (Ledig et al. 2001). Inbreeding pada pinus juga dapat terjadi karena habitat terisolasi, misal pada Pinus resinosa (Boys et al. 2005). Robledo-Arnuncio dan Gill (2005) telah berhasil membuktikan bahwa Pinus sylvestris yang tumbuh pada lokasi yang terisolasi memiliki laju kawin sendiri yang lebih besar dibanding jenis yang tumbuh pada populasi besar. 77 Hubungan Genetik Perhitungan mengenai hubungan genetik antar populasi sangat berguna untuk mengetahui pola sebaran dan kesamaan sifat genetik pada semua populasi yang diteliti. Pengetahuan tentang hubungan genetik ini merupakan haal mendasar yang diperlukan untuk mengkaji sejarah persebaran sifat genetik maupun untuk mempertahankan dan merencanakan pengelolaan keragaman genetik populasi. Nilai hubungan genetik dapat diperoleh dari hasil perhitungan dengan parameter jarak genetik (genetic distance) yang dilanjutkan dengan analisi kelompok (cluster). Nilai jarak genetik terdekat (0.0194) diperoleh pada hubungan antara populasi Dolok Tusam Barat dengan populasi Dolok Tusam Timur. Hal ini menunjukkan bahwa antara populasi Dolok Tusam Barat dengan Dolok Tusam Timur memiliki tingkat kekerabatan yang paling dekat dan kemungkinan berasal dari sumber benih yang sama. Sedangkan jarak genetik terjauh (0.6572) diperoleh dari populasi Dolok Tusam Barat dan Tolang, hal tersebut mengindikasikan kekerabatan kedua pohon pada lokasi tersebut cukup jauh. Hasil analisis kelompok (cluster) membagi strain Tapanuli kedalam dua kelompok besar yaitu kelompok I (Dolok Tusam Barat dan Dolok Tusam Timur) dan kelompok II (Tolang, Parinsoran dan Labugala) walaupun sesungguhnya masih terdapat hubungan kekerabatan dan karena perkembangan pemanfaatan lahan telah menyebabkan terjadinya kelompok-kelompok populasi alam yang sedikit terpisah. Kelompok II pada penelitian ini terdiri dari populasi yang terfragmentasi, perbedaan tersebut kemungkinan disebabkan adanya infusi sumber benih lain melalui kegiatan reboisasi pada daerah tersebut. Hal tersebut didukung oleh Indrioko (1996) dan Kartikawati (1998) yang menyatakan bahwa kegiatan reboisasi hutan yang dilakukan di daerah Aceh, Tapanuli, Kerinci dan daerahdaerah lain di seluruh Indonesia menggunakan benih tusam yang didatangkan dari Jawa. Implikasi Fragmentasi Habitat dan Keragaman Genetik Pengetahuan mengenai keragaman genetik dari suatu populasi sangat penting untuk kegiatan konservasi yang dilakukan karena keragaman genetik yang 78 tinggi akan membantu populasi beradaptasi terhadap perubahan lingkungan disekelilingnya dan terjaganya biodiversity. Lebih lanjut Namkoong et al. (1996) diacu dalam Finkeldey (2005) menyatakan bahwa derajat keragaman genetik merupakan salah satu indikator kelestarian pengelolaan hutan. Keragaman genetik strain Tapanuli pada lima lokasi penelitian tergolong cukup tinggi, hal tersebut mengindikasikan kegiatan seleksi dan pemeliharaan yang dilakukan mampu menjaga keragaman genetiknya. Fragmentasi habitat yang terjadi pada daerah Lobugala, Parinsoran dan Torang, sedikit mempengaruhi keragaman genetiknya hal tersebut ditunjukkan dengan sedikit perbedaan nilai He pada kawasan hutan lindung Dolok Tusam. Pada lokasi terfragmentasi, kegiatan rehabilitasi untuk memulihkan kondisi hutan masih terus dilakukan dengan melakukan infusi jenis dari hutan sehingga keragamannya tetap terjaga tinggi walaupun indeks fiksasinya tinggi. Adanya peluang inbreeding yang cukup tinggi pada lokasi terfragmentasi memungkinkan terjadinya persentase homozigositas yang cukup tinggi sehingga memungkinkan terjadinya kerusakan struktur genetik karena genetic drift, depresi inbreeding, asortif mating, meiotic drift (Munawar 2002). Rekomendasi yang dapat dihasilkan pada penelitian ini adalah menjaga populasi alami strain Tapanuli (Dolok Tusam Barat dan Dolok Tusam Timur) karena memiliki keragaman alel cukup tinggi serta peluang terjadinya inbreeding yang rendah sehingga memungkinkan diperolehnya sumber gen bagi karakter tertentu sesuai yang diharapkan. Demikian juga untuk produksi biomassa karbon. Adanya tutupan lahan pinus yang masih rapat dan pertumbuhan yang bagus pada kedua lokasi tersebut memungkinkan diperoleh biomassa karbon yang cukup banyak dibandingkan lokasi terfragmentasi. Berdasarkan hasil analisis genetik dengan menggunakan penanda molekuler mikrosatelit dapat diketahui bahwa populasi Lobugala memiliki nilai heterosigositas harapan (He) tertinggi, dan populasi Dolok Tusam Barat memiliki nilai heterosigositas harapan (He) terendah. Namun jika nilai He tersebut dibandingkan dengan nilai heterosigositas aktualnya (Ha) maka hanya populasi Dolok Tusam Barat yang memiliki surplus heterosigositas, sedangkan keempat populasi lainnya mengalami defisit heterosigositas. 79 Tingginya nilai He pada populasi Lobugala menunjukkkan bahwa keragaman di dalam populasi ini lebih tinggi dibanding populasi yang lain. Hal ini dapat terjadi kemungkinan karena adanya outbreeding pada populasi P. merkusii strain Tapanuli yang ada di lokasi Lobugala. Kondisi tutupan lahan yang relatif lebih terbuka dibanding tutupan lahan keempat lokasi lainnya memungkinkan terjadinya pergerakan biji P. merkusii strain Tapanuli dari berbagai lokasi sehingga terjadi outbreeding di Lobugala. Adapun nilai He yang terendah pada populasi Dolok Tusam Barat menunjukkan bahwa populasi alam P. merkusii strain Tapanuli pada lokasi ini memiliki keragaman di dalam populasi yang rendah. Hal ini dapat terjadi kemungkinan karena pengaruh kondisi tegakan alam P. merkusii strain Tapanuli pada lokasi Dolok Tusam Barat yang telah mencapai klimaks sehingga peluang terjadinya outbreeding kecil. Selanjutnya berdasarkan nilai Indeks Fiksasi (Fis) dapat diketahui bahwa hanya populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang memiliki nilai negatif atau terjadi surplus heterosigositas sehingga peluang terjadinya inbreeding pun kecil. Sebaliknya populasi alam P. merkusii strain Tapanuli yang tumbuh di empat lokasi yang lain memiliki nilai Fis positif atau terjadi defisit heterosigositas sehingga peluang terjadinya depresi pun meningkat. Rendahnya peluang terjadinya depresi inbreeding pada populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat diduga kuat terjadi sebagai dampak dari kondisi tutupan hutan yang stabil. Sebaliknya meningkatnya peluang depresi inbreeding pada lokasi Lobugala kemungkinan karena adanya tegakan alam P. merkusii strain Tapanuli yang mengelompok dalam ukuran populasi yang sempit. Selanjutnya berdasarkan analisis genetik dapat diketahui juga keanekaragaman genetik antar populasi yang antara lain ditunjukkan oleh nilai jarak genetik dan digambarkan dalam bentuk dendrogram. Berdasarkan nilai jarak genetiknya, diantara lima populasi P. merkusii strain Tapanuli yang diteliti berkisar dari 0.0194 hingga 0.6572. Nilai jarak genetik terendah (0.0194) diperoleh pada hubungan antara populasi Dolok Tusam Barat dengan populasi 80 Dolok Tusam Timur. Hal ini menunjukkan bahwa antara populasi Dolok Tusam Barat dengan Dolok Tusam Timur memiliki tingkat kekerabatan yang paling dekat dibanding dengan ketiga populasi yang lain. Adapun nilai jarak genetik tertinggi (0.6572) ditemukan pada hubungan antara populasi Tolang dengan Dolok Tusam Barat. Hal ini menandakan bahwa antara populasi Tolang dengan Dolok Tusam Barat memiliki tingkat kekerabatan yang paling jauh dibanding dengan ketiga populasi alam P. merkusii strain Tapanuli yang lainnya. Semakin dekat kekerabatan dua populasi maka kedua populasi tersebut semakin banyak memiliki kesamaan dalam hal struktur genetiknya. Demikian juga sebaliknya, semakin jauh kekerabatan dua populasi maka struktur genetik diantara kedua populasi itu pun akan semakin banyak perbedaannya. Selanjutnya mengacu pada hasil analisis kelompok, dapat diketahui bahwa lima populasi P. merkusii strain Tapanuli yang diteliti dibagi menjadi 2 kelompok besar. Kelompok pertama menempatkan populasi Dolok Tusam Timur dan Dolok Tusam Barat ke dalam satu kelompok. Adapun kelompok kedua, menempatkan populasi Parinsoran dan Tolang ke dalam sub kelompok pertama, dan populasi Lobugala ke dalam kelompok sendiri. Berdasarkan analisis kelompok ini, dapat diketahui ternyata populasi Lobugala merupakan populasi P. merkusii strain Tapanuli yang memiliki struktur genetik paling berbeda dengan struktur genetik keempat populasi lainnya. Perbedaan struktur genetik populasi Lobugala kemungkinan terjadi sebagai dampak dari proses adaptasi populasi P. merkusii strain Tapanuli terhadap kondisi tapak tumbuhnya. Berdasarkan analisis kelompok ini juga diketahui ternyata kedekatan dua populasi tidak ditentukan oleh kedekatan jarak geografisnya, melainkan dikarenakan kedekatan struktur genetiknya. Hal ini nampak pada penempatan populasi Parinsoran yang satu kelompok dengan populasi Tolang. Kedua populasi ini berada pada jarak geografis yang jauh tetapi ternyata memiliki struktur genetik yang berdekatan. Hasil dari analisis pengelompokan tersebut juga dapat digunakan sebagai dasar untuk pemilihan sumber materi genetik untuk keperluan pemuliaan ataupun untuk kepentingan pembudidayaan. Mengacu pada nilai keragaman genetik dan nilai jarak genetik maka dapat dinyatakan bahwa populasi Dolok Tusam Barat dan 81 Dolok Tusam Timur merupakan populasi yang cocok dijadikan untuk lokasi pengambilan sumber pengambilan materi genetik P. merkusii strain Tapanuli. Karenanya keberadaan tegakan alam P. merkusii strain Tapanuli di kawasan hutan lindung Dolok Tusam Barat dan Dolok Tusam Timur perlu dilestarikan. Sub-topik Penelitian 3 Analisis Kandungan Biomassa Karbon Tegakan Alam P. merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli – Sumatera Utara Hasil Informasi mengenai distribusi diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam kawasan hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat diperlukan sebagai acuan untuk menentukan distribusi diameter dari pohon-pohon yang akan ditebang untuk kegiatan destructive sampling. Distribusi diameter tersebut disusun dengan menggunakan data-data diameter hasil inventarsiasi tegakan alam P. merkusii strain Tapanuli yang ada di dalam kluster plot pengamatan, seperti disajikan di dalam lampiran 3. Mengacu pada data hasil inventarisasi tersebut dapat diketahui bahwa kerapatan tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat relatif sama. Di dalam kluster plot Dolok Tusam Timur terdapat 47 pohon P. merkusii strain Tapanuli dengan rentang diameter antara 12.4 cm hingga 120.6 cm. Adapun di dalam kluster plot Dolok Tusam Barat terdapat 43 pohon P. merkusii strain Tapanuli dengan rentang diameter antara 30 cm hingga 98 cm. Selanjutnya data-data diameter tersebut didistribusikan ke dalam kelas diameter dengan interval 10 cm seperti disajikan pada Lampiran 3. Secara keseluruhan pola sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat ditampilkan dalam grafik pada Gambar 21. Berdasarkan grafik sebaran kelas diameter tersebut dapat diketahui bahwa pohon-pohon P. merkusii strain Tapanuli dengan diameter 40 hingga 79,9 cm banyak ditemukan di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam 82 Barat. Pola Sebaran kelas diameter seperti tergambarkan dalam grafik inilah yang selanjutnya digunakan sebagai acuan untuk menentukan sebaran kelas diameter pohon-pohon P. merkusii strain Tapanuli yang akan ditebang untuk destructive sampling. 18 16 5 14 2 Jumlah 12 9 10 9 8 3 12 6 HL DT Barat 11 6 4 6 5 2 0 HL DT Timur 0 2 0 0 6 6 2 1 1 1 0 2 0 1 0 Kelas diameter (cm) Gambar 21 Grafik sebaran kelas diameter tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat. Jumlah pohon yang ditebang untuk destructive sampling dalam penelitian ini sebanyak 36 pohon. Seperti tersaji pada Gambar 21 maka ketiga puluh enam pohon yang ditebang untuk destructive sampling tersebut harus dapat mewakili setiap kelas diameter pohon yang berhasil didata dari hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat, yakni mulai dari kelas diameter 10-19,9 cm hingga 120-129.9 cm. Mengingat status kawasan Dolok Tusam Timur dan Dolok Tusam Barat merupakan kawasan hutan negara untuk pemenuhan fungsi lindung atau Hutan Lindung maka tegakan alam P. merkusii strain Tapanuli yang telah diinventarisir tersebut tidak boleh ditebang. Sehubungan dengan hal ini, maka kegiatan destructive sampling dilakukan pada lahan milik warga dengan sebaran diameter pohon P. merkusii strain Tapanuli mengikuti pola sebaran kelas diameter P. merkusii strain Tapanuli yang ada di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat (Gambar 21). 83 Berdasarkan hasil inventarisasi tegakan alam P. merkusii strain Tapanuli pada lahan milik warga, sebanyak 36 batang pohon dengan rentang diameter 1382 cm telah berhasil dipilih untuk kegiatan destructive sampling. Dengan demikian ada empat kelas diameter dari struktur tegakan alam P. merkusii strain Tapanuli yang ada di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat yang belum terwakili oleh kelas diameter dari 36 batang pohon yang ditebang untuk destructive sampling. Hal ini terjadi karena keterbatasan jumlah pohon P. merkusii strain Tapanuli milik warga yang berdiameter besar. Pada umumnya diameter batang pohon P. merkusii strain Tapanuli milik warga berkisar antara 20-60 cm. Untuk memenuhi keterwakilan dari semua kelas diameter yang ada pada kawasan hutan lindung Dolok Tusam maka jumlah sampel untuk penyusunan persamaan allometrik perlu ditambah, terutama dari kelas diameter besar. Terkait dengan hal tersebut maka dilakukan pendekatan volumetrik, yakni pengukuran biomassa pohon P. merkusii strain Tapanuli yang dihitung dari nilai kerapatan jenis kayunya dikalikan dengan volumenya. Melalui pendekatan volumetrik, tegakan alam P. merkusii strain Tapanuli yang memiliki diameter besar tidak perlu ditebang, namun cukup diambil sampel kayunya untuk dianalisis kerapatan jenis kayunya. Mengacu pada pola sebaran kelas diameter pada tegakan alam P. merkusii strain Tapanuli yang tumbuh di dalam hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat maka ada tambahan delapan sampel yang diukur biomassanya dengan pendekatan volumetrik. Kedelapan sampel tambahan tersebut memiliki sebaran diameter sebagai berikut: 75 cm, 79.5 cm, 86 cm, 95 cm, 104 cm, 110.9 cm, 115.5 cm, dan 120..6 cm. Gambar 22 menyajikan grafik sebaran kelas diameter dari tiga sumber data yang berbeda yakni: a). Sebaran kelas diameter hasil dari kegiatan inventarisasi tegakan alam P. merkusii strain Tapanuli yang ada di hutan lindung Dolok Tusam Timur dan Dolok Tusam Barat (grafik dengan garis berwarna biru), b). Sebaran kelas diameter dari 36 sampel pohon yang akan digunakan untuk destruvtive sampling (grafik dengan garis berwarna merah), c). Sebaran kelas diameter sebagai hasil dari kompilasi antara 36 sampel destructive sampling + 8 sampel volumetrik (grafik dengan garis berwarna hijau). Seperti nampak pada Gambar 84 22 sebaran kelas diameter untuk 36 sampel destructive sampling dan 8 sampel untuk pendekatan volumetrik secara garis besar memiliki pola grafik yang sama dengan sebaran kelas diameter hasil inventarisasi dari hutan lindug Dolok Tusam Timur dan Dolok Tusam Barat. 18 16 Jumlah pohon 14 12 10 8 Inventory 6 Destructive 4 Destructive + 8 2 0 Sebaran Diameter (cm) Gambar 22 Perbandingan pola sebaran diameter antara hasil inventori plot di hutan lindung Dolok Tusam (warna biru) dengan 36 pohon untuk destructive sampling (warna merah) serta 44 pohon untuk modifikasi destructive sampling + volumetrik hijau). kluster sampel sampel (warna Distribusi Biomassa P. merkusii Strain Tapanuli Hasil Destructive Sampling Sebanyak 36 pohon P. merkusii strain Tapanuli ditebang untuk pelaksanaan metode destructive sampling. Hasil pengukuran dimensi pohon dan biomassanya secara terperinci disajikan pada Lampiran 4. Mencermati data biomassa tersebut, dapat diketahui bahwa secara keseluruhan rata-rata biomassa yang dialokasikan ke bagian atas tanah adalah sebesar 77.32%, sedangkan sisanya sebesar 22.68% dialokasikan untuk biomassa di bawah tanah (akar). Selanjutnya dari 77.32% biomassa bagian atas tanah tersebut, sebanyak 57.88% dialokasikan ke batang, 12.87% dialokasikan ke cabang, 3.74% dialokasikan ke ranting, 2.83% dialokasikan ke daun, dan 0.01% dialokasikan ke buah. Sebaran alokasi biomassa pada masing-masing pohon dari tiga puluh enam pohon P. merkusii strain Tapanuli yang ditebang dalam destructive sampling, secara visual tergambarkan dalam Grafik yang ditampilkan pada Gambar 23. 85 Seperti tampak pada Gambar 23, sebagian besar biomassa dialokasikan ke batang dengan kisaran 38.02–82.25%. Akar merupakan bagian pohon yang mendapatkan alokasi biomassa terbesar kedua setelah batang yakni berkisar antara 9.5836.71%. Adapun alokasi biomassa untuk bagian pohon yang lain sebagai berikut: cabang (1.39-28.35%), ranting (1.49-8.20%), daun ( 1.36-6.67%) dan buah (0.030.11%). 100,00% 80,00% Persentase (%) 60,00% 40,00% 20,00% 82,0 76,0 74,0 72,0 65,3 63,0 62,0 61,0 59,5 57,0 55,2 54,5 53,0 50,0 48,0 47,0 45,0 44,1 43,0 41,3 40,5 39,0 38,4 36,5 34,3 32,7 30,5 29,1 27,2 26,0 25,0 23,0 20,0 19,3 17,0 13,0 0,00% Diameter (cm) Buah Gambar 23 Daun Ranting Cabang Batang Akar Grafik sebaran alokasi biomassa pada setiap bagian pohon dari 36 Pinus merkusii strain Tapanuli yang ditebang didalam kegiatan destructive sampling 86 Mengacu pada data biomassa hasil dari kegiatan destructive sampling tersebut dapat diketahui juga nisbah pucuk akar yang cenderung mengalami penurunan seiring dengan peningkatan diameter batang. Nilai nisbah pucuk akar dari ketiga puluh enam pohon P. merkusii strain Tapanuli yang ditebang tersebut rata-rata bernilai 4.1 dengan nilai nisbah pucuk akar terkecil 1.7 dan terbesar 9.4. Selain itu, juga dapat diketahui nilai kerapatan jenis kayu dan nilai perbandingan antara biomassa total dengan biomassa batang atau dikenal dengan istilah nilai Biomassa Ekspansion Factor (BEF) dari 36 pohon P. merkusii strain Tapanuli yang ditebang tersebut. Nilai kerapatan jenis kayu dari P. merkusii strain Tapanuli yang ditebang tersebut rata-rata 0.479 g/cm3. Adapun nilai BEF dari P. merkusii strain Tapanuli yang ditebang tersebut berkisar antara 1.22- 2.63 dengan nilai rata-rata 1.78. Persamaan Allometrik Biomassa Bagian Atas, Bagian Bawah dan Total P. merkusii Strain Tapanuli Persamaan allometrik untuk pendugaan kandungan biomassa karbon pada tegakan alam P. merkusii strain Tapanuli ini menggunakan dua input data yang berbeda. Input data pertama, merupakan data biomassa hasil destructive methode terhadap 36 pohon contoh P. merkusii strain Tapanuli. Hasil pengukuran biomassa bagian atas, bawah, dan total dari P. merkusii yang dijadikan sebagai pohon contoh tersebut disajikan pada Lampiran 3. Biomassa bagian atas (above ground biomass) tersebut merupakan penjumlahan dari biomassa batang, cabang, ranting, daun, dan buah dari P. merkusii strain Tapanuli yang diteliti, sedangkan biomassa bagian bawah tanah (below ground biomass) adalah biomassa akar dari pohon P. merkusii strain Tapanuli. Data biomassa tersebut di dalam penyusunan persamaan allometrik digunakan sebagai peubah tak bebas Y. Adapun untuk peubah X nya, ada 4 model peubah yakni: a). Diameter, b). Diameter x Tinggi, c). Diameter x Kerapatan Jenis Kayu, dan d). Diameter x Kerapatan Jenis Kayu x Tinggi. Input data kedua, merupakan data biomassa hasil modifikasi antara metode destructive sampling dengan metode volumetrik. Input data kedua ini terdiri atas 36 data biomassa dari hasil destructive methode P. merkusii strain Tapanuli ditambah dengan 8 data biomassa P. merkusii strain Tapanuli yang dihitung dari 87 pendekatan volumetrik. Data biomassa yang digunakan sebagai peubah Y dan beberapa parameter yang digunakan sebagai peubah X untuk penyusunan persamaan allometrik ini disajikan pada Lampiran 5. Model persamaan allometrik yang dihasilkan dari dua sumber data tersebut masing-masing disajikan pada Tabel 21 dan Tabel 22 di bawah ini. Tabel 21 Model persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli yang diolah dari 36 data biomassa pohon hasil destructive sampling No Peubah bebas (X) Peubah tak bebas (Y) Model Persamaan R2 R2adj RMSE Y=aXb 1. Diameter Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.2222 X2.3035 Y = 0.1678 X2.3085 Y = 0.0239 X2.4864 0.96620 0.96890 0.85080 0.965251 0.967960 0.846370 0.199183 0.191416 0.481772 2. Diameter x Tinggi Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0057 X1.7622 Y = 0.0039 X1.7787 Y = 0.0006 X1.853 0.94460 0.96080 0.78930 0.943007 0.959629 0.783086 0.255089 0.214865 0.572462 3. Diameter x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 2.0815 X2.1242 Y = 1.5401 X2.1373 Y = 0.2971 X2.2578 0.94840 0.95860 0.80980 0.946903 0.957351 0.804158 0.246216 0.220843 0.543946 4. Diameter x Tinggi x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0361X1.6751 Y = 0.0245 X1.6954 Y = 0.0051 X1.7417 0.94320 0.96470 0.77060 0.941511 0.963618 0.763832 0.258415 0.203974 0.597328 Tabel 22 Model persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli yang diolah dari 44 data biomassa pohon hasil modifikasi destructive sampling + volumetrik No Peubah bebas (X) Peubah tak bebas (Y) Model Persamaan Y=aXb R2 R2adj RMSE 1. Diameter Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.2451X2.2757 Y = 0.1900X2.2730 Y = 0.0283X2.4393 0.97840 0.97980 0.90240 0.977900 0.979317 0.900094 0.183996 0.177670 0.436644 2. Diameter x Tinggi Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0093X1.6885 Y = 0.0069X1.6931 Y = 0.001X1.7824 0.96330 0.97220 0.86170 0.962397 0.971534 0.858445 0.240009 0.208435 0.519749 3. Diameter x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 2.4771X2.0604 Y = 1.8885X2.0625 Y = 0.3591X2.1887 0.96620 0.97180 0.87520 0.965382 0.971086 0.872239 0.230288 0.210070 0.493776 4. Diameter x Tinggi x Kerapatan kayu Total Biomassa Biomassa atas tanah Biomassa bawah tanah Y = 0.0648X1.5754 Y = 0.0477X1.5820 Y = 0.0085X1.6531 0.96020 0.97190 0.84870 0.959284 0.971200 0.845086 0.249748 0.209654 0.543721 88 Berdasarkan perbandingan nilai R2, R2adj dan RMSE dapat diketahui bahwa persamaan allometrik nomor 1 pada Tabel 20 (dibentuk dari 36 data biomassa hasil destructive sampling + 8 data biomassa dari pendekatan volumetrik) dengan diameter sebagai peubah bebas X memiliki nilai R2 terbesar, R2adj terbesar dan nilai RMSE terkecil dibanding persamaan allometrik lainnya. Hal ini menunjukkan bahwa persamaan allometrik terbaik untuk pendugaan biomassa karbon P. merkusii strain Tapanuli adalah persamaan yang disusun dari 1 peubah bebas X yakni diameter setinggi dada (DBH). Model persamaan allometrik terbaik untuk pendugaan biomassa total P. merkusii strain Tapanuli adalah Y = 0.2451(DBH)2.2757 dengan R2 = 0.97840, Radj = 0.977900, RMSE = 0.183996. Persamaan allometrik untuk pendugaan biomassa atas tanah P. merkusii strain Tapanuli adalah Y = 0.1900(DBH)2.2730 dengan R2 = 0.97980, Radj = 0.979317, RMSE = 0.177670. Adapun persamaan allometrik untuk pendugaan biomassa P. merkusii strain Tapanuli bawah tanah adalah Y = 0.0283(DBH)2.4393 dengan R2 = 0.90240, Radj = 0.900094, RMSE = 0.436644. Grafik persamaan allometrik terbaik untuk pendugaan biomassa P. merkusii strain Tapanuli disajikan pada Gambar 24. 16000.0 Y = 0.2451(DBH)2.2757 R² = 0.9784 14000.0 Biomassa (Kg) 12000.0 AGB 10000.0 BGB Y = 0.19(DBH)2.273 R² = 0.9798 8000.0 TB 6000.0 Power (AGB) Y = 0.0283(DBH)2.4393 R² = 0.9024 4000.0 2000.0 0.0 0.0 20.0 40.0 60.0 80.0 100.0 120.0 140.0 Diameter (cm) Gambar 24 Grafik model persamaan allometrik terbaik untuk pendugaan biomassa Pinus merkusii strain Tapanuli. 89 Perbandingan Persamaan Allometrik Terpilih (Hasil Penelitian) dengan Persamaan Allometrik yang Sudah Ada Persamaan allometrik yang terpilih tersebut selanjutnya dibandingkan dengan persamaan allometrik yang disusun oleh Siregar (2007) untuk pendugaan biomassa total P. merkusii yang tumbuh di Cianten – Jawa Barat. Perbandingan kedua persamaan ini dilakukan untuk melihat keeratan kedua persamaan di dalam menduga kandungan biomassa total jika dibandingkan dengan biomassa total aktual (hasil pengukuran dari destructive sampling). Secara sederhana, perbandingan kedua persamaan allometrik tersebut dilakukan dengan cara memasukkan nilai diameter setinggi dada (DBH) ke dalam persamaan allometrik Cianten (Y=0.1031(DBH)2.4587) dan Tapanuli (Y = 0.2451(DBH)2.2757 ) dan membandingkan hasilnya dengan nilai berat biomassa total hasil pengukuran dari kegiatan destructive sampling. Grafik yang menunjukkan perbandingan antara nilai dugaan biomassa total yang dihasilkan dari persamaan allometrik Cianten dengan persamaan Tapanuli disajikan pada Gambar 25 di bawah ini. 6000.00 Y = 0.2451(DBH)2.2757 Pinus - Tapanuli Y= 0.1031(DBH)2.4587 Pinus - Cianten Berat Biomassa (Kg) 5000.00 4000.00 Berat Aktual 3000.00 Cianten Tapanuli 2000.00 1000.00 0.00 0.0 20.0 40.0 60.0 Diameter (cm) 80.0 100.0 Gambar 25 Grafik perbandingan antara nilai dugaan biomassa P. merkusii strain Tapanuli antara persamaan allometrik Tapanuli dengan persamaan allometrik Cianten 90 Persamaan allometrik P. merkusii – Cianten menghasilkan nilai dugaan biomassa total dengan simpangan total dan rata-rata terhadap nilai aktual biomassa total masing-masing sebesar -8119.09 kg dan -225.53 kg. Adapun simpangan total dan rata-rata yang dihasilkan dari persamaan allometrik P. merkusii – Tapanuli masing-masing sebesar -784.11 kg dan -21.78 kg. Berdasarkan nilai simpangan total dan rata-rata tersebut, secara umum dapat dinyatakan bahwa persamaan allometrik Cianten lebih tepat digunakan untuk menduga biomassa tegakan P. merkusii dengan diameter kecil (di bawah 40 cm), sedangkan persamaan allometrik hasil penelitian ini lebih tepat digunakan untuk menduga biomassa tegakan P. merkusii yang memiliki kisaran diameter besar hingga diameter 120 cm. Hasil perbandingan antara nilai dugaan yang dihasilkan dari persamaan allomterik Pinus-Cianten dengan nilai dugaan hasil dari persamaan Pinus- Tapanuli disajikan pada Lampiran 6. Analisis Kandungan Biomassa Karbon pada Lima Populasi Alam P. merkusii strain Tapanuli yang Tumbuh pada Ekosistem Daratan Tapanuli – Sumatera Utara Persamaan allometrik terpilih tersebut selanjutnya digunakan untuk menghitung potensi kandungan biomassa total dan karbon pada tegakan P. merkusii strain Tapanuli yang tumbuh pada lima lokasi sebaran alaminya di Tapanuli – Sumatera Utara. Analisis diawali dengan menghitung kandungan biomassa total tegakan P. merkusii strain Tapanuli kemudian mengalikannya dengan nilai devault 0.5 sehingga kandungan karbonnya dapat diketahui seperti tersaji pada Tabel 23. Tabel 23 Kandungan biomassa total dan karbon P. merkusii strain Tapanuli serta di lima lokasi penelitian No Lokasi Biomassa (ton/ha) Atas Stok Karbon (ton C/ha) Total 143.9 Bawah (akar) 44.3 Kerapatan Pohon (pohon/ha) 187.8 117 Dolok Tusam Timur Parinsoran 287.8 Bawah (akar) 88.6 75.1 21.4 97.9 37.5 10.7 48.9 85 291.8 88.5 380.8 145.9 44.2 190.4 107 4 Dolok Tusam Barat Lobugala 142.9 41.9 186.4 71.5 21.0 93.2 90 5 Tolang 70.1 20.2 91.3 35.0 10.1 45.7 52 1 2 3 Total Atas 375.7 91 Berdasarkan data pada Tabel 23 dapat diketahui juga bahwa urutan lokasi dengan kandungan stok karbon mulai dari yang terendah ke yang tertinggi yaitu: Tolang, Parinsoran, Lobugala, Dolok Tusam Timur, dan Dolok Tusam Barat. Besarnya kandungan stok karbon tersebut sangat erat kaitannya dengan kerapatan tegakan alam P. merkusii strain Tapanuli pada setiap lokasi penelitian. Pembahasan Biomassa merupakan salah parameter penting yang perlu diamati didalam kegiatan penelitian yang terkait dengan aspek silvikultur, ekologi, dan fisiologi pohon. Berdasarkan pengolahan data biomassa, maka ada banyak aspek yang dapat dianalisis lebih dalam, antara lain produktivitas, kandungan unsur hara di dalam jaringan tanaman, kandungan biomassa karbon, dan sebaran kelas umur. Atas dasar inilah maka kegiatan pengukuran terhadap kandungan biomassa pada suatu pohon atau tegakan harus dapat dilakukan sesuai kaidah ilmiah yang benar sehingga diperoleh data yang akurat. Berdasarkan hasil sebaran biomassa pada tegakan alam P. merkusii strain Tapanuli dapat diketahui bahwa biomassanya menyebar secara tidak teratur seperti disajikan pada Gambar 23. Hal ini secara tidak langsung menandakan bahwa tegakan P. merkusii strain Tapanuli yang diteliti terdiri atas pohon-pohon dengan umur yang berbeda. Data ini secara tidak langsung dapat digunakan sebagai bukti bahwa populasi P. merkusii strain Tapanuli yang menyebar di daratan ekosistem Tapanuli benar-benar merupakan tegakan alam. Berdasarkan data pada Lampiran 4, dapat diketahui bahwa alokasi biomassa batang tidak menunjukkan pola pada umumnya tanaman yakni semakin bertambah diameter maka alokasi biomassa ke batang semakin besar (Zhang et al. 2005). Hal ini terjadi kemungkinan karena pengaruh dari keragaman umur, kerapatan, dan kualitas tapak dari pohon P. merkusii strain Tapanuli yang ditebang. Hal ini sebagaimana dinyatakan (Lambers et al. 1998) yang menyatakan bahwa keragaman alokasi biomassa pohon kemungkinan disebabkan oleh perbedaan umur tegakan, kerapatan, dan kualitas tapak, dikarenakan produksi daun dan bagian cabang sangat sensitif terhadap cahaya, air, unsur hara, serta kondisi tanah lainnya. 92 Selanjutnya berdasarkan perbandingan antara persamaan allometrik yang dihasilkan dari penelitian ini dengan persamaan allometrik hasil penelitian di Cianten secara umum dapat dinyatakan bahwa nilai dugaan biomassa yang dihasilkan dari persamaan hasil penelitian di Tapanuli ternyata lebih mendekati niai biomassa aktualnya (hasil destructive samping). Menurut Chave et al. (2005), Raison et al. (2009), perbedaan dua model persamaan allometrik secara garis besar terkait dengan perbedaan beberapa informasi yang perlu diperhatikan didalam penyusunan persamaan allometrik yakni jenis vegetasi yang diduga biomassanya (spesifik jenis, kelompok jenis, campuran jenis), metode sampling, jumlah dan keterwakilan pohon sampel, jumlah dan ukuran plot inventarisasi, dan koreksi bias dalam penerapan persamaan. Terkait dengan perbedaan 2 model persamaan allometrik tersebut, Krisnawati (2010) menyarankan agar persamaan allometrik seharusnya tidak digunakan untuk menduga biomassa di luar rentang data/ukuran pohon yang digunakan untuk menyusun persamaan. Hal ini perlu diperhatikan untuk mendapatkan nilai dugaan biomassa dengan tingkat keakuratan dan kevalidan yang tinggi. Selanjutnya berdasarkan data stok karbon pada Tabel 23, dapat diketahui bahwa lokasi dengan kerapatan pohon P. merkusii strain Tapanuli tinggi memiliki kandungan biomassa dan simpanan karbon lebih tinggi dibanding lokasi yang kerapatan pohonnya rendah. Dolok Tusam Timur dan Dolok Tusam Barat merupakan hutan lindung dengan kondisi tegakan alam P. merkusii strain Tapanuli dalam keadaan rapat dan memiliki dimensi pohon besar. Kondisi inilah yang menjadikan kedua lokasi tersebut memiliki kandungan biomassa dan simpanan karbon jauh lebih besar dibanding lokasi lainnya. Kandungan biomassa atas kedua lokasi tersebut sedikit di bawah rata-rata stok karbon pada daratan di kawasan tropis Asia yakni 185 ton C/ha (Iverson et al. 1993). Namun jika mengacu pada nilai devault dari biomassa atas pada hutan hujan tropis yang dikeluarkan oleh IPCC (2006), maka kandungan biomassa untuk lokasi Dolok Tusam Timur dan Dolok Tusam Barat termasuk tinggi, yakni mendekati nilai devault sebesar 300 ton/ha. 93 PEMBAHASAN UMUM Pinus merkusii merupakan satu-satunya jenis tumbuhan daun jarum yang penyebarannya mampu melewati lintang selatan khatulistiwa (Cooling 1968). Di Indonesia jenis ini menyebar secara alami di tiga lokasi yakni Takengon - Aceh, Tapanuli – Sumatera Utara, dan Kerinci – Sumatera Barat. Diantara ketiga populasi alam tersebut, hanya P. merkusii asal Aceh saja yang kini mengalami penyebaran cukup pesat hingga jauh melewati sebaran alaminya. Adapun penyebaran P. merkusii asal Tapanuli dan Kerinci, relatif masih stagnan di sekitar lokasi sebaran alaminya. Berdasarkan hasil analisis perubahan tutupan lahan, secara garis besar dapat diketahui bahwa tutupan hutan di lima lokasi sebaran alam P. merkusii strain Tapanuli yang diteliti relatif dalam kondisi stabil. Ada tiga lokasi yang kondisi tutupan hutannya relatif baik yakni Dolok Tusam Timur, Dolok Tusam Barat, dan Tolang. Kondisi ini terjadi kemungkinan sebagai dampak dari tercapainya kondisi klimaks pada struktur tegakan yang ada di tiga lokasi tersebut. Struktur tegakan alam P. merkusii strain Tapanuli yang mencapai klimaks tersebut secara umum mempengaruhi terhadap karakter regenerasi, struktur genetik, dan kandungan biomassa karbonnya. Berdasarkan hasil analisis struktur tegakan, dapat diketahui bahwa karakter regenerasi alam pada lokasi dengan tutupan hutan lebat (Dolok Tusam Barat, Dolok Tusam Timur, dan Tolang) secara umum memang menunjukkan kurva J terbalik yang merupakan salah satu ciri bentuk struktur tegakan di hutan alam (Lamprecht 1989). Namun jika dirinci lebih lanjut berdasarkan tingkat perkembangan pohonnya maka dapat diketahui adanya ketimpangan di dalam struktur tegakan populasi alam P. merkusii strain Tapanuli tersebut, yaitu jumlah anakan P. merkusii strain Tapanuli sangat rendah pada sebaran alaminya. Sebaliknya untuk jenis lain, jumlah anakannya relatif lebih banyak dibanding P. merkusii strain Tapanuli. Kondisi ini tentu akan menjadi salah satu faktor penghambat berkembangnya anakan alami yang tumbuh di dalam hutan. Akibatnya anakan alam P. merkusii strain Tapanuli yang sempat muncul, dalam perkembangannya tidak mampu bersaing dengan jenis non pinus. 94 Hal ini sekaligus menjawab bentuk struktur tegakan P. merkusii strain Tapanuli yang sedikit atau bahkan tidak ada jumlah pancang dan tiangnya. Berdasarkan hasil analisis pengelompokan secara genetik, dapat diketahui bahwa lokasi dengan tingkat kerapatan tutupan hutan yang relatif sama akan berada pada kelompok yang sama. Karenanya, lokasi Dolok Tusam Barat dan Dolok Tusam Timur yang relatif memiliki tingkat penutupan hutan paling rapat, berada pada kelompok yang sama. Sebaliknya untuk lokasi Lobugala dengan tingkat tutupan hutan terendah, berada pada kelompok tersendiri. Kemudian untuk lokasi Parinsoran dan Tolang yang memiliki tingkat tutupan hutan relatif sama, berada pada satu kelompok genetik yang sama. Berdasarkan analisis pengelompokan genetik dapat diketahui juga ternyata lokasi dengan tingkat fragmentasi yang sama secara genetik akan mengelompok dalam kelompok yang sama. Kelompok pertama adalah untuk lokasi yang tidak terfragmentasi yakni Dolok Tusam Timur dan Dolok Tusam Barat. Kemudian kelompok kedua adalah untuk lokasi yang terfragmentasi yakni Tolang, Parinsoran, dan Lobugala. Untuk kelompok yang terfragmentasi ini, dibagi menjadi dua sub kelompok. Sub kelompok pertama adalah untuk lokasi yang tingkat fragmentasinya menengah yakni Parinsoran dan Tolang, dan sub kelompok kedua adalah lokasi yang paling terfragmentasi yakni Lobugala. Berdasarkan data stok karbon pada Tabel 23, dapat diketahui bahwa secara garis besar berdasarkan jumlah stok karbonnya, kelima lokasi penelitian dapat dikelompokkan menjadi tiga. Kelompok pertama adalah Dolok Tusam Timur (stok karbon 187,8 ton C/ha) dan Dolok Tusam Barat (stok karbon 190.4 ton C/ha) yang memiliki kandungan stok karbon tinggi. Kelompok kedua adalah lokasi Lobugala dengan stok karbon 93.2 ton C/ha. Kelompok ketiga adalah lokasi Parinsoran ( stok karbon 48.9 ton C/ha) dan Tolang (stok karbon 45.7 ton C/ha). Pola pengelompokan stok karbon tersebut ternyata persis sama dengan pola pengelompokan berdasarkan kedekatan genetiknya. Hal ini secara tidak langsung mengindikasikan bahwa kemampuan suatu tegakan alam P. merkusii strain Tapanuli didalam menyerap karbon juga dipengaruhi oleh faktor genetik. Populasi alam yang berada pada kekerabatan genetik yang dekat akan memiliki stok karbon yang sama. Berdasarkan pengelompokan ini secara umum dapat dinyatakan 95 bahwa populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Timur dan Dolok Tusam Barat memiliki struktur genetik yang mampu menjadikan populasi ini memiliki stok karbon yang tinggi. Bertitik tolak dari uraian di atas, maka ada beberapa hal yang perlu diperhatikan untuk pengelolaan populasi alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara sebagai berikut: a. Untuk keperluan pelestarian materi genetik P. merkusii strain Tapanuli, maka lokasi Dolok Tusam Barat merupakan lokasi yang direkomendasikan untuk dijadikan sebagai sumber benih. b. Untuk keperluan pelestarian biomassa karbon, maka lokasi hutan lindung Dolok Tusam Barat dan Dolok Tusam Timur merupakan lokasi yang direkomendasikan untuk dijaga kelestariannya sehingga stok karbon yang ada saat ini tidak berkurang. c. Untuk keperluan kesinambungan regenerasi alam P. merkusii strain Tapanuli, maka Lobugala, Parinsoran, dan Tolang direkomendasikan sebagai lokasi untuk perbanyakan anakan alam P. merkusii strain Tapanuli. 96 97 SIMPULAN Berdasarkan hasil dan pembahasan pada bab sebelumnya, maka simpulan dari penelitian ini sebagai berikut: a. Berdasarkan hasil analisis perubahan tutupan lahan dapat diketahui kondisi tutupan hutan di lima lokasi penelitian relatif stabil. Bahkan di lokasi Lobugala, tutupan hutannya meningkat. Selanjutnya berdasarkan analisis sifat kimia tanah dapat diketahui kandungan karbon tanah di lima lokasi penelitian berkisar antara 46,1- 89 ton C/ha. Kandungan karbon tanah tertinggi ditemukan di Lobugala, sedangkan yang terendah di Parinsoran. Adapun berdasarkan analisis struktur tegakan dapat diketahui bahwa kelima lokasi penelitian mengalami defisit permudaan alam P. merkusii strain Tapanuli. b. Berdasarkan hasil analisis genetik dapat diketahui nilai heterosigositas harapan (He) pada lima populasi alam P. merkusii strain Tapanuli berkisar antara 0,3779 hingga 0,4693. Nilai He tertinggi dimiliki oleh populasi alam P. merkusii strain Tapanuli yang tumbuh di Lobugala, sedangkan yang terendah dimiliki oleh populasi alam Dolok Tusam Barat. Namun demikian, berdasarkan nilai heterosigositas aktualnya, hanya populasi alam P. merkusii strain Tapanuli yang tumbuh di Dolok Tusam Barat yang mengalami surplus heterosigositas. Selanjutnya berdasarkan kedekatan jarak genetiknya, kelima populasi alam P. merkusii strain Tapanuli mengelompok menjadi dua kelompok besar. Kelompok pertama terdiri atas populasi Dolok Tusam Timur dan Dolok Tusam Barat. Adapun kelompok kedua terdiri atas dua sub kelompok. Sub kelompok pertama terdiri atas populasi Parinsoran dan Tolang, sedangkan sub kelompok kedua hanya terdiri populasi Lobugala. c. Persamaan allometrik terbaik untuk pendugaan biomasa karbon P. merkusii strain Tapanuli menggunakan peubah bebas diameter setinggi dada (DBH) dengan model persamaan sebagai berikut: untuk pendugaan biomassa di bagian atas tanah adalah Y = 0,1900(DBH)2,2730 R² = 0,97980, R2adj=0,979317, RMSE=0,177670; untuk pendugaan biomassa akar adalah Y = 0,0283(DBH)2,4393 , R² = 0,90240, R2adj=0,900094 98 RMSE=0,436644; dan 2,2757 0,2451(DBH) untuk pendugaan biomassa total adalah Y= R² = 0,97840 R2adj= 0,977900 RMSE=0,183996. Stok karbon P. merkusii strain Tapanuli di 5 lokasi penelitian sbb: Dolok Tusam Timur 187,8 ton C/ha, Parinsoran 48,9 ton C/ha, Dolok Tusam Barat 190,4 ton C/ha, Lobugala 93,2 ton C/ha, dan Tolang 45,7 ton C/ha. SARAN Beberapa saran diajukan untuk menindaklanjuti hasil penelitian ini, sebagai berikut: a. Agar proses regenerasi populasi alam P. merkusii strain Tapanuli dapat terjadi secara lestari dan optimal maka di setiap lokasi sebaran alam P. merkusii strain Tapanuli perlu dibuat tempat khusus untuk pemeliharaan semai alam sehingga pertumbuhannya optimal. b. Agar potensi genetik P. merkusii strain Tapanuli tetap terjaga dengan baik maka populasi alam P. merkusii strain Tapanuli pada sebaran alaminya di Tapanuli – Sumatera Utara perlu dikelola lebih baik oleh pemerintah. c. Agar potensi kandungan karbon yang ada di dalam kawasan hutan lindung Dolok Tusam – Tapanuli Utara tetap terjaga dan terevaluasi secara kontinyu dengan tingkat keakuratan yang tinggi maka pemerintah perlu kembali menata dan memantapkan tata batas kawasan hutan lindung Dolok Tusam – Tapanuli – Sumatera Utara. 99 DAFTAR PUSTAKA Auckland L, Thomas B, Yi Z, Mervyn S, Claire W. 2002. Conifer Microsatellite Handbook. Texas A&M University. College Station. Texas. Angelsen A. 2009. Realising REDD+. National Strategy and Policy Options. CIFOR. Bogor . Arifin HS, Wulandari C, Pramukanto Q, Kaswanto RL. 2009. Analisis Lanskap Agroforestry. Bogor: IPB Press. Arifin HS, Nakagoshi N. 2011. Landscape ecology and urban biodiversity in tropical indonesian cities. J Landscape Ecol Eng 7:33-43. Brown S. 2002. Meassuring, Monitoring, and Verification of Carbon Benefits for Forest Based Projects. Phill. Trans. R. Soc.Lond . Brown S. 1997. Estimating Biomass and Biomass Change of Tropical Forests: a Primer. (FAO Forestry Paper - 134). FAO, Rome. Basuki TM, Adi RN, Sukresno. 2004. Informasi Teknis Stok Karbon Organik dalam Tegakan Pinus merkusii, Agatihis lorantifolia dan Tanah. Prosiding Ekspose BP2TPDAS-IBB Surakarta, 3 Agustus 2004. Burley J. 1976. Genetics Systems and Genetic Conservation of Tropical Pines. Dalam: Burley J. Dan B.T. Styles (Eds). Tropical Trees: Variation, Breeding and Conservation, Linn Soc. Symp. Series No.2. London- New York: Academic Press. Chave J, Andalo C, Brown S, Cairans MA, Chambers JQ, Folster H, Eamus D, Folster H, Fromard F, Huguchi N, Kira T, Lescure JP, Nelson WB, Ogawa H, Puig H, Riera B, Yamakura T. 2005. Tree allometry and improved estimation of carbon stocks and balance in tropical forests. J Oecologia 145: 87-99. Chen CR, Condroa LM, Davis MR, Scordock RR. 2000. Effects of afforestation on posphorus dynamics and bioligical properties in a New Zealand grassland soil. J Plant Soil 220: 151-163. Cooling ENG. 1968. Fast Growing Timber Trees of the Lowland Tropics No. 4. Pinus merkusii. Department of Forestry, University of Oxford, Commonwealth Forestry Institute, England. Devey ME, Fiddler T, Liu B, Knapp S, Neale D. 1994. An RFLP Linkage Map For Loblolly Pine Based Not A Three-Generation Outbreed Pedigree. J Theor.Appl.Genet. 00:656-662 . Echeverria C. 2011. How Landscape Change: Integration of Spatial Patterns and human Processes in Temperate Landscape of Southern Chile. J Applied Geography 32 : 822-831. Ellingson LJ, Kauffman JB, Cummings DL, Sanford RL, Jaramillo VJ. 2000 Soil N Dynamics Associated With Deforestation, Biomass Burning, and Pasture Conversion in a Mexican Tropical dry Forest. J Forest Ecology and Management 137 : 41-51. 100 Fandeli C. 1977. Beberapa Pinus yang Tumbuh di Asia Tenggara, Yogyakarta: Yayasan Pembina Fakultas Kehutanan – Universitas Gajah Mada. [FAO] Food and Agriculture Organization. 2010. Global Forest Resources Assessment. Main report. FAO Forestry Paper 163. Rome. 371 p. [FAO] Food and Agriculture Organization. 2000. Land Cover Classification Syatem. Geo Spatial Data And Information. Rome. Finkeldey R. 2005. Pengantar Genetika Hutan Tropis. E. Jamhuri , I.Z. Siregar, U.J. Siregar dan A.W. Kertadikara, penerjemah. Gottingen : Institute of Forest Genetics and Forest Tree Breeding Georg-August-UniverityGöttingen. Terjemahan dari : An Introduction to Tropical Forest Genetics Fitzsimmons MJ, Pennoek DJ, Thorpe J. 2003. Effects of Deforestation on Ecosystem Carbon Densites in Central Sasktachewan. J Forest Ecology and Management 188:349-361. Fitzsimmons M. 2001. Effects of Deforestation and Reforestation on Landsacape Spatial Structure in Boreal Saskatchewan. J Forest Ecology and Management 173:577-592. Forest Watch Indonesia. 2011. Potret Keadaan Hutan Indonesia Periode Tahun 2000-2009. Ed-Pertama. Foth HD. 1990. Fundamentals of Soil Science. Eight edition. United Stated of America: John Wiley & Sons. Guo LB, Gifford RM. 2002. Soil carbon stocks and land use change: a meta analysis. J Glob Chang Biol 8:345-360. Harahap RMS, Aswandi. 2008. Pengembangan dan Konservasi Tusam (Pinus merkusii) Strain Tapanuli dan Kerinci. http://restoreourforest.blogspot.com. pengembangan dan-konservasi-tusam-pinus.html (1 of 14)11/17/2008 5:22:50 AM. Harahap RMS. 2000a. Status Hutan Alam Pinus merkusii di Sumatera Saat Ini. Prosiding Seminar Nasional Sistem Silvikultur 1999: Peluang dan Tantangan Menuju Produktivitas dan Kelestarian Sumberdaya Hutan Jangka Panjang. Wanagama I, 1-2 Desember 1999. Editor: Eko B. Hariyanto. Fakultas Kehutanan – Universitas Gajah Mada. Yogyakarta. Harahap RMS. 2000b. Keragaman Sifat dan Data Ekologi Populasi Alami Pinus merkusii. Prosiding Seminar Nasional Sistem Silvikultur 1999: Peluang dan Tantangan Menuju Produktivitas dan Kelestarian Sumberdaya Hutan Jangka Panjang. Wanagama I, 1-2 Desember 1999. Editor: Eko B. Hariyanto. Fakultas Kehutanan – Universitas Gajah Mada. Yogyakarta. Harahap RMS. 2000c. Uji Asal Benih Pinus merkusii di Sumatera Utara. Prosiding Seminar Nasional Sistem Silvikultur 1999: Peluang dan Tantangan Menuju Produktivitas dan Kelestarian Sumberdaya Hutan Jangka Panjang. Wanagama I, 1-2 Desember 1999. Editor: Eko B. Hariyanto. Fakultas Kehutanan – Universitas Gajah Mada. Yogyakarta. 101 Harahap RMS, Mukti A. 1976. Pengamatan strobli dan percobaan orientasi penyerbukan terkendali dan tanpa pelindung. Laporan Nomor 237. Bogor: Lembaga Penelitian Hutan. Hardiyanto EB, Danarto S. 2000. Ex situ Conservation of Pinus merkusii in Java, Indonesia. Dalam: Proceeding of the International Conference on Ex situ and In situ Conservation of Commercial Tropical Trees. 11-13 June 2001. Yogyakarta Husaeni EA. 1996. Hama Hutan di Indonesia. Kerjasama Proyek Pendidikan dan Latihan dalam Rangka Pengindonesiaan Tenaga Kerja Pengusahaan Hutan dengan Fakultas Kehutanan. Bogor: Institut Pertanian Bogor. Indrioko S. 1996. Studi Variasi Genetik Pinus merkusii Jungh et de Vriese di Pulau Jawa dengan Analisis Isozim [Tesis S2]Bogor: Program Pascasarjana Universitas Gadjah Mada; 1996. [IPCC] Intergovernmental Panel on Climate Change. 2003. Good Practice Guidance for Land Use, Land-Use Change and Forestry. Intergovernmental Panel on Climate Change National Greenhouse Gas Inventories Programme. www.ipcc-nggip.iges.or.jp/lulucf/gpglulucf_unedit.htmlTH [IPCC] Intergovernmental Panel on Climate Change . 2006. Agriculture, forestry and other land use . In: Eggleston HS, Buendia L, Miwa K, Ngara T, Tanabe K. (Eds.). IPCC Guidelines for National Greenhouse Gas Inventories, Prepared by the National Greenhouse Gas Inventories Programme. IGES. Japan. [ITTO] International Tropical Timber Organization. 2011. ITTO. Status of Tropical Forest Management 2011. ITTO Technical Series No 38. Prepared by J. Blaser, A. Sarre. [ITTO] International Tropical Timber Organization. 2009. Guidelines for the Conservation and Sustainable Use of Biodiversity in Tropical Timber Production Forests. ITTO Policy Development Series No 17. [ITTO] International Tropical Timber Organization. 2002. ITTO guidelines for the restoration, management and rehabilitation of degraded and secondary tropical. [ITTO] International Tropical Timber Organization. 1997. Guidelines for Fire Management in Tropical Forests. ITTO Policy Development Series No 6. [ITTO] International Tropical Timber Organization. 1997. Guidelines for Fire Management in Tropical Forests. ITTO Policy Development Series No 6. [ITTO] International Tropical Timber Organization. 1993. Guidelines for the establishment and sustainable management of planted tropical forests. Iverson RI, Brown S, Grainger A. 1993. Carbon Sequestration in Tropical Asia: an Assessment of Technically Suitable Forest Lands Using Geographic Information Systems Analysis. J Climate Research 3: 23-38. [IUCN] International Union for Conservation of Nature and Natural Resources . 2012. Conifer Specialist Group 2000. Pinus merkusii. IUCN Red List of Threatened Species. Version 2011.1.[terhubung berkala]. http://www.iucnredlist.org. [27 Sept 2012]. 102 [JIFRO] Japan International Forestry Consultants Assosiation . 2000. Manual of Biomass Measurements in Plantation and in Regenerated Vegetation. Japan. Karhu A. 2001. Evolution and application of pine microsatellites. [Desertation]. Linnanmaa: Faculity of Science University of Oulu.2001. Kartikawati NK. 1998. Studi variasi genetik Tusam (Pinus merkusii Jungh et de Vriese) pada hutan alam di Aceh dan hutan tanaman di Jawa dengan Metode Analisis Isozim. [Tesis] S2. Yogyakrata : Program Pascasarjana – Universitas Gadjah Mada. Kartikawati NK. 1996. Pewarisan pola berkas jaringan megagametofit pinus merkusii jungh et de vriese dengan menggunakan metode isozim. [Skripsi]. Yogyakarta Fakultas Kehutanan Universitas Gadjah Mada. Kartikawati NK, Na'iem M. 1999. Study of genetic variation of Pinus merkusii natural and plantation forest using Isozyme Technique. J Agrosains 12 (1), Januari 1999. [Kemenhut] Kementrian Kehutanan. 2010. Statistik Kehutanan. Planologi Kehutanan. Jakarta: Departemen Kehutanan RI. Koskela J, Kuusipalo J, Sirikul W. 1995. Natural regeneration dynamics of pinus merkusii in northern thailand. J Forest Ecology and Management 77 : 169- 179. Korner C, Asshof R, Bignucolo O, Hattenschwiler S, Keel SG, Ried SP, Pepin S, Siegwof RW, Zotz G. 2005. Carbon flux and growth in mature deciduous forest trees exposed to elevated CO2. J Science 309(5739) : 1360-1362. Krisnawati H. 2010. Status data Stok Karbon Dalam Biomas Hutan di Indonesia In: REDD+ & Forest Governance. Editor: N. Masripatin dan C. Wulandari. Pusat Penelitian dan Pengembangan Perubahan Iklim dan Kebijakan. Badan Penelitian dan Pengembangan Kehutanan – Kementerian Kehutanan Republik Indonesia. Kutil BL, Williams CG. 2001. Triplet repeat micro-satellites shared among hard and soft pines. J Of He-Redity 92:327-332 Lagercrantz U, Ellegren H, Andersson L. 1993. Abundance of various polymorphic microsatellite motifs differs between plants and vertebrates. J Nucleic Ac-Ids Research 21: 1111-1115. Lamb AFA, Cooling NG. 1967. Exploration, Utilization and Conservation of Low Altitute Tropical Pine Gene Resources. Food and Agriculture Organization of The United Nations. Rome. Lambers H, Chapin FS, Pons TL. 1998. Plant Physiological Ecology. Newyork: Spinger-Verlag. Lamprecht H. 1989. Silviculture in The Tropics. Tropical Forest Ecosystem and Their Tree Species – Possibilities and Methods for Their Long Term Utilization. Federal Republic of Germany: Technical Cooperation. Li YC, Korol AB, Fahima T, Beiles , Nevo E. 2002. Microsatellites: genomic distribution, putative functions and mutational mechanisms: a Review. J Mol. Ecol. 11: 2453-2465. 103 Lira PK, Tambosi LR, Ewers RM, Metzger JP. 2012. Land-use and land-cover in atlantic forest landscapes. J Forest Ecology and Management 278: 80-89. Mangold R. 1997. Forest Health Monitoring: Field Methods Guide. USDA Forest Service. NC 27709. USA: FHM Monitoring Program, Research Triangle Park. Munawar AA. 2002. Studi keragaman genetik tusam (pinus merkusii jungh et de vriese) di hutan alam tapanuli dan kerinci dengan analisis isozim serta implementasinya dalam konservasi [Tesis] Yogyaklarta:Program Pascasarjana, Universitas Gajah Mada. Myers N. 1996. The world’s forests: problems and potentials. J Environ. Conserv. 21: 156–168. Nurtjahjaningsih ILG, Saito Y, Lian CL, Tsuda Y, Ide Y. 2005. Development and characteristics of microsatellite markers in Pinus merkusii. J Molecular Ecology Notes 5: 552-553. Parfitt RL, Scott NA, Ross DJ, Salt GJ, Tate KR. 2003. Land use change effects on soil C and N transformation in soils of high N status: comparisons under indigenous forest, pasture, and pine plantation. J Biogeochemistry 66:203221. Pili R, Anfodillo T, Carrer M. 2006. Towards a functional and simplified allometry for estimating forest. J Forest Ecol Manag 237(1-3): 583-593 Pritchett WL. 1979. Properties and Management of Forest Soils, Chapter 11: Mycorrhizal: Forms And Function. Raison J, Waterworth R, Twomey A. 2009. Guidelines for evaluation and use of allometric equations and biomass C data sourced from the review of available information. Racmatsyah O, Haneda NF. 2007. Pengendalian Kutu Lilin pada Pinus merkusii secara kimia. Fakultas Kehutanan, Institut Pertanian Bogor dan Perum Perhutani. Ross DJ, Tate KR, Scott NA, Felthman CW. 1999. Land-use change effects on soil carbon, nitrogen, and phophorus pools and fluxes in three adjacent ecosystems. J Soil biol Biochm 31: 803-813. Salisbury FB, Ross CW. 1995. Fisiologi Tumbuhan, Jilid 2. Penerjemah: Diah RL, Sumaryono. Bandung :Penerbit ITB. Saroinsong F, Harashina K, Arifin H, Gandasasmita K, Sakamoto K. 2007. Practical application of a land resources information system for agricultural landscape planning. J Landscape and Urban Planning 79 :38-52. Scott LJ, Shepherd M, Dieters MJ, Nikles G, Henry RJ. 2001. Characteristic Of Microsatellites Loci In Araucaria Cunninghamii And Transfer To Related Species. Plant Systemic And Evolution. Sebben AM, Degen B, Azevedo VCR, Silva MB, de Lacerda AEB, Ciampi AY, Kanashiro M, Carneiro FS, Thompson I, Loveless MD. 2008. Modelling the long-term impacts of selective logging on genetic diversity and 104 demographic structure of four tropical tree species in the Amazon forest. J Forest Ecol Manag 254: 335–349 Siregar CA. 2011. Develop Forest Carbon Standard and Carbon Accounting System for Small-scale Plantation Based on Local Experinces. Indonesia’s Ministry of Forestry – International Tropical Timber Organization. RED-PD 007/09 Rev.2 (F). Siregar CA. 2007. Pendugaan Biomassa pada Tanaman Pinus (pinus merkusii jungh et de vriese) dan Konservasi Karbon Tanah Cianten, Jawa Barat. Ringkasan Hasil-hasil Penelitian. Bogor: Badan Litbang Kehutanan. Departemen Kehutanan RI. Siregar IZ, Hattemer HH. 1999. Genetic variation of Pinus merkusii Jungh et de vriese in Indonesia. Scientific paper at Deutscher Tropentag 1999 in Berlin, Session: Biodiversity and Development of Plant Genetic Resources. Smith J. 1963. Manual of Malayan Silviculture Part I – III. Malayan Forest Record No.23. Forest Research Institute, Kepong – Malaysia. Suhaendi H. 1988. Pendugaan parameter-parameter genetika-ekologi dari beberapa sifat kuantitatif dalam hutan tanaman Pinus merkusii Jungh et de vriese strain tapanuli dan strain Aceh [Disertasi] Bogor: Program Pascasarjana. Institut Pertanian Bogor;1988. Suhaendi H. 2005. Kajian konservasi Pinus merkusii strain Tapanuli di Sumatera. J Analisis Kebijakan Kehutanan 2(1) : 45-57. Suhendang E. 1995. Ukuran Kenormalan Pada Hutan Tidak Seumur. Di dalam: Penerapan Ekolable Di Hutan Produksi. Prosiding Simposium Penerapan Ekolable di Hutan Produksi; Jakarta, 10-12 Agustus 1995. hlm 249-263. Tan KH. 1993. Principles of Soil Chemistry. Second edition. New York: Marcell Dekker, Inc. Tisdale SL, Nelson WL, Beaton JD. 1985. Soil Fertility And Fertilizers. Fourth edition. United States of America : Macmillaan Publishing Company. Turner BL, Lambin EF, Reenberg A. 2007. Land change science special feature The emergence of land change science for global environmental change and sustainability. Proceedings of the National Academy of Sciences of the United States of America 104: 20672–20677. Turner MG, Pearson SM, Boistad P, Wear DN. 2003. Effects of land-cover change on spatial pattern of forest communities in the southern appalachian mountains (USA). J Landscape Echology 18: 449-464. Vendramin G, Hansen OK. 2005. Molecular markers for characterizing diversity in forest trees’ in ‘Conservation and management of forest genetic resources in Europe Te Geburek and J. Turok (eds) Arbora Publish-er, Zvolen ISBN 80-967088-1-3. Wang Z, Weber JL, Zhong G, dan Tanksley SD. 1994. Survey of plant short tandem dna repeats. J Theor. Appl. Gene. 88:1- 6. [WCFSD] World Commission on Forests and Sustainable Development. 1999. Sustainable Forest Management. Issues paper. 42 p. 105 Weising K, Nybom H, Wolff K, Kahl G. 2005. Repetitive DNA. In DNA Fingerprinting In Plants: Principles, Methods, And Applications. 2. ed. Boca Raton FL: Taylor & Francis. Xiang W, Liu S, Deng X, Shen A, Lei X, Tian D, Zhao M, Peng C. 2011. Generala allometric equation and biomass allocatioan of Pinus massoniana trees on a regional scale in southern China. J Eco Res 26: 697-711. Yafid B, Jafarsidik YS. 2005. Permudaan Pinus merkusii jungh et de vriese galur kerinci, potensi dan komposisi tegakan di kawasan bukit Tapan, Taman Nasional Kerinci Seblat. Info Hutan II (2):145-152. Zhang DX, Hewitt GM. 2003. Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. J Mol. Ecol 12:563-584. 106 Lampiran 1. Kondisi tutupan lahan pada ekosistem daratan Tapanuli pada tahun 1994, 2005, dan 2011 No Tutupan lahan Luas (Ha) Laju perubahan luas (Ha/tahun) Keterangan 2005 2011 1994-2005 2005-2011 1994-2011 79.743,64 78.570,98 -86,2 -195,4 -124,8 Menurun 84.393,23 85.097,75 52,27 117,4 75,3 Meningkat 800,46 1.268,61 33,97 78,0 49,5 Meningkat 164.937,33 164.937,33 1994 1. Hutan 80.692,25 2. Non Hutan 83.818,27 3. Log Over Area (LOA) 426,81 Jumlah 164.937,33 Lampiran 2. Kondisi tapak tumbuh tidak kering dan kering pada ekosistem daratan Tapanuli pada tahun 1994, 2005, dan 2011 No. 1. 2. 3. 4. 5. Kelas Kering Tidak Kering Kering Agak Kering Sangat Kering No Data (Awan) TOTAL Kelas kering Tidak kering Kering No Data (awan) Kelas kering Tidak kering Kering No Data (awan) 1994 (Ha) 114.600,36 44.080,34 6.214,99 41,64 0,00 164.937,33 2005 (Ha) 102.423,55 40.073,64 15.734,21 2.854,94 3.850,99 164.937,33 2011 (Ha) 105.492,27 26.039,78 5.455,48 1.708,51 26.241,29 164.937,33 Trend 1994 2005 2011 1994-2005 2005-2011 1994-2011 114600,36 102423,55 105492,27 -12176,81 -1106,98 3068,72 511,45 -9108,09 -535,77 50336,97 58662,79 33203,77 8325,82 756,89 -25459,02 -4243,17 -17133,20 -1007,84 0,00 3850,99 26241,29 3850,99 350,09 22390,30 3731,72 26241,29 1543,605 164937,33 164937,33 164937,33 1994 69,48% 30,52% 0,00% 100,00% 2005 62,10% 35,57% 2,33% 100,00% Trend 2011 1994-2005 2005-2011 63,96% -7,38% -0,67% 1,86% 20,13% 5,05% 0,46% -15,44% 15,91% 2,33% 0,21% 13,58% 100,00% 0,31% -2,57% 2,26% 1994-2011 -5,52% -10,39% 15,91% -0,32% -0,61% 0,94% 107 Lampiran 3. Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Lokasi : DOLOK TUSAM TIMUR Land Cover 1 2 3 Luas (Ha) 2.020,43 2020,43 1,81 9,74 4,72 1 2 3 4 16,27 2,35 165,44 49,59 30,96 DOLOK TUSAM TIMUR 2005 No Poligon Luas (Ha) 1 2.002,66 2.002,66 1 1,81 2 5,70 3 12,07 4 9,74 5 4,72 34,03 1 2,35 2 165,44 3 49,59 4 30,96 248,33 2285,03 248,33 2285,03 1994 Hutan Sub total LOA No Poligon 1 Sub total Non Hutan Sub total Jumlah Lokasi 2011 No Poligon 1 1 2 3 1 2 3 4 5 Luas (Ha) 1.990,70 1.990,70 36,98 1,45 4,72 43,15 2,35 165,44 2,85 49,59 30,96 251,18 2.285,03 : PARINSORAN Land Cover PARINSORAN 1994 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) No Poligon Luas (Ha) Hutan 1 197,60 1 197,60 1 195,58 2 0,02 2 0,02 2 0,02 3 728,39 3 709,42 3 659,31 Sub total 926,00 907,04 854,92 LOA 1 188,25 1 188,25 1 2,01 2 3,31 3 201,98 Sub total 188,25 188,25 207,31 Non Hutan 1 1.170,78 1 1.189,75 1 4,95 2 1.217,86 Sub total 1170,78 1189,75 1.222,81 Jumlah 2285,03 2285,03 2.285,03 Lokasi : DOLOK TUSAM BARAT Land Cover Hutan Sub total LOA Sub total Non Hutan Sub total Jumlah DOLOK TUSAM BARAT 1994 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) No Poligon Luas (Ha) 1 1.651,31 1 1.651,31 1 1.644,89 1651,31 1.651,31 1.644,89 1 10,62 1 10,62 1 17,04 10,62 10,62 17,04 1 134,63 1 134,63 1 134,63 2 488,46 2 488,46 2 488,46 623,10 623,10 623,10 2285,03 2285,03 2.285,03 108 Lokasi : LOBUGALA Land Cover Hutan Sub total LOA Sub total Non Hutan Sub total Jumlah Lokasi 1994 No Poligon Luas (Ha) 1 197,09 2 92,49 289,59 1 4,14 4,14 1 1.991,30 1991,30 2285,03 LOBUGALA 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) 1 197,09 1 201,24 2 92,49 2 92,49 289,59 293,73 1 4,14 4,14 1 1.991,30 1 1.991,30 1991,30 1.991,30 2285,03 2.285,03 : TOLANG – AEK BILAH Land Cover AEK BILAH 1994 2005 2011 No Poligon Luas (Ha) No Poligon Luas (Ha) No Poligon Luas (Ha) Hutan 1 1.640,69 1 1.610,92 1 1.583,17 2 0,69 Sub total 1640,69 1.611,61 1.583,17 LOA 1 4,57 1 2,79 2 6,60 2 6,90 3 6,60 4 2,82 5 3,09 6 2,87 Sub total 11,17 25,07 Non Hutan 1 214,91 1 214,91 1 226,35 2 418,26 2 458,51 2 450,44 Sub total 633,17 673,42 676,79 Jumlah 2285,03 2285,03 2.285,03 109 Lampiran 4. Kondisi penggunaan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Lokasi : DOLOK TUSAM TIMUR Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah Lokasi DOLOK TUSAM TIMUR 1994 2005 2011 No. Poligon Luas (Ha) No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 2.020,43 1 2.011,25 1 2.004,15 Sub Total 2.020,43 Sub Total 2.011,25 Sub Total 2.004,15 1 2,35 1 1,81 1 1,81 2 1,81 2 9,55 2 9,55 3 9,55 3 11,53 3 3,19 4 9,74 4 9,74 4 11,53 5 4,72 5 4,72 5 3,90 Sub Total 28,16 Sub Total 37,34 6 9,74 7 4,72 Sub Total 44,44 1 14,55 1 14,55 1 14,55 2 17,09 2 17,09 2 17,09 3 22,73 3 22,73 3 20,32 Sub Total 54,37 Sub Total 54,37 Sub Total 51,96 1 55,92 1 52,97 1 45,97 2 30,02 2 8,23 2 10,63 Sub Total 85,94 3 23,90 3 23,90 Sub Total 85,10 Sub Total 80,51 1 68,33 1 71,28 1 78,28 2 8,23 2 9,66 2 9,66 3 19,58 3 16,03 3 16,03 Sub Total 96,13 Sub Total 96,97 Sub Total 103,97 2.285,03 2.285,03 2.285,03 : DOLOK TUSAM BARAT Land Use Hutan Ilalang-semak Kebun Ladang Sawah DOLOK TUSAM BARAT 1994 2005 No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 1.651,31 1 1.651,31 Sub Total 1.651,31 Sub Total 1.651,31 1 16,93 1 13,73 2 10,62 2 10,62 3 15,94 3 4,63 4 65,84 4 15,94 5 13,73 5 65,73 Sub Total 123,06 6 11,91 7 4,25 Sub Total 126,80 1 110,36 1 97,87 2 69,83 2 19,89 Sub Total 180,19 Sub Total 117,76 1 33,24 1 35,58 2 35,62 2 105,73 3 4,89 3 41,62 4 114,23 4 58,23 Sub Total 187,98 Sub Total 241,16 1 2 3 Sub Total Jumlah 24,29 6,66 111,54 142,49 2.285,03 1 2 3 4 Sub Total 107,41 28,91 6,66 5,02 147,99 2.285,03 2011 No. Poligon Luas (Ha) 1 1.647,73 Sub Total 1.647,73 1 3,66 2 3,58 3 10,62 4 4,63 5 2,55 6 11,91 7 162,36 Sub Total 199,31 1 116,19 Sub Total 116,19 1 2 3 4 5 6 Sub Total 1 2 3 Sub Total 3,36 105,73 8,33 55,72 1,74 33,70 208,57 28,91 79,29 5,02 113,22 2.285,03 110 Lokasi : PARINSORAN Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah Lokasi PARINSORAN 1994 2005 2011 No. Poligon Luas (Ha) No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 197,60 1 197,60 1 197,60 2 0,02 2 0,02 2 712,44 3 728,39 3 728,39 Sub Total 910,03 Sub Total 926,00 Sub Total 926,00 1 5,87 1 8,45 1 66,74 2 1,39 2 5,13 2 31,09 3 2,46 Sub Total 13,59 3 2,23 4 1,69 4 22,62 5 4,56 5 14,40 6 13,13 6 15,53 7 7,14 7 3,76 Sub Total 36,24 8 7,71 Sub Total 164,08 1 232,84 1 77,40 1 77,40 Sub Total 232,84 2 190,69 2 176,40 Sub Total 268,08 Sub Total 253,79 1 165,64 1 106,08 1 23,10 2 22,35 2 22,35 2 106,08 3 188,25 3 188,25 3 48,01 Sub Total 376,24 Sub Total 316,68 4 5,93 5 22,35 Sub Total 205,47 1 82,84 1 113,03 1 117,52 2 630,86 2 647,65 2 634,13 Sub Total 713,70 Sub Total 760,68 Sub Total 751,65 2.285,03 2.285,03 2.285,03 : TOLANG – AEK BILAH Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah AEK BILAH 1994 2005 2011 No. Poligon Luas (Ha) No. Poligon Luas (Ha) No. Poligon Luas (Ha) 1 1.640,69 1 1.632,37 1 1.604,57 Sub Total 1.640,69 2 3,76 Sub Total 1.604,57 Sub Total 1.636,13 1 2,27 1 11,75 1 2,97 2 4,57 2 7,01 2 2,97 3 6,60 3 3,87 3 3,25 4 1,27 Sub Total 22,64 4 4,19 5 0,94 5 3,60 Sub Total 15,65 6 9,36 7 18,01 Sub Total 44,34 1 174,01 1 162,58 1 37,98 2 161,13 2 153,67 2 147,72 Sub Total 335,14 Sub Total 316,25 3 96,56 4 9,87 Sub Total 292,13 1 14,36 1 4,92 1 4,92 2 4,92 2 1,39 2 1,39 3 26,61 3 2,53 3 2,53 4 7,90 4 26,61 4 26,61 5 81,52 5 7,90 5 1,82 6 66,13 6 17,89 6 12,02 Sub Total 201,44 7 1,27 7 22,72 8 3,67 8 1,27 9 70,67 9 10,11 10 70,19 10 3,67 Sub Total 207,05 11 8,14 12 0,48 13 61,75 14 6,87 15 50,30 Sub Total 214,61 1 53,83 1 64,68 1 64,68 2 7,97 2 7,97 2 35,34 3 30,32 3 30,32 3 29,35 Sub Total 92,12 Sub Total 102,97 Sub Total 129,37 2.285,03 2.285,03 2.285,03 111 Lokasi : LOBUGALA Land Use Hutan Ilalang-semak Kebun Ladang Sawah Jumlah LOBUGALA 1994 2005 No. Poligon Luas (Ha) No. Poligon Luas 1 197,09 1 2 92,49 2 Sub Total 289,59 Sub Total 1 10,30 1 2 2,43 2 3 54,55 3 4 3,65 4 5 8,52 5 6 40,21 6 7 11,07 7 8 5,73 8 9 8,22 9 10 4,14 10 Sub Total 148,82 11 Sub Total 1 2 3 4 Sub Total 1 2 3 4 5 Sub Total 18,93 94,01 34,35 104,80 252,09 9,93 32,85 58,65 40,93 283,37 425,73 1 2 3 4 5 Sub Total 42,50 11,10 45,84 1.005,80 63,56 1.168,80 2.285,03 1 2 3 4 Sub Total 1 2 3 4 5 6 Sub Total 1 2 3 4 5 Sub Total 2011 (Ha) No. Poligon Luas (Ha) 201,24 1 201,24 92,49 2 92,49 293,73 Sub Total 293,73 10,30 1 2,49 2,43 2 12,23 17,44 3 6,73 12,40 4 11,31 54,55 5 12,83 3,65 6 6,98 8,52 7 11,92 11,07 8 13,84 63,78 9 19,02 8,22 10 11,53 8,59 11 9,54 200,95 12 8,59 Sub Total 127,01 11,31 1 98,27 98,27 2 31,62 34,35 3 140,66 124,39 Sub Total 270,55 268,32 9,93 1 9,93 32,85 2 32,85 75,15 3 6,87 40,93 4 59,31 69,84 5 349,68 195,96 Sub Total 458,63 424,66 42,50 1 20,62 11,10 2 146,91 45,84 3 930,57 940,65 4 37,01 57,27 Sub Total 1.135,11 1.097,37 2.285,03 2.285,03 112 Lampiran 5. Kondisi Tapak Tumbuh Tidak Kering dan Tapak Tumbuh Kering di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Lokasi : DOLOK TUSAM TIMUR Dolok Tusam Timur Derajat Kekeringan Tidak Kering Lokasi 1994 2005 2011 Luas (Ha) Luas (Ha) Luas (Ha) 1.930,33 1.642,47 1.764,39 Kering 325,13 304,74 69,72 Agak Kering 28,50 81,18 9,47 Sangat Kering 1,07 72,01 2,36 Awan 0,00 184,63 439,09 Jumlah 2.285,03 2.285,03 2.285,03 : PARINSORAN Parinsoran Derajat Kekeringan 2005 2011 Luas (Ha) Luas (Ha) Luas (Ha) 1.224,61 1.295,36 1.215,25 Kering 948,42 784,86 579,35 Agak Kering 111,79 187,74 44,78 Sangat Kering 13,83 4,18 Awan 0,21 0,00 3,23 441,47 Jumlah 2.285,03 2.285,03 2.285,03 Tidak Kering Lokasi 1994 : DOLOK TUSAM BARAT Derajat Kekeringan Tidak Kering Kering Agak Kering Sangat Kering Awan Jumlah Dolok Tusam Barat 1994 2005 2011 Luas (Ha) Luas (Ha) Luas (Ha) 1.910,35 1.139,93 1.656,86 336,87 486,48 201,20 37,66 171,16 34,96 0,16 136,25 12,37 0,00 351,22 379,64 2.285,03 2.285,03 2.285,03 113 Lokasi : LOBUGALA Derajat Kekeringan Tidak Kering Kering Agak Kering Sangat Kering Awan Jumlah Lokasi 1994 Luas (Ha) 1.034,05 1.069,24 181,61 0,13 0,00 2.285,03 Lobugala 2005 Luas (Ha) 547,20 490,09 677,19 182,70 387,85 2.285,03 2011 Luas (Ha) 748,62 563,80 326,45 122,35 523,81 2.285,03 : TOLANG Lampiran 6. Hasil pengolahan skoring mikrosatellite dengan menggunakan software Popgene 1.32 POPULATION GENETIC ANALYSIS of Pinus merkusii strain Tapanuli ** Single-Population Descriptive Statistics ** population ID : 1 population name : DOLOK TUSAM TIMUR * Population : 1 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 2.7576 0.2081 -1.2848 (2, 1) 10 7.2121 1.0777 6.5364 (2, 2) 2 4.1212 1.0918 -2.8920 (3, 1) 0 1.2727 1.2727 0.0000 (3, 2) 3 1.5455 1.3690 3.9798 (3, 3) 0 0.0909 0.0909 0.0000 ========================================================== == 114 Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.110213 Degree of freedom : 3 Probability : 0.163902 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 6.339385 Degree of freedom : 3 Probability : 0.096217 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 3.1818 0.0104 -0.3530 (2, 1) 9 6.8182 0.6982 4.9974 (2, 2) 1 3.1818 1.4961 -2.3149 (3, 1) 0 1.8182 1.8182 0.0000 (3, 2) 4 1.8182 2.6182 6.3077 (3, 3) 0 0.1818 0.1818 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.822857 Degree of freedom : 3 Probability : 0.077763 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.637082 Degree of freedom : 3 Probability : 0.034526 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 4 0.8485 11.7056 12.4048 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 6.3030 6.3030 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 13 9.8485 1.0085 7.2184 115 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 19.017143 Degree of freedom : 1 Probability : 0.000013 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.623204 Degree of freedom : 1 Probability : 0.000009 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 12 8.3636 1.5810 8.6643 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 5 1.3636 9.6970 12.9928 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 5 1.3636 9.6970 12.9928 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 12 8.3636 1.5810 8.6643 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : 116 G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 1 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.4118 0.4412 0.2353 0.7059 0.2941 Allele 2 0.5000 0.4412 0.2941 0.7059 Allele 3 0.0882 0.1176 0.7647 ========================================================== ============ Summary Statistics of population 1 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** *************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 3.0000 2.3401 0.9261 Pm05 34 3.0000 2.4807 0.9738 Pm07 34 2.0000 1.5622 0.5456 Pm04 34 2.0000 1.7101 0.6058 Pm08 34 2.0000 1.7101 0.6058 Mean 34 2.4000 1.9606 0.7314 St. Dev 0.5477 0.4180 0.2017 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** **************** ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== 117 Pm01 34 0.2353 0.7647 0.4100 0.5900 0.5727 0.5298 Pm05 34 0.2353 0.7647 0.3850 0.6150 0.5969 0.5486 Pm07 34 1.0000 0.0000 0.6292 0.3708 0.3599 0.4752 Pm04 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3769 Pm08 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3399 Mean 34 0.6941 0.3059 0.5137 0.4863 0.4720 0.4541 St. Dev 0.4188 0.4188 0.1090 0.1090 0.1058 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 -0.2143 -0.0737 1.0000 1.0000 1.0000 Allele 2 -0.5294 -0.5509 **** 1.0000 1.0000 Allele 3 -0.0968 -0.1333 1.0000 **** **** Total -0.3353 -0.2812 1.0000 1.0000 1.0000 ========================================================== ============ population ID : 2 population name : PARINSORAN * Population : 2 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 3 2.5161 0.0931 1.0553 (2, 2) 10 10.4839 0.0223 -0.9451 (3, 1) 0 0.2903 0.2903 0.0000 (3, 2) 3 2.5161 0.0931 1.0553 118 (3, 3) 0 0.0968 0.0968 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.692308 Degree of freedom : 3 Probability : 0.875012 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 1.165630 Degree of freedom : 3 Probability : 0.761259 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 4 0.9032 10.6175 11.9046 (2, 1) 0 5.1613 5.1613 0.0000 (2, 2) 8 6.1290 0.5711 4.2625 (3, 1) 0 1.0323 1.0323 0.0000 (3, 2) 4 2.5806 0.7806 3.5060 (3, 3) 0 0.1935 0.1935 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.356391 Degree of freedom : 3 Probability : 0.000371 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.673131 Degree of freedom : 3 Probability : 0.000198 * Population : 2 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 1.7742 0.8469 3.1516 (2, 1) 3 2.8387 0.0092 0.3316 (2, 2) 2 0.9032 1.3318 3.1797 (3, 1) 2 4.6129 1.4800 -3.3428 (3, 2) 1 3.3548 1.6529 -2.4208 (3, 3) 5 2.5161 2.4520 6.8672 ========================================================== == 119 Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 7.772860 Degree of freedom : 3 Probability : 0.050947 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.766408 Degree of freedom : 3 Probability : 0.051094 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm04* ========================================================== = Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 5 1.4516 8.6738 12.3676 (2, 1) 0 7.0968 7.0968 0.0000 (2, 2) 11 7.4516 1.6897 8.5682 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.460317 Degree of freedom : 1 Probability : 0.000029 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 20.935851 Degree of freedom : 1 Probability : 0.000005 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm08* ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 13 10.4839 0.6039 5.5929 (2, 1) 0 5.0323 5.0323 0.0000 (2, 2) 3 0.4839 13.0839 10.9473 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.720000 Degree of freedom : 1 Probability : 0.000015 likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 16.540192 Degree of freedom : 1 Probability : 0.000048 120 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 2 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.0938 0.2500 0.3438 0.3125 0.8125 Allele 2 0.8125 0.6250 0.2500 0.6875 0.1875 Allele 3 0.0938 0.1250 0.4062 ========================================================== ============ Summary Statistics of population 2 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** ***************============================================= ===== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 1.4755 0.6125 Pm05 32 3.0000 2.1333 0.9003 Pm07 32 3.0000 2.8927 1.0796 Pm04 32 2.0000 1.7534 0.6211 Pm08 32 2.0000 1.4382 0.4826 Mean 32 2.6000 1.9386 0.7392 St. Dev 0.5477 0.6015 0.2437 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** ***************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** ************* ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 32 0.6250 0.3750 0.6673 0.3327 0.3223 0.5298 Pm05 32 0.7500 0.2500 0.4516 0.5484 0.5312 0.5486 121 Pm07 32 0.6250 0.3750 0.3246 0.6754 0.6543 0.4752 Pm04 32 1.0000 0.0000 0.5565 0.4435 0.4297 0.3769 Pm08 32 1.0000 0.0000 0.6855 0.3145 0.3047 0.3399 Mean 32 0.8000 0.2000 0.5371 0.4629 0.4484 0.4541 St. Dev 0.1896 0.1896 0.1515 0.1515 0.1468 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 -0.1034 1.0000 0.3074 1.0000 1.0000 Allele 2 -0.2308 0.4667 0.3333 1.0000 1.0000 Allele 3 -0.1034 -0.1429 0.6113 **** **** Total -0.1636 0.5294 0.4269 1.0000 1.0000 ========================================================== ============ population ID : 3 population name : DOLOK TUSAM BARAT * Population : 3 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 4.6364 1.4991 -3.3631 (2, 1) 14 8.7273 3.1856 13.2329 (2, 2) 1 3.6364 1.9114 -2.5820 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.596078 Degree of freedom : 1 Probability : 0.010220 Likelihood ratio test for Hardy-Weinberg equilibrium : 122 G-square : 7.287822 Degree of freedom : 1 Probability : 0.006942 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 4 6.3636 0.8779 -3.7144 (2, 1) 13 8.2727 2.7013 11.7516 (2, 2) 0 2.3636 2.3636 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.942857 Degree of freedom : 1 Probability : 0.014777 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.037168 Degree of freedom : 1 Probability : 0.004583 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0909 0.0909 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 3 2.8182 0.0117 0.3751 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 14 14.0909 0.0006 -0.1812 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.103226 Degree of freedom : 1 Probability : 0.747992 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.193892 Degree of freedom : 1 123 Probability : 0.659697 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 10 9.8485 0.0023 0.3053 (2, 1) 6 6.3030 0.0146 -0.5913 (2, 2) 1 0.8485 0.0271 0.3286 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.043956 Degree of freedom : 1 Probability : 0.833935 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.042703 Degree of freedom : 1 Probability : 0.836286 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 0.6364 2.9221 4.5805 (2, 1) 3 5.7273 1.2987 -3.8798 (2, 2) 12 10.6364 0.1748 2.8951 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 4.395604 Degree of freedom : 1 Probability : 0.036032 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 3.595838 Degree of freedom : 1 Probability : 0.057924 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 3 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ 124 Allele 1 0.5294 0.6176 0.0882 0.7647 0.2059 Allele 2 0.4706 0.3824 0.2353 0.7941 Allele 3 0.9118 ========================================================== ============ Summary Statistics of population 3 : ****************************************************************** *************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** *************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 2.0000 1.9931 0.6914 Pm05 34 2.0000 1.8951 0.6652 Pm07 34 2.0000 1.1918 0.2984 Pm04 34 2.0000 1.5622 0.5456 Pm08 34 2.0000 1.4859 0.5084 Mean 34 2.0000 1.6256 0.5418 St. Dev 0.0000 0.3238 0.1565 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** *************** ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 34 0.1765 0.8235 0.4866 0.5134 0.4983 0.5298 Pm05 34 0.2353 0.7647 0.5134 0.4866 0.4723 0.5486 Pm07 34 0.8235 0.1765 0.8342 0.1658 0.1609 0.4752 125 Pm04 34 0.6471 0.3529 0.6292 0.3708 0.3599 0.3769 Pm08 34 0.8235 0.1765 0.6631 0.3369 0.3270 0.3399 Mean 34 0.5412 0.4588 0.6253 0.3747 0.3637 0.4541 St. Dev 0.3151 0.3151 0.1386 0.1386 0.1345 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 -0.6528 -0.6190 -0.0968 0.0192 0.4603 Allele 2 -0.6528 -0.6190 **** 0.0192 0.4603 Allele 3 **** **** -0.0968 **** **** Total -0.6528 -0.6190 -0.0968 0.0192 0.4603 ========================================================== ============ population ID : 4 population name : LOBUGALA * Population : 4 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 1.1613 2.9113 5.6945 (2, 1) 3 3.4839 0.0672 -0.8972 (2, 2) 0 2.1290 2.1290 0.0000 (3, 1) 0 3.1935 3.1935 0.0000 (3, 2) 9 4.2581 5.2808 13.4714 (3, 3) 1 1.7742 0.3378 -1.1467 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.919697 126 Degree of freedom : 3 Probability : 0.003017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 17.121978 Degree of freedom : 3 Probability : 0.000667 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 0.9032 4.8675 7.2024 (2, 1) 2 4.1290 1.0978 -2.8996 (2, 2) 3 3.8710 0.1960 -1.5294 (3, 1) 0 2.0645 2.0645 0.0000 (3, 2) 8 4.1290 3.6290 10.5824 (3, 3) 0 0.9032 0.9032 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 12.758036 Degree of freedom : 3 Probability : 0.005190 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 13.355809 Degree of freedom : 3 Probability : 0.003927 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 2 1.2581 0.4376 1.8543 (2, 2) 2 2.5161 0.1059 -0.9183 (3, 1) 1 1.5484 0.1942 -0.8744 (3, 2) 7 6.7097 0.0126 0.5930 (3, 3) 4 3.8710 0.0043 0.2623 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.851282 Degree of freedom : 3 Probability : 0.837166 127 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.916914 Degree of freedom : 3 Probability : 0.821344 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 0.4839 4.7505 5.6763 (2, 1) 2 5.0323 1.8271 -3.6909 (2, 2) 12 10.4839 0.2193 3.2416 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.796923 Degree of freedom : 1 Probability : 0.009132 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.227098 Degree of freedom : 1 Probability : 0.022238 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 11 8.9032 0.4938 4.6526 (2, 1) 2 6.1935 2.8394 -4.5214 (2, 2) 3 0.9032 4.8675 7.2024 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 8.200699 Degree of freedom : 1 Probability : 0.004187 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.333521 Degree of freedom : 1 Probability : 0.006768 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 4 : ========================================================== ============ 128 Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.2812 0.2500 0.0938 0.1875 0.7500 Allele 2 0.3750 0.5000 0.4062 0.8125 0.2500 Allele 3 0.3438 0.2500 0.5000 ========================================================== ============ Summary Statistics of population 4 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** **************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 2.9595 1.0916 Pm05 32 3.0000 2.6667 1.0397 Pm07 32 3.0000 2.3594 0.9344 Pm04 32 2.0000 1.4382 0.4826 Pm08 32 2.0000 1.6000 0.5623 Mean 32 2.6000 2.2048 0.8221 St. Dev 0.5477 0.6634 0.2808 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** **************** ========================================================== ====================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 32 0.2500 0.7500 0.3165 0.6835 0.6621 0.5298 Pm05 32 0.3750 0.6250 0.3548 0.6452 0.6250 0.5486 Pm07 32 0.3750 0.6250 0.4052 0.5948 0.5762 0.4752 Pm04 32 0.8750 0.1250 0.6855 0.3145 0.3047 0.3769 129 Pm08 32 0.8750 0.1250 0.6129 0.3871 0.3750 0.3399 Mean 32 0.5500 0.4500 0.4750 0.5250 0.5086 0.4541 St. Dev 0.3010 0.3010 0.1641 0.1641 0.1590 0.0923 ========================================================== ====================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.5362 0.6667 -0.1034 0.5897 0.6667 Allele 2 -0.6000 -0.2500 -0.1660 0.5897 0.6667 Allele 3 -0.2468 -0.3333 0.0000 **** **** Total -0.1327 0.0000 -0.0847 0.5897 0.6667 ========================================================== ============ population ID : 5 population name : Aekbilah * Population : 5 @ Locus : Pm01 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 2 0.2609 11.5942 8.1475 (2, 1) 0 2.2609 2.2609 0.0000 (2, 2) 3 3.3913 0.0452 -0.7356 (3, 1) 0 1.2174 1.2174 0.0000 (3, 2) 7 3.9565 2.3411 7.9876 (3, 3) 0 0.9130 0.9130 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.371795 Degree of freedom : 3 Probability : 0.000369 Likelihood ratio test for Hardy-Weinberg equilibrium : 130 G-square : 15.399542 Degree of freedom : 3 Probability : 0.001505 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm05 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 0.0435 0.0435 0.0000 (2, 1) 2 1.3043 0.3710 1.7098 (2, 2) 3 4.5652 0.5366 -2.5191 (3, 1) 0 0.6087 0.6087 0.0000 (3, 2) 7 4.5652 1.2986 5.9842 (3, 3) 0 0.9130 0.9130 0.0000 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 3.771429 Degree of freedom : 3 Probability : 0.287227 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.174869 Degree of freedom : 3 Probability : 0.159431 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm07 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 0 1.9565 1.9565 0.0000 (2, 1) 10 4.3478 7.3478 16.6582 (2, 2) 0 1.9565 1.9565 0.0000 (3, 1) 0 1.7391 1.7391 0.0000 (3, 2) 0 1.7391 1.7391 0.0000 (3, 3) 2 0.2609 11.5942 8.1475 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 26.333333 Degree of freedom : 3 Probability : 0.000008 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 24.805710 Degree of freedom : 3 131 Probability : 0.000017 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm04 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 3 0.6522 8.4522 9.1563 (2, 1) 0 4.6957 4.6957 0.0000 (2, 2) 9 6.6522 0.8286 5.4411 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.976471 Degree of freedom : 1 Probability : 0.000185 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 14.597394 Degree of freedom : 1 Probability : 0.000133 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm08 * ========================================================== == Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ========================================================== == (1, 1) 10 8.2609 0.3661 3.8211 (2, 1) 0 3.4783 3.4783 0.0000 (2, 2) 2 0.2609 11.5942 8.1475 ========================================================== == Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 15.438596 Degree of freedom : 1 Probability : 0.000085 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 11.968632 Degree of freedom : 1 Probability : 0.000541 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 5 : ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 ========================================================== ============ Allele 1 0.1667 0.0833 0.4167 0.2500 0.8333 Allele 2 0.5417 0.6250 0.4167 0.7500 0.1667 Allele 3 0.2917 0.2917 0.1667 132 ========================================================== ============ Summary Statistics of population 5 : ****************************************************************** **************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** ****************************************************************** **************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 24 3.0000 2.4615 0.9901 Pm05 24 3.0000 2.0719 0.8602 Pm07 24 3.0000 2.6667 1.0282 Pm04 24 2.0000 1.6000 0.5623 Pm08 24 2.0000 1.3846 0.4506 Mean 24 2.6000 2.0370 0.7783 St. Dev 0.5477 0.5465 0.2589 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ****************************************************************** **************** ** Summary of Heterozygosity Statistics for All Loci ** ****************************************************************** ****************============================================ ==================================== Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ========================================================== ====================== Pm01 24 0.4167 0.5833 0.3804 0.6196 0.5938 0.5298 Pm05 24 0.2500 0.7500 0.4601 0.5399 0.5174 0.5486 Pm07 24 0.1667 0.8333 0.3478 0.6522 0.6250 0.4752 Pm04 24 1.0000 0.0000 0.6087 0.3913 0.3750 0.3769 Pm08 24 1.0000 0.0000 0.7101 0.2899 0.2778 0.3399 Mean 24 0.5667 0.4333 0.5014 0.4986 0.4778 0.4541 St. Dev 0.4057 0.4057 0.1541 0.1541 0.1477 0.0923 ========================================================== ===================== * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 5 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ========================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 133 ========================================================== ============ Allele 1 1.0000 -0.0909 -0.7143 1.0000 1.0000 Allele 2 -0.1748 -0.6000 -0.7143 1.0000 1.0000 Allele 3 -0.4118 -0.4118 1.0000 **** **** Total 0.0175 -0.4497 -0.3333 1.0000 1.0000 Lampiran 7. Distribusi biomassa hasil destructive sampling 36 pohon P. merkusii strain Tapanuli Berat Kering (Kg) No. Diameter Tinggi Batang (cm) (m) Kg Cabang % Kg Ranting % Kg Daun % Kg Buah % Kg Akar % Kg Total % Kg % 1. 13,0 16,53 35,3 82,09% 0,6 1,40% 2,3 5,35% 0,7 1,63% 0,0 0,00% 4,1 9,53% 43,0 100,00% 2. 17,0 25,80 140,7 81,71% 7,1 4,12% 3,7 2,15% 4,2 2,44% 0,0 0,00% 16,5 9,58% 172,2 100,00% 3. 19,3 21,26 166,2 76,76% 15,1 6,96% 5,8 2,66% 8,7 4,02% 0,0 0,00% 20,8 9,61% 216,5 100,00% 4. 20,0 25,50 216,6 82,23% 10,2 3,87% 5,7 2,16% 5,6 2,13% 0,0 0,00% 25,3 9,61% 263,4 100,00% 5. 23,0 22,50 212,4 54,98% 17,1 4,43% 8,0 2,07% 5,7 1,48% 0,0 0,00% 143,1 37,04% 386,3 100,00% 6. 25,0 17,10 186,0 49,88% 32,5 8,72% 8,5 2,28% 7,8 2,09% 0,0 0,00% 138,1 37,03% 372,9 100,00% 7. 26,0 21,30 196,9 48,33% 44,0 10,80% 8,3 2,04% 7,3 1,79% 0,0 0,00% 150,9 37,04% 407,4 100,00% 8. 27,2 16,50 186,1 38,02% 53,2 10,87% 38,2 7,80% 32,3 6,60% 0,0 0,00% 179,7 36,71% 489,5 100,00% 9. 29,1 26,30 392,3 51,87% 52,7 6,97% 15,8 2,09% 15,4 2,04% 0,0 0,00% 280,1 37,04% 756,3 100,00% 10. 30,5 22,60 330,8 61,54% 75,2 13,99% 16,8 3,13% 9,3 1,73% 0,0 0,00% 105,4 19,61% 537,5 100,00% 11. 32,7 21,92 392,3 51,69% 145,0 19,11% 38,8 5,11% 34,0 4,48% 0,0 0,00% 148,8 19,61% 758,9 100,00% 12. 34,3 28,10 511,9 63,08% 89,7 11,05% 27,6 3,40% 23,2 2,86% 0,0 0,00% 159,1 19,61% 811,5 100,00% 13. 36,5 19,05 331,3 53,39% 74,6 12,02% 50,9 8,20% 41,4 6,67% 0,0 0,00% 122,3 19,71% 620,5 100,00% 14. 38,4 23,73 575,2 56,88% 140,1 13,85% 46,0 4,55% 50,8 5,02% 0,9 0,09% 198,3 19,61% 1011,3 100,00% 15. 39,0 27,90 677,8 60,73% 145,9 13,07% 45,3 4,06% 28,2 2,53% 0,0 0,00% 218,8 19,61% 1116,0 100,00% 173,8 13,77% 1262,0 100,00% 16. 40,5 23,30 671,5 53,21% 63,9 5,06% 52,0 4,12% 0,3 0,02% 300,5 23,81% 17. 41,3 27,67 593,2 67,29% 52,3 5,93% 13,1 1,49% 13,0 1,47% 0,0 0,00% 209,9 23,81% 881,5 100,00% 18. 43,0 30,86 1112,7 63,14% 148,2 8,41% 45,8 2,60% 35,9 2,04% 0,0 0,00% 419,6 23,81% 1762,2 100,00% 19. 44,1 21,52 585,5 54,54% 138,0 12,86% 59,3 5,52% 37,0 3,45% 0,0 0,00% 253,7 23,63% 1073,5 100,00% 20. 45,0 27,74 953,6 62,13% 114,7 57,3 3,73% 43,8 2,85% 0,0 0,00% 365,4 23,81% 1534,8 100,00% 7,47% 21. 47,0 27,78 766,4 53,51% 260,0 18,15% 34,2 2,39% 30,6 2,14% 0,0 0,00% 341,0 23,81% 1432,2 100,00% 22. 48,0 20,80 753,0 57,48% 127,5 9,73% 65,1 4,97% 51,8 3,95% 0,7 0,05% 311,9 23,81% 1310,0 100,00% 23. 50,0 31,20 1299,1 58,69% 139,9 6,32% 52,4 2,37% 30,3 1,37% 0,0 0,00% 691,7 31,25% 2213,4 100,00% 24. 53,0 20,40 858,8 48,08% 278,7 15,60% 138,9 7,78% 77,9 4,36% 1,9 0,11% 430,0 24,07% 1786,2 100,00% 25. 54,5 30,90 1294,3 48,75% 419,6 15,81% 60,6 2,28% 50,7 1,91% 0,0 0,00% 829,6 31,25% 2654,8 100,00% 2719,1 100,00% 26. 55,2 28,00 1430,6 52,61% 264,2 9,72% 111,7 4,11% 62,9 2,31% 0,0 0,00% 849,7 31,25% 27. 57,0 30,08 1221,8 49,75% 359,9 14,65% 58,3 2,37% 48,4 1,97% 0,0 0,00% 767,5 31,25% 2455,9 100,00% 28. 59,5 25,05 1651,0 43,46% 674,0 17,74% 181,1 4,77% 104,0 2,74% 1,7 0,04% 1187,2 31,25% 3799,0 100,00% 29. 61,0 30,65 1692,6 58,77% 596,5 20,71% 101,0 3,51% 72,5 2,52% 0,0 0,00% 417,4 14,49% 2880,0 100,00% 30. 62,0 28,04 1631,5 66,00% 354,1 14,32% 74,1 3,00% 54,0 2,18% 0,0 0,00% 358,3 14,49% 2472,0 100,00% 31. 63,0 26,20 1776,4 65,43% 399,7 14,72% 79,5 2,93% 66,0 2,43% 0,0 0,00% 393,5 14,49% 2715,1 100,00% 32. 65,3 29,94 1981,9 59,15% 764,3 22,81% 62,6 1,87% 59,4 1,77% 0,0 0,00% 482,2 14,39% 3350,4 100,00% 33. 72,0 28,57 1817,8 43,44% 1058,1 25,29% 159,7 3,82% 128,3 3,07% 0,0 0,00% 1020,6 24,39% 4184,5 100,00% 34. 74,0 34,80 2874,2 54,56% 886,0 16,82% 128,7 2,44% 105,0 1,99% 0,0 0,00% 1274,0 24,18% 5267,9 100,00% 35. 76,0 24,28 1854,8 38,06% 1377,7 28,27% 304,0 6,24% 148,4 3,04% 0,0 0,00% 1188,7 24,39% 4873,6 100,00% 36. 82,0 28,60 Rata-rata 2681,5 53,84% 57,36% 892,4 17,92% 12,73% 146,6 2,94% 3,70% 86,5 1,74% 2,80% 0,0 0,00% 0,01% 1173,1 23,56% 23,39% 4980,1 100,00% 100,00% 134 Lampiran 8. No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. Data Biomassa hasil detructive sampling untuk penyusunan persamaan allometrik P. merkusii strain Tapanuli Parameter Pertumbuhan D 13,0 17,0 19,3 20,0 23,0 25,0 26,0 27,2 29,1 30,5 32,7 34,3 36,5 38,4 39,0 40,5 41,3 43,0 44,1 45,0 47,0 48,0 50,0 53,0 54,5 55,2 57,0 59,5 61,0 62,0 63,0 65,3 72,0 74,0 76,0 82,0 H 16,53 25,80 21,26 25,50 22,50 17,10 21,30 16,50 26,30 22,60 21,92 28,10 19,05 23,73 27,90 23,30 27,67 30,86 21,52 27,74 27,78 20,80 31,20 20,40 30,90 28,00 30,08 25,05 30,65 28,04 26,20 29,94 28,57 34,80 24,28 28,60 Peubah Bebas (X) D*H D*WD D*H*WD 214,89 5,82 96,15 438,60 8,13 209,63 410,32 10,32 219,30 510,00 9,34 238,20 517,50 11,03 248,14 427,50 11,15 190,65 553,80 8,76 186,67 448,80 12,74 210,18 765,33 14,41 379,04 689,30 15,52 350,82 716,78 16,73 366,76 963,83 15,69 440,96 695,33 16,32 310,85 911,23 18,65 442,66 1088,10 17,17 479,01 943,65 18,81 438,32 1142,77 17,67 489,02 1326,98 21,46 662,34 949,03 20,75 446,59 1248,30 22,45 622,66 1305,66 19,91 553,01 998,40 23,58 490,56 1560,00 26,94 840,58 1081,20 29,43 600,43 1684,05 25,75 795,62 1545,60 24,86 695,97 1714,56 22,48 676,19 1490,48 33,21 831,86 1869,65 28,30 867,41 1738,48 32,22 903,41 1650,60 31,97 837,56 1955,08 31,43 941,12 2057,04 35,32 1009,13 2575,20 38,78 1349,48 1845,28 38,02 923,02 2345,20 41,56 1188,54 Peubah Tak Bebas (Y) Above Ground Biomass Below Ground Biomass Total Biomass (Kg) (Kg) (Kg) AGB BGB TB 38,9 4,1 43,0 155,7 16,5 172,2 195,7 20,7 216,5 238,1 25,2 263,3 243,2 141,1 384,3 234,8 136,2 371,0 256,5 148,8 405,3 309,8 179,7 489,5 476,2 276,2 752,4 432,1 250,6 682,7 610,1 149,8 759,9 652,4 160,2 812,6 498,2 122,3 620,5 813,0 199,6 1012,6 897,2 220,2 1117,4 961,5 236,0 1197,5 671,6 207,8 879,4 1342,6 415,5 1758,1 819,8 253,7 1073,5 1169,4 361,9 1531,3 1091,2 337,7 1428,9 998,1 308,9 1307,0 1521,7 470,9 1992,6 1356,2 430,0 1786,2 1825,2 578,7 2403,9 1869,4 592,7 2462,1 1688,4 535,3 2223,7 2611,8 828,1 3439,9 2462,6 414,0 2876,6 2113,7 355,4 2469,1 2321,6 390,3 2711,9 2868,2 482,2 3350,4 3163,9 1009,2 4173,1 3993,9 1274,0 5267,9 3684,9 1175,4 4860,3 3807,0 1173,1 4980,1 135 107 Lampiran 1. Kondisi tutupan lahan di lima lokasi sebaran alam P. merkusii strain Tapanuli pada tahun 1994, 2005, dan 2011 Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah Bentuk Tutupan Lahan Hutan Ilalang-semak Kebun Ladang Padi-ladang Jumlah DOLOK TUSAM TIMUR 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 1 2020.43 1 2011.25 1 2004.15 5 28.16 5 37.34 7 44.44 3 54.37 3 54.37 3 51.96 2 85.94 3 85.1 3 80.51 3 96.13 3 96.97 3 103.97 14 2285.03 15 2285.03 17 2285.03 PARINSORAN 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 3 926.00 3 926 2 910.03 7 36.24 2 13.59 8 164.08 1 232.84 2 268.08 2 253.79 3 376.24 3 316.68 5 205.47 2 713.70 2 760.68 2 751.65 16 2285.03 12 2285.03 19 2285.03 DOLOK TUSAM BARAT 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 1 1651.31 1 1651.31 1 1647.73 5 123.06 7 126.8 7 199.31 2 180.19 2 117.76 1 116.19 4 187.98 4 241.16 6 208.57 3 142.49 4 147.99 3 113.22 15 2285.03 18 2285.03 18 2285.03 LOBUGALA 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 2 289.59 2 293.73 2 293.73 10 148.82 11 200.95 12 127.01 4 252.09 4 268.32 3 270.55 5 425.73 6 424.66 5 458.63 5 1168.8 5 1097.37 4 1135.11 26 2285.03 28 2285.03 26 2285.03 TOLANG 1994 2005 2011 Jml Patch Luas (Ha) Jml Patch Luas (Ha) Jml Patch Luas (Ha) 1 5 2 6 3 17 1640.69 15.65 335.14 201.44 92.12 2285.03 2 3 2 10 3 20 1636.13 22.64 316.25 207.05 102.97 2285.03 1 7 4 15 3 30 1604.57 44.34 292.13 214.61 129.37 2285.03 108 Lampiran 2. Hasil analisis genetik dengan menggunakan software Popgene 3.2 population ID : 1 population name : DOLOK TUSAM TIMUR * Population : 1 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 2.7576 0.2081 -1.2848 (2, 1) 10 7.2121 1.0777 6.5364 (2, 2) 2 4.1212 1.0918 -2.8920 (3, 1) 0 1.2727 1.2727 0.0000 (3, 2) 3 1.5455 1.3690 3.9798 (3, 3) 0 0.0909 0.0909 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.110213 Degree of freedom : 3 Probability : 0.163902 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 6.339385 Degree of freedom : 3 Probability : 0.096217 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 3.1818 0.0104 -0.3530 (2, 1) 9 6.8182 0.6982 4.9974 (2, 2) 1 3.1818 1.4961 -2.3149 (3, 1) 0 1.8182 1.8182 0.0000 (3, 2) 4 1.8182 2.6182 6.3077 (3, 3) 0 0.1818 0.1818 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.822857 Degree of freedom : 3 Probability : 0.077763 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.637082 Degree of freedom : 3 Probability : 0.034526 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 4 0.8485 11.7056 12.4048 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 6.3030 6.3030 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 13 9.8485 1.0085 7.2184 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 19.017143 Degree of freedom : 1 Probability : 0.000013 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.623204 Degree of freedom : 1 Probability : 0.000009 109 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 12 8.3636 1.5810 8.6643 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 5 1.3636 9.6970 12.9928 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 5 1.3636 9.6970 12.9928 (2, 1) 0 7.2727 7.2727 0.0000 (2, 2) 12 8.3636 1.5810 8.6643 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 5 1.3636 9.6970 12.9928 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 7.2727 7.2727 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 12 8.3636 1.5810 8.6643 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 1 Probability : 0.000017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 1 Probability : 0.000003 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 1 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) 110 ============================================================ (1, 1) 0 0.0000 0.0000 0.0000 (2, 1) 0 0.3030 0.3030 0.0000 (2, 2) 5 1.3636 9.6970 12.9928 (3, 1) 1 0.6970 0.1318 0.7220 (3, 2) 0 6.9697 6.9697 0.0000 (3, 3) 11 7.6667 1.4493 7.9423 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.550725 Degree of freedom : 3 Probability : 0.000339 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 21.657150 Degree of freedom : 3 Probability : 0.000077 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 1 : ============================================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ============================================================================== ============ Allele 1 0.4118 0.4412 0.2353 0.7059 0.2941 0.2941 0.0294 Allele 2 0.5000 0.4412 0.2941 0.7059 0.2941 Allele 3 0.0882 0.1176 0.7647 0.7059 0.6765 ============================================================================== ============ Summary Statistics of population 1 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 3.0000 2.3401 0.9261 Pm05 34 3.0000 2.4807 0.9738 Pm07 34 2.0000 1.5622 0.5456 Pm04 34 2.0000 1.7101 0.6058 Pm08 34 2.0000 1.7101 0.6058 Pm09a 34 2.0000 1.7101 0.6058 Pm12 34 3.0000 1.8349 0.7281 Mean St. Dev 34 2.4286 1.9069 0.7130 0.5345 0.3552 0.1714 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] ********************************************************************************* ** Summary of Heterozygosity Statistics for All Loci ** ********************************************************************************** 111 ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 34 0.2353 0.7647 0.4100 0.5900 0.5727 0.5298 Pm05 34 0.2353 0.7647 0.3850 0.6150 0.5969 0.5486 Pm07 34 1.0000 0.0000 0.6292 0.3708 0.3599 0.4752 Pm04 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3769 Pm08 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.3399 Pm09a 34 1.0000 0.0000 0.5722 0.4278 0.4152 0.4074 Pm12 34 0.9412 0.0588 0.5312 0.4688 0.4550 0.3669 Mean 34 0.7731 0.2269 0.5246 0.4754 0.4614 0.4350 St. Dev 0.3680 0.3680 0.0917 0.0917 0.0890 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ============================================================================== ============ Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ============================================================================== ============ Allele 1 -0.2143 -0.0737 1.0000 1.0000 1.0000 1.0000 -0.0303 Allele 2 -0.5294 -0.5509 **** 1.0000 1.0000 **** 1.0000 Allele 3 -0.0968 -0.1333 1.0000 **** **** 1.0000 0.8656 Total -0.3353 -0.2812 1.0000 1.0000 1.0000 1.0000 0.8707 ============================================================================== ============ population ID : 2 population name : PARINSORAN * Population : 2 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 3 2.5161 0.0931 1.0553 (2, 2) 10 10.4839 0.0223 -0.9451 (3, 1) 0 0.2903 0.2903 0.0000 (3, 2) 3 2.5161 0.0931 1.0553 (3, 3) 0 0.0968 0.0968 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.692308 Degree of freedom : 3 Probability : 0.875012 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 1.165630 Degree of freedom : 3 Probability : 0.761259 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 4 0.9032 10.6175 11.9046 (2, 1) 0 5.1613 5.1613 0.0000 112 (2, 2) 8 6.1290 0.5711 4.2625 (3, 1) 0 1.0323 1.0323 0.0000 (3, 2) 4 2.5806 0.7806 3.5060 (3, 3) 0 0.1935 0.1935 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.356391 Degree of freedom : 3 Probability : 0.000371 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.673131 Degree of freedom : 3 Probability : 0.000198 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 1.7742 0.8469 3.1516 (2, 1) 3 2.8387 0.0092 0.3316 (2, 2) 2 0.9032 1.3318 3.1797 (3, 1) 2 4.6129 1.4800 -3.3428 (3, 2) 1 3.3548 1.6529 -2.4208 (3, 3) 5 2.5161 2.4520 6.8672 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 7.772860 Degree of freedom : 3 Probability : 0.050947 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.766408 Degree of freedom : 3 Probability : 0.051094 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 5 1.4516 8.6738 12.3676 (2, 1) 0 7.0968 7.0968 0.0000 (2, 2) 11 7.4516 1.6897 8.5682 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.460317 Degree of freedom : 1 Probability : 0.000029 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 20.935851 Degree of freedom : 1 Probability : 0.000005 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 13 10.4839 0.6039 5.5929 (2, 1) 0 5.0323 5.0323 0.0000 (2, 2) 3 0.4839 13.0839 10.9473 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : 113 Chi-square : 18.720000 Degree of freedom : 1 Probability : 0.000015 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 16.540192 Degree of freedom : 1 Probability : 0.000048 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 12 8.9032 1.0771 7.1638 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 6.1935 6.1935 0.0000 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 4 0.9032 10.6175 11.9046 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.888199 Degree of freedom : 1 Probability : 0.000023 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.068448 Degree of freedom : 1 Probability : 0.000013 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 2 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 0 2.3226 2.3226 0.0000 (2, 2) 12 8.9032 1.0771 7.1638 (3, 1) 3 0.4839 13.0839 10.9473 (3, 2) 0 3.8710 3.8710 0.0000 (3, 3) 1 0.3226 1.4226 2.2628 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 21.873913 Degree of freedom : 3 Probability : 0.000069 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 20.373932 Degree of freedom : 3 Probability : 0.000142 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 2 : ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.0938 0.2500 0.3438 0.3125 0.8125 0.7500 0.0938 Allele 2 0.8125 0.6250 0.2500 0.6875 0.1875 0.7500 Allele 3 0.0938 0.1250 0.4062 0.2500 0.1562 ======================================================================================= === Summary Statistics of population 2 : *********************************************************************************** 114 ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 1.4755 0.6125 Pm05 32 3.0000 2.1333 0.9003 Pm07 32 3.0000 2.8927 1.0796 Pm04 32 2.0000 1.7534 0.6211 Pm08 32 2.0000 1.4382 0.4826 Pm09a 32 2.0000 1.6000 0.5623 Pm12 32 3.0000 1.6787 0.7277 Mean 32 2.5714 1.8531 0.7123 St. Dev 0.5345 0.5129 0.2098 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 32 0.6250 0.3750 0.6673 0.3327 0.3223 0.5298 Pm05 32 0.7500 0.2500 0.4516 0.5484 0.5312 0.5486 Pm07 32 0.6250 0.3750 0.3246 0.6754 0.6543 0.4752 Pm04 32 1.0000 0.0000 0.5565 0.4435 0.4297 0.3769 Pm08 32 1.0000 0.0000 0.6855 0.3145 0.3047 0.3399 Pm09a 32 1.0000 0.0000 0.6129 0.3871 0.3750 0.4074 Pm12 32 0.8125 0.1875 0.5827 0.4173 0.4043 0.3669 Mean 32 0.8304 0.1696 0.5544 0.4456 0.4316 0.4350 St. Dev 0.1720 0.1720 0.1275 0.1275 0.1235 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 -0.1034 1.0000 0.3074 1.0000 1.0000 1.0000 -0.1034 Allele 2 -0.2308 0.4667 0.3333 1.0000 1.0000 **** 1.0000 Allele 3 -0.1034 -0.1429 0.6113 **** **** 1.0000 0.2889 Total -0.1636 0.5294 0.4269 1.0000 1.0000 1.0000 0.5362 ======================================================================================= === population ID : 3 population name : DOLOK TUSAM BARAT * Population : 3 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) 115 ============================================================ (1, 1) 2 4.6364 1.4991 -3.3631 (2, 1) 14 8.7273 3.1856 13.2329 (2, 2) 1 3.6364 1.9114 -2.5820 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.596078 Degree of freedom : 1 Probability : 0.010220 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.287822 Degree of freedom : 1 Probability : 0.006942 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 4 6.3636 0.8779 -3.7144 (2, 1) 13 8.2727 2.7013 11.7516 (2, 2) 0 2.3636 2.3636 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 5.942857 Degree of freedom : 1 Probability : 0.014777 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 8.037168 Degree of freedom : 1, Probability : 0.004583 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0909 0.0909 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 3 2.8182 0.0117 0.3751 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 14 14.0909 0.0006 -0.1812 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.103226 Degree of freedom : 1 Probability : 0.747992 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.193892 Degree of freedom : 1 Probability : 0.659697 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~ * Population : 3 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 10 9.8485 0.0023 0.3053 (2, 1) 6 6.3030 0.0146 -0.5913 (2, 2) 1 0.8485 0.0271 0.3286 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.043956 Degree of freedom : 1 Probability : 0.833935 Likelihood ratio test for Hardy-Weinberg equilibrium : 116 G-square : 0.042703 Degree of freedom : 1 Probability : 0.836286 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 0.6364 2.9221 4.5805 (2, 1) 3 5.7273 1.2987 -3.8798 (2, 2) 12 10.6364 0.1748 2.8951 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 4.395604 Degree of freedom : 1 Probability : 0.036032 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 3.595838 Degree of freedom : 1 Probability : 0.057924 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.6364 0.6364 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 7 5.7273 0.2828 2.8094 (3, 2) 0 0.0000 0.0000 0.0000 (3, 3) 10 10.6364 0.0381 -1.2339 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.957265 Degree of freedom : 1 Probability : 0.327877 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 1.575518 Degree of freedom : 1 Probability : 0.209407 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 3 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0000 0.0000 0.0000 (2, 1) 0 0.0000 0.0000 0.0000 (2, 2) 8 4.1212 3.6506 10.6127 (3, 1) 0 0.0000 0.0000 0.0000 (3, 2) 1 8.7576 6.8718 -4.3398 (3, 3) 8 4.1212 3.6506 10.6127 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 14.173010 Degree of freedom : 1 Probability : 0.000167 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 16.885577 Degree of freedom : 1 Probability : 0.000040 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 3 : 117 ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.5294 0.6176 0.0882 0.7647 0.2059 0.2059 Allele 2 0.4706 0.3824 0.2353 0.7941 0.5000 Allele 3 0.9118 0.7941 0.5000 ======================================================================================= === Summary Statistics of population 3 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 34 2.0000 1.9931 0.6914 Pm05 34 2.0000 1.8951 0.6652 Pm07 34 2.0000 1.1918 0.2984 Pm04 34 2.0000 1.5622 0.5456 Pm08 34 2.0000 1.4859 0.5084 Pm09a 34 2.0000 1.4859 0.5084 Pm12 34 2.0000 2.0000 0.6931 Mean 34 2.0000 1.6591 0.5587 St. Dev 0.0000 0.3086 0.1414 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 34 0.1765 0.8235 0.4866 0.5134 0.4983 0.5298 Pm05 34 0.2353 0.7647 0.5134 0.4866 0.4723 0.5486 Pm07 34 0.8235 0.1765 0.8342 0.1658 0.1609 0.4752 Pm04 34 0.6471 0.3529 0.6292 0.3708 0.3599 0.3769 Pm08 34 0.8235 0.1765 0.6631 0.3369 0.3270 0.3399 Pm09a 34 0.5882 0.4118 0.6631 0.3369 0.3270 0.4074 Pm12 34 0.9412 0.0588 0.4848 0.5152 0.5000 0.3669 Mean 34 0.6050 0.3950 0.6106 0.3894 0.3779 0.4350 St. Dev 0.2975 0.2975 0.1268 0.1268 0.1231 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 -0.6528 -0.6190 -0.0968 0.0192 0.4603 -0.2593 **** 118 Allele 2 -0.6528 -0.6190 **** 0.0192 0.4603 **** 0.8824 Allele 3 **** **** -0.0968 **** **** -0.2593 0.8824 Total -0.6528 -0.6190 -0.0968 0.0192 0.4603 -0.2593 0.8824 ======================================================================================= === Population ID : 4 population name : LOBUGALA * Population : 4 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 1.1613 2.9113 5.6945 (2, 1) 3 3.4839 0.0672 -0.8972 (2, 2) 0 2.1290 2.1290 0.0000 (3, 1) 0 3.1935 3.1935 0.0000 (3, 2) 9 4.2581 5.2808 13.4714 (3, 3) 1 1.7742 0.3378 -1.1467 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.919697 Degree of freedom : 3 Probability : 0.003017 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 17.121978 Degree of freedom : 3 Probability : 0.000667 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 0.9032 4.8675 7.2024 (2, 1) 2 4.1290 1.0978 -2.8996 (2, 2) 3 3.8710 0.1960 -1.5294 (3, 1) 0 2.0645 2.0645 0.0000 (3, 2) 8 4.1290 3.6290 10.5824 (3, 3) 0 0.9032 0.9032 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 12.758036 Degree of freedom : 3 Probability : 0.005190 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 13.355809 Degree of freedom : 3 Probability : 0.003927 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 2 1.2581 0.4376 1.8543 (2, 2) 2 2.5161 0.1059 -0.9183 (3, 1) 1 1.5484 0.1942 -0.8744 (3, 2) 7 6.7097 0.0126 0.5930 (3, 3) 4 3.8710 0.0043 0.2623 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.851282 Degree of freedom : 3 Probability : 0.837166 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.916914 Degree of freedom : 3 119 Probability : 0.821344 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 0.4839 4.7505 5.6763 (2, 1) 2 5.0323 1.8271 -3.6909 (2, 2) 12 10.4839 0.2193 3.2416 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 6.796923 Degree of freedom : 1 Probability : 0.009132 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.227098 Degree of freedom : 1 Probability : 0.022238 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 11 8.9032 0.4938 4.6526 (2, 1) 2 6.1935 2.8394 -4.5214 (2, 2) 3 0.9032 4.8675 7.2024 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 8.200699 Degree of freedom : 1 Probability : 0.004187 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 7.333521 Degree of freedom : 1 Probability : 0.006768 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 11 8.1613 0.9874 6.5668 (2, 1) 1 0.7419 0.0898 0.5970 (2, 2) 0 0.0000 0.0000 0.0000 (3, 1) 0 5.9355 5.9355 0.0000 (3, 2) 0 0.2581 0.2581 0.0000 (3, 3) 4 0.9032 10.6175 11.9046 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.888199 Degree of freedom : 3 Probability : 0.000464 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 19.068448 Degree of freedom : 3 Probability : 0.000265 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 4 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ 120 (1, 1) 0 0.0968 0.0968 0.0000 (2, 1) 3 2.5161 0.0931 1.0553 (2, 2) 11 10.4839 0.0254 1.0573 (3, 1) 0 0.2903 0.2903 0.0000 (3, 2) 1 2.5161 0.9136 -1.8454 (3, 3) 1 0.0968 8.4301 4.6707 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 9.849231 Degree of freedom : 3 Probability : 0.019892 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 4.937911 Degree of freedom : 3 Probability : 0.176400 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 4 : ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.2812 0.2500 0.0938 0.1875 0.7500 0.7188 0.0938 Allele 2 0.3750 0.5000 0.4062 0.8125 0.2500 0.0312 0.8125 Allele 3 0.3438 0.2500 0.5000 0.2500 0.0938 ======================================================================================= === Summary Statistics of population 4 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 32 3.0000 2.9595 1.0916 Pm05 32 3.0000 2.6667 1.0397 Pm07 32 3.0000 2.3594 0.9344 Pm04 32 2.0000 1.4382 0.4826 Pm08 32 2.0000 1.6000 0.5623 Pm09a 32 3.0000 1.7239 0.6922 Pm12 32 3.0000 1.4755 0.6125 Mean 32 2.7143 2.0319 0.7736 St. Dev 0.4880 0.6210 0.2449 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ============================================================================== == Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ============================================================================== == Pm01 32 0.2500 0.7500 0.3165 0.6835 0.6621 0.5298 Pm05 32 0.3750 0.6250 0.3548 0.6452 0.6250 0.5486 Pm07 32 0.3750 0.6250 0.4052 0.5948 0.5762 0.4752 Pm04 32 0.8750 0.1250 0.6855 0.3145 0.3047 0.3769 Pm08 32 0.8750 0.1250 0.6129 0.3871 0.3750 0.3399 Pm09a 32 0.9375 0.0625 0.5665 0.4335 0.4199 0.4074 121 Pm12 32 0.7500 0.2500 0.6673 0.3327 0.3223 0.3669 Mean 32 0.6339 0.3661 0.5156 0.4844 0.4693 0.4350 St. Dev 0.2896 0.2896 0.1536 0.1536 0.1488 0.0830 ============================================================================== == * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.5362 0.6667 -0.1034 0.5897 0.6667 0.8454 -0.1034 Allele 2 -0.6000 -0.2500 -0.1660 0.5897 0.6667 -0.0323 0.1795 Allele 3 -0.2468 -0.3333 0.0000 **** **** 1.0000 0.6322 Total -0.1327 0.0000 -0.0847 0.5897 0.6667 0.8512 0.2242 ======================================================================================= === population ID : 5 population name : TOLANG * Population : 5 @ Locus : Pm01 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 2 0.2609 11.5942 8.1475 (2, 1) 0 2.2609 2.2609 0.0000 (2, 2) 3 3.3913 0.0452 -0.7356 (3, 1) 0 1.2174 1.2174 0.0000 (3, 2) 7 3.9565 2.3411 7.9876 (3, 3) 0 0.9130 0.9130 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 18.371795 Degree of freedom : 3 Probability : 0.000369 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 15.399542 Degree of freedom : 3 Probability : 0.001505 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm05 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0435 0.0435 0.0000 (2, 1) 2 1.3043 0.3710 1.7098 (2, 2) 3 4.5652 0.5366 -2.5191 (3, 1) 0 0.6087 0.6087 0.0000 (3, 2) 7 4.5652 1.2986 5.9842 (3, 3) 0 0.9130 0.9130 0.0000 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 3.771429 Degree of freedom : 3 Probability : 0.287227 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 5.174869 Degree of freedom : 3 Probability : 0.159431 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm07 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ 122 (1, 1) 0 1.9565 1.9565 0.0000 (2, 1) 10 4.3478 7.3478 16.6582 (2, 2) 0 1.9565 1.9565 0.0000 (3, 1) 0 1.7391 1.7391 0.0000 (3, 2) 0 1.7391 1.7391 0.0000 (3, 3) 2 0.2609 11.5942 8.1475 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 26.333333 Degree of freedom : 3 Probability : 0.000008 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 24.805710 Degree of freedom : 3 Probability : 0.000017 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm04 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 3 0.6522 8.4522 9.1563 (2, 1) 0 4.6957 4.6957 0.0000 (2, 2) 9 6.6522 0.8286 5.4411 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 13.976471 Degree of freedom : 1 Probability : 0.000185 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 14.597394 Degree of freedom : 1 Probability : 0.000133 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm08 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 10 8.2609 0.3661 3.8211 (2, 1) 0 3.4783 3.4783 0.0000 (2, 2) 2 0.2609 11.5942 8.1475 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 15.438596 Degree of freedom : 1 Probability : 0.000085 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 11.968632 Degree of freedom : 1 Probability : 0.000541 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm09a * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 7 5.2174 0.6091 4.1148 (2, 1) 2 2.7826 0.2201 -1.3210 (2, 2) 1 0.2609 2.0942 2.6875 (3, 1) 0 2.7826 2.7826 0.0000 (3, 2) 0 0.6957 0.6957 0.0000 (3, 3) 2 0.2609 11.5942 8.1475 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 17.995833 Degree of freedom : 3 Probability : 0.000441 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 13.628807 Degree of freedom : 3 Probability : 0.003457 123 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ * Population : 5 @ Locus : Pm12 * ============================================================ Genotypes Obs. (O) Exp. (E) (O-E)²/E 2*O*Ln(O/E) ============================================================ (1, 1) 0 0.0435 0.0435 0.0000 (2, 1) 2 1.9130 0.0040 0.1778 (2, 2) 10 10.0435 0.0002 -0.0868 ============================================================ Chi-square test for Hardy-Weinberg equilibrium : Chi-square : 0.047619 Degree of freedom : 1 Probability : 0.827259 Likelihood ratio test for Hardy-Weinberg equilibrium : G-square : 0.091039 Degree of freedom : 1 Probability : 0.762860 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Allele Frequency of population 5 : ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 0.1667 0.0833 0.4167 0.2500 0.8333 0.6667 0.0833 Allele 2 0.5417 0.6250 0.4167 0.7500 0.1667 0.1667 0.9167 Allele 3 0.2917 0.2917 0.1667 0.1667 ======================================================================================= === Summary Statistics of population 5 : *********************************************************************************** ** Summary of Genic Variation Statistics for All Loci ** ** [See Nei (1987) Molecular Evolutionary Genetics (p. 176-187)] ** *********************************************************************************** ================================================== Locus Sample Size na* ne* I* ================================================== Pm01 24 3.0000 2.4615 0.9901 Pm05 24 3.0000 2.0719 0.8602 Pm07 24 3.0000 2.6667 1.0282 Pm04 24 2.0000 1.6000 0.5623 Pm08 24 2.0000 1.3846 0.4506 Pm09a 24 3.0000 2.0000 0.8676 Pm12 24 2.0000 1.1803 0.2868 Mean 24 2.5714 1.9093 0.7208 St. Dev 0.5345 0.5501 0.2871 ================================================== * na = Observed number of alleles * ne = Effective number of alleles [Kimura and Crow (1964)] * I = Shannon's Information index [Lewontin (1972)] 124 *********************************************************************************** ** Summary of Heterozygosity Statistics for All Loci ** *********************************************************************************** ================================================================================ Locus Sample Size Obs_Hom Obs_Het Exp_Hom* Exp_Het* Nei** Ave_Het ================================================================================ Pm01 24 0.4167 0.5833 0.3804 0.6196 0.5938 0.5298 Pm05 24 0.2500 0.7500 0.4601 0.5399 0.5174 0.5486 Pm07 24 0.1667 0.8333 0.3478 0.6522 0.6250 0.4752 Pm04 24 1.0000 0.0000 0.6087 0.3913 0.3750 0.3769 Pm08 24 1.0000 0.0000 0.7101 0.2899 0.2778 0.3399 Pm09a 24 0.8333 0.1667 0.4783 0.5217 0.5000 0.4074 Pm12 24 0.8333 0.1667 0.8406 0.1594 0.1528 0.3669 Mean 24 0.6429 0.3571 0.5466 0.4534 0.4345 0.4350 St. Dev 0.3559 0.3559 0.1809 0.1809 0.1733 0.0830 ================================================================================ * Expected homozygosty and heterozygosity were computed using Levene (1949) ** Nei's (1973) expected heterozygosity The number of polymorphic loci is : 7 The percentage of polymorphic loci is : 100.00 % Wright's (1978) fixation index (Fis) as a measure of heterozygote deficiency or excess ======================================================================================= === Allele \ Locus Pm01 Pm05 Pm07 Pm04 Pm08 Pm09a Pm12 ======================================================================================= === Allele 1 1.0000 -0.0909 -0.7143 1.0000 1.0000 0.6250 -0.0909 Allele 2 -0.1748 -0.6000 -0.7143 1.0000 1.0000 0.4000 -0.0909 Allele 3 -0.4118 -0.4118 1.0000 **** **** 1.0000 **** Total 0.0175 -0.4497 -0.3333 1.0000 1.0000 0.6667 -0.0909 ======================================================================================= === 125 Lampiran 3. Hasil inventarisasi sebaran diameter tegakan alam Pinus merkusii strain Tapanuli di dalam kawasan Hutan Lindung Dolok Tusam Timur dan Dolok Tusam Barat – Sumatera Utara Kelas Diameter >0-9,9 10-19,9 20-29,9 30-39,9 40-49,9 50-59,9 60-69,9 70-79,9 80-89,9 90-99,9 100-109,9 110-119,9 120-129,9 Jumlah pohon HL DT Barat HL DT Timur Dolok Tusam 0 0 0 0 2 2 0 5 5 1 6 7 6 9 15 12 5 17 6 9 15 11 2 13 1 2 3 6 3 9 0 1 1 0 2 2 0 1 1 43 47 90 Destructive Sampling 0 3 6 6 7 6 4 3 1 0 0 0 0 36 Pendekatan Volumetrtik 0 0 0 0 0 0 0 2 1 1 1 2 1 8 Jumlah Data 0 3 6 6 7 6 4 5 2 1 1 2 1 44 126 Lampiran 4. Batang No. Diameter Tinggi (cm) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. (m) 13.0 16.53 17.0 25.80 19.3 21.26 20.0 25.50 23.0 22.50 25.0 17.10 26.0 21.30 27.2 16.50 29.1 26.30 30.5 22.60 32.7 21.92 34.3 28.10 36.5 19.05 38.4 23.73 39.0 27.90 40.5 23.30 41.3 27.67 43.0 30.86 44.1 21.52 45.0 27.74 47.0 27.78 48.0 20.80 50.0 31.20 53.0 20.40 54.5 30.90 55.2 28.00 57.0 30.08 59.5 25.05 61.0 30.65 62.0 28.04 63.0 26.20 65.3 29.94 72.0 28.57 74.0 34.80 76.0 24.28 82.0 28.60 Rata-rata total Sebaran persentase biomassa hasil destructive sampling 36 pohon Pinus merkusii strain Tapanuli di Tapanuli – Sumatera Utara kg 35.3 140.7 166.2 216.6 212.4 186.0 196.9 186.1 392.3 330.8 392.3 511.9 331.3 575.2 677.8 671.5 593.2 1112.7 585.5 953.6 766.4 753.0 1299.1 858.8 1294.3 1430.6 1221.8 1651.0 1692.6 1631.5 1776.4 1981.9 1817.8 2874.2 1854.8 2681.5 Cabang % 82.05% 81.71% 76.78% 82.25% 55.27% 50.14% 48.58% 38.02% 52.14% 48.45% 51.63% 63.00% 53.39% 56.81% 60.66% 56.07% 67.45% 63.29% 54.54% 62.27% 53.64% 57.61% 65.20% 48.08% 53.84% 58.10% 54.94% 48.00% 58.84% 66.08% 65.50% 59.15% 43.56% 54.56% 38.16% 53.84% 57.88% kg 0.6 7.1 15.1 10.2 17.1 32.5 44.0 53.2 52.7 75.2 145.0 89.7 74.6 140.1 145.9 173.8 52.3 148.2 138.0 114.7 260.0 127.5 139.9 278.7 419.6 264.2 359.9 674.0 596.5 354.1 399.7 764.3 1058.1 886.0 1377.7 892.4 Berat Kering (kg) Daun Ranting % 1.39% 4.12% 6.97% 3.87% 4.45% 8.76% 10.86% 10.87% 7.00% 11.01% 19.08% 11.04% 12.02% 13.84% 13.06% 14.51% 5.95% 8.43% 12.86% 7.49% 18.20% 9.76% 7.02% 15.60% 17.45% 10.73% 16.18% 19.59% 20.74% 14.34% 14.74% 22.81% 25.36% 16.82% 28.35% 17.92% 12.87% kg 2.3 3.7 5.8 5.7 8.0 8.5 8.3 38.2 15.8 16.8 38.8 27.6 50.9 46.0 45.3 63.9 13.1 45.8 59.3 57.3 34.2 65.1 52.4 138.9 60.6 111.7 58.3 181.1 101.0 74.1 79.5 62.6 159.7 128.7 304.0 146.6 % 5.35% 2.15% 2.66% 2.16% 2.08% 2.29% 2.05% 7.80% 2.10% 2.46% 5.11% 3.40% 8.20% 4.54% 4.05% 5.34% 1.49% 2.61% 5.52% 3.74% 2.39% 4.98% 2.63% 7.78% 2.52% 4.54% 2.62% 5.26% 3.51% 3.00% 2.93% 1.87% 3.83% 2.44% 6.25% 2.94% 3.74% kg 0.7 4.2 8.7 5.6 5.7 7.8 7.3 32.3 15.4 9.3 34.0 23.2 41.4 50.8 28.2 52.0 13.0 35.9 37.0 43.8 30.6 51.8 30.3 77.9 50.7 62.9 48.4 104.0 72.5 54.0 66.0 59.4 128.3 105.0 148.4 86.5 % 1.63% 2.44% 4.02% 2.13% 1.48% 2.10% 1.80% 6.60% 2.05% 1.36% 4.47% 2.86% 6.67% 5.02% 2.52% 4.34% 1.48% 2.04% 3.45% 2.86% 2.14% 3.96% 1.52% 4.36% 2.11% 2.55% 2.18% 3.02% 2.52% 2.19% 2.43% 1.77% 3.07% 1.99% 3.05% 1.74% 2.83% Buah kg 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.9 0.0 0.3 0.0 0.0 0.0 0.0 0.0 0.7 0.0 1.9 0.0 0.0 0.0 1.7 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Akar % kg 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.09% 0.00% 0.03% 0.00% 0.00% 0.00% 0.00% 0.00% 0.05% 0.00% 0.11% 0.00% 0.00% 0.00% 0.05% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.00% 0.01% 4.1 16.5 20.7 25.2 141.1 136.2 148.8 179.7 276.2 250.6 149.8 160.2 122.3 199.6 220.2 236.0 207.8 415.5 253.7 361.9 337.7 308.9 470.9 430.0 578.7 592.7 535.3 828.1 414.0 355.4 390.3 482.2 1009.2 1274.0 1175.4 1173.1 Total % 9.58% 9.58% 9.58% 9.58% 36.71% 36.71% 36.71% 36.71% 36.71% 36.71% 19.71% 19.71% 19.71% 19.71% 19.71% 19.71% 23.63% 23.63% 23.63% 23.63% 23.63% 23.63% 23.63% 24.07% 24.07% 24.07% 24.07% 24.07% 14.39% 14.39% 14.39% 14.39% 24.18% 24.18% 24.18% 23.56% 22.68% kg 43.0 172.2 216.5 263.3 384.3 371.0 405.3 489.5 752.4 682.7 759.9 812.6 620.5 1012.6 1117.4 1197.5 879.4 1758.1 1073.5 1531.3 1428.9 1307.0 1992.6 1786.2 2403.9 2462.1 2223.7 3439.9 2876.6 2469.1 2711.9 3350.4 4173.1 5267.9 4860.3 4980.1 % 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 100.00 127 Lampiran 5. Data biomassa yang menjadi input peubah bebas X untuk penyusunan persamaan allometrik untuk Pinus merkusii strain Tapanuli di Tapanuli – Sumatera Utara No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. Parameter Pertumbuhan D 13.0 17.0 19.3 20.0 23.0 25.0 26.0 27.2 29.1 30.5 32.7 34.3 36.5 38.4 39.0 40.5 41.3 43.0 44.1 45.0 47.0 48.0 50.0 53.0 54.5 55.2 57.0 59.5 61.0 62.0 63.0 65.3 72.0 74.0 75.0 76.0 79.5 82.0 86.0 95.0 104.0 110.9 115.5 120.6 H 16.53 25.80 21.26 25.50 22.50 17.10 21.30 16.50 26.30 22.60 21.92 28.10 19.05 23.73 27.90 23.30 27.67 30.86 21.52 27.74 27.78 20.80 31.20 20.40 30.90 28.00 30.08 25.05 30.65 28.04 26.20 29.94 28.57 34.80 36.00 24.28 32.50 28.60 33.00 35.00 36.00 38.00 37.00 36.50 WD 0.447 0.478 0.534 0.467 0.479 0.446 0.337 0.468 0.495 0.509 0.512 0.458 0.447 0.486 0.440 0.464 0.428 0.499 0.471 0.499 0.424 0.491 0.539 0.555 0.472 0.450 0.394 0.558 0.464 0.520 0.507 0.481 0.491 0.524 0.520 0.500 0.558 0.507 0.586 0.539 0.520 0.551 0.583 0.451 Peubah Bebas (X) D*H D*WD D*H*WD 214.89 5.82 96.15 438.60 8.13 209.63 410.32 10.32 219.30 510.00 9.34 238.20 517.50 11.03 248.14 427.50 11.15 190.65 553.80 8.76 186.67 448.80 12.74 210.18 765.33 14.41 379.04 689.30 15.52 350.82 716.78 16.73 366.76 963.83 15.69 440.96 695.33 16.32 310.85 911.23 18.65 442.66 1088.10 17.17 479.01 943.65 18.81 438.32 1142.77 17.67 489.02 1326.98 21.46 662.34 949.03 20.75 446.59 1248.30 22.45 622.66 1305.66 19.91 553.01 998.40 23.58 490.56 1560.00 26.94 840.58 1081.20 29.43 600.43 1684.05 25.75 795.62 1545.60 24.86 695.97 1714.56 22.48 676.19 1490.48 33.21 831.86 1869.65 28.30 867.41 1738.48 32.22 903.41 1650.60 31.97 837.56 1955.08 31.43 941.12 2057.04 35.32 1009.13 2575.20 38.78 1349.48 2700.00 39.00 1404.00 1845.28 38.02 923.02 2583.75 44.36 1441.73 2345.20 41.56 1188.54 2838.00 50.40 1663.07 3325.00 51.21 1792.18 3744.00 54.08 1946.88 4214.20 61.11 2322.02 4273.50 67.34 2491.45 4401.90 54.39 1985.26 Peubah Tak Bebas (Y) Above Ground Biomass (Kg) Below Ground Biomass (Kg) Total Biomass (Kg) AGB BGB TB 38.9 4.1 43.0 155.7 16.5 172.2 195.7 20.7 216.5 238.1 25.2 263.3 243.2 141.1 384.3 234.8 136.2 371.0 256.5 148.8 405.3 309.8 179.7 489.5 476.2 276.2 752.4 432.1 250.6 682.7 610.1 149.8 759.9 652.4 160.2 812.6 498.2 122.3 620.5 813.0 199.6 1012.6 897.2 220.2 1117.4 961.5 236.0 1197.5 671.6 207.8 879.4 1342.6 415.5 1758.1 819.8 253.7 1073.5 1169.4 361.9 1531.3 1091.2 337.7 1428.9 998.1 308.9 1307.0 1521.7 470.9 1992.6 1356.2 430.0 1786.2 1825.2 578.7 2403.9 1869.4 592.7 2462.1 1688.4 535.3 2223.7 2611.8 828.1 3439.9 2462.6 414.0 2876.6 2113.7 355.4 2469.1 2321.6 390.3 2711.9 2868.2 482.2 3350.4 3163.9 1009.2 4173.1 3993.9 1274.0 5267.9 3561.7 1124.8 4686.5 3684.9 1188.7 4873.6 3876.9 1224.3 5101.2 3807.0 1173.1 4980.1 4837.8 1527.7 6365.5 5758.9 1818.6 7577.5 6848.7 2162.8 9011.5 8710.4 2750.6 11461.0 9733.5 3073.8 12807.3 8018.1 2532.0 10550.1 128 Lampiran 6. Perbandingan nilai dugaan biomassa P. merkusii strain Tapanuli antara hasil dari persamaan allometrik Tapanuli dengan persamaan allometrik Cianten (Siregar, 2007) 2,4587 Y=0,1031(DBH) No. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. Diameter Berat Aktual a 13.0 43.02 17.0 172.20 19.3 216.47 20.0 263.33 23.0 384.27 25.0 371.00 26.0 405.28 27.2 489.50 29.1 752.42 30.5 682.74 32.7 759.87 34.3 812.55 36.5 620.50 38.4 1012.58 39.0 1117.45 40.5 1197.53 41.3 879.44 43.0 1758.09 44.1 1073.50 45.0 1531.29 47.0 1428.89 48.0 1306.98 50.0 1992.61 53.0 1786.20 54.5 2403.90 55.2 2462.12 57.0 2223.73 59.5 3439.90 61.0 2876.61 62.0 2469.05 63.0 2711.91 65.3 3350.40 72.0 4173.14 74.0 5267.90 76.0 4860.33 82.0 4980.10 Jumlah 62276.81 Rata-rata 1729.91 Cianten b 2,2757 Y = 0,2451(DBH) Tapanuli c 56.51 109.29 149.30 162.97 229.79 282.08 310.64 347.08 409.76 459.95 545.85 613.88 715.27 810.31 841.80 923.65 969.16 1070.21 1138.78 1196.77 1331.82 1402.58 1550.66 1789.52 1916.62 1977.72 2140.07 2378.28 2528.42 2631.55 2737.14 2989.41 3800.86 4065.73 4341.25 5233.02 54157.72 1504.38 Selisih Cianten - Aktual Selisih Tapanuli - Aktual b-a c-a 84.01 13.49 40.99 154.69 -62.91 -17.51 206.48 -67.17 -9.99 223.92 -100.36 -39.41 307.77 -154.47 -76.50 372.08 -88.92 1.08 406.82 -94.65 1.53 450.81 -142.42 -38.69 525.68 -342.66 -226.74 585.01 -222.79 -97.73 685.49 -214.01 -74.38 764.21 -198.67 -48.34 880.35 94.77 259.85 988.11 -202.26 -24.47 1023.60 -275.65 -93.85 1115.40 -273.88 -82.14 1166.17 89.72 286.73 1278.28 -687.88 -479.80 1353.92 65.28 280.42 1417.62 -334.51 -113.67 1565.08 -97.07 136.19 1641.89 95.60 334.91 1801.73 -441.96 -190.89 2057.21 3.32 271.01 2192.10 -487.28 -211.80 2256.70 -484.40 -205.42 2427.66 -83.66 203.93 2676.77 -1061.62 -763.13 2832.82 -348.19 -43.79 2939.61 162.50 470.55 3048.62 25.24 336.71 3307.82 -360.99 -42.58 4131.19 -372.28 -41.95 4396.97 -1202.17 -870.93 4672.09 -519.08 -188.25 5554.05 252.92 573.95 61492.70 -8119.09 -784.11 1708.13 -225.53 -21.78 129
Analysis of land cover changes, genetic structure, and carbon biomass stock of pinus Merkusii Jungh Et De Vriese Strain Tapanuli In Its Natural Distribution In North Sumatra Dolok Tusam Timur merkusii strain Tapanuli Ekstraksi DNA Analysis of land cover changes, genetic structure, and carbon biomass stock of pinus Merkusii Jungh Et De Vriese Strain Tapanuli In Its Natural Distribution In North Sumatra K-potensial tinggi tinggi sedang sedang rendah P-tersedia K-tersedia merkusii strain Tapanuli K-tersedia sangat tinggi sangat tinggi Kapasitas Tukar Kation KTK sangat rendah sangat rendah Kapasitas Tukar Kation KTK sangat rendah sangat rendah Kejenuhan Basa merkusii strain Tapanuli pada Sebaran Alaminya di Tapanuli P-potensial K-potensial merkusii strain Tapanuli P-potensial merkusii strain Tapanuli Parinsoran merkusii strain Tapanuli PCR Polymerase Chain Reaction Persentase C organik, Persentase N, dan C-N rasio pH tanah merkusii strain Tapanuli pH tanah Persentase C organik, Persentase N, dan C-N rasio sangat rendah sangat rendah rendah rendah rendah rendah rendah sangat rendah sangat rendah rendah rendah rendah rendah rendah rendah rendah rendah rendah sangat tinggi sangat tinggi sedang merkusii strain Tapanuli sedang sedang sedang sedang Seleksi Primer Analysis of land cover changes, genetic structure, and carbon biomass stock of pinus Merkusii Jungh Et De Vriese Strain Tapanuli In Its Natural Distribution In North Sumatra Seleksi Primer PCR Polymerase Chain Reaction tinggi tinggi sedang sedang rendah P-tersedia
Aktifitas terbaru
Penulis
Dokumen yang terkait
Tags

Semai Pinus Pinus Merkusii Jungh Et De Vriese

Upload teratas

Analysis of land cover changes, genetic structure, and carbon biomass stock of pinus Merkusii Jungh Et De Vriese Strain Tapanuli In Its Natural Distribution In North Sumatra

Gratis