Penentuan Jenis Kelamin pada Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR)

Gratis

0
10
88
2 years ago
Preview
Full text
RINGKASAN ISYANA KHAERUNNISA. D14080155. 2012. Penentuan Jenis Kelamin pada Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR). Skripsi. Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan, Institut Pertanian Bogor. Pembimbing Utama : Dr. Jakaria, S.Pt., M.Si. Pembimbing Anggota : Maria Ulfah, S.Pt., M.Sc.Agr. Jenis kelamin pada Aves penting diketahui untuk berbagai tujuan terutama dalam bidang pemuliaan, konservasi dan pengembangan keilmuan. Penentuan jenis kelamin sulit dilakukan pada beberapa jenis Aves, terutama pada jenis-jenis burung monomorfik seperti kakatua (Psittacidae) dan beo (Sturnidae). Hal ini menyebabkan hampir semua breeder mengalami kesulitan dalam menentukan jenis kelamin burung-burung tersebut. Pendekatan teknologi berbasis molekuler dapat diterapkan untuk menentukan jenis kelamin dengan menggunakan gen penanda jenis kelamin, yaitu gen Chromodomain Helicase DNA-binding (CHD). Gen ini digandakan melalui proses Polymerase Chain Reaction (PCR). Polymerase Chain Reaction (PCR) dilakukan untuk menggandakan jumlah molekul DNA secara in vitro dengan bantuan enzim polimerase dan primer (Williams, 2005). Penelitian ini dilakukan untuk menentukan jenis kelamin pada beberapa jenis Aves berdasarkan gen CHD-W dan CHD-Z menggunakan primer 2550F dan 2718R. Jenis-jenis aves yang diuji yaitu Gallus gallus domesticus (ayam Kampung), Coturnix coturnix japonica (puyuh jepang), Anas platyrhynchos (itik), Columba livia (merpati), Gracula religiosa robusta (beo nias), Cacatua moluccencis (kakatua maluku), dan Cacatua sulphurea (kakatua-kecil Jambul-kuning). Sebanyak 21 sampel Aves diperoleh dalam bentuk darah dan bulu, kemudian diekstraksi untuk mendapatkan DNA total. DNA kemudian diamplifikasi dengan bantuan primer 2550F dan 2718R (Fridolfsson dan Ellegren, 1999) dan dielektroforesis menggunakan Agarose Gel dengan konsentrasi 1,5%. Visualisasi DNA menggunakan bantuan sinar ultraviolet. Jenis kelamin pada Aves ditentukan dengan jumlah pita hasil elektroforesis. Pita tunggal menunjukkan jenis kelamin jantan, dan pita ganda menujukkan jenis kelamin betina. Hasil penelitian menunjukkan bahwa seluruh sampel Aves dapat diidentifikasi jenis kelaminnya. Seluruh sampel dari Aves jantan menunjukkan pita tunggal (ZZ), sedangkan pada betina menunjukkan dua pita (ZW), kecuali pada itik dan merpati. Betina pada itik dan merpati dapat dibedakan dengan jantannya, meskipun keduanya ditunjukkan dengan pita tunggal. Pita yang muncul di sampel itik dan merpati betina adalah pita W, sedangkan pita Z tidak terdeteksi. Kata-kata kunci: penentuan jenis kelamin, gen CHD, PCR, Aves ii ABSTRACT Avians Sex Determination Using Polymerase Chain Reaction (PCR) Method Khaerunnisa, I., Jakaria, and M. Ulfah Many avian species are sexually monomorphic. In this case, molecular approach is an efficient method for sex determination. The sexes of monomorphic avians can be determined by PCR amplification of the CHD genes. CHD genes are preserved within avian Z and W sex chromosomes. The objective of this research was to determine sex of chickens, quails, ducks, pigeons, hill myna, salmon-crested cockatoos, and yellow-crested cockatoos based on CHD gene using primer 2550F and 2718R. PCR products were screened by 1.5% agarose gel electrophoresis with Ethidium Bromide. According to the results 10 males and 11 females were determined from 21 specimens of avians. Individuals showed double (ZW) and single (ZZ) bands were identified as females and males, respectively in chickens, quails, hill myna, salmon-crested cockatoos and yellow-crested cockatoos. Males and females in ducks and pigeons showed single band in different length of basepairs. Keywords: sex determination, CHD genes, PCR, avian iii PENDAHULUAN Latar Belakang Jenis kelamin pada Aves penting diketahui untuk berbagai tujuan terutama dalam bidang pemuliaan, diantaranya untuk menentukan pejantan dan induk, pengendalian rasio jenis kelamin (Nicholas, 2004), dan pemasangan jantan dan betina dalam satu kandang di penangkaran. Penentuan jenis kelamin pada jenis-jenis burung monomorfik seperti kakatua (Psittacidae) dan beo (Sturnidae) sulit dilakukan, terlebih ketika burung belum mencapai dewasa kelamin. Hal ini menyebabkan hampir semua breeder mengalami kesulitan dalam menentukan jenis kelamin burung-burung tersebut. Jenis kelamin dapat diidentifikasi menggunakan beberapa pendekatan, diantaranya: (a) pengamatan tingkah laku, (b) adanya brooding patch, (c) perbedaan dalam pola morfometrik, (d) pemeriksaan gonad menggunakan laparoscopy, dan (e) pemeriksaan kromosom jenis kelamin. Metode pertama dan kedua dapat diterapkan secara umum hanya pada musim kawin, dan analisis morfometrik dapat menimbulkan bias. Pemeriksaan gonad sulit dilakukan di luar musim kawin (ketika gonad mengecil) dan karena ukuran tubuh Aves yang relatif kecil dibandingkan dengan ternak lainnya (Dubiec dan Zagalska-Neubauer, 2006). Pendekatan teknologi berbasis molekuler dapat diterapkan untuk mengidentifikasi jenis kelamin dengan menggunakan gen penanda jenis kelamin, yaitu gen Chromodomain Helicase DNA-binding (CHD). Gen CHD berada di kromosom W dan Z, yang terdiri dari CHD-W (berada pada kromosom W) dan CHD-Z (berada pada kromosom Z) (Dubiec dan Zagalska-Neubauer, 2006). Metode ini memberikan hasil yang lebih akurat untuk menentukan jenis kelamin dibandingkan dengan menggunakan metode lainnya. Selain itu, metode ini dapat dilakukan pada saat Aves baru menetas atau belum mencapai dewasa kelamin. Gen CHD dapat diidentifikasi dengan primer 2550F dan 2718R (Fridolfsson dan Ellegren, 1999) melalui metode Polymerase Chain Reaction (PCR). Teknik ini digunakan untuk menggandakan jumlah molekul DNA secara in vitro dengan bantuan enzim polimerase dan primer (Williams, 2005). Sumber DNA genom pada Aves secara umum dapat diperoleh dari darah (Dubiec dan Zagalska-Neubauer, 2006). DNA juga dapat diperoleh melalui isolasi 1 dari bulu burung. Koleksi sampel bulu menimbulkan rasa sakit yang lebih sedikit daripada pengambilan darah. Selain itu, biaya yang dibutuhkan lebih murah dan dapat mengurangi risiko kontaminasi (Cerit dan Avanus, 2007). Penelitian serupa telah banyak dilakukan di beberapa negara, seperti identifikasi jenis kelamin burung paruh bengkok Nymphicus hollandicus di Turki (Cerit dan Avanus, 2007), puyuh jepang di Eropa (Morinha et al., 2011), berbagai jenis burung di Amerika Serikat (Kahn et al., 1998), burung laut di Pasifik Utara dan Laut Bering (Dawson et al., 2001), burung-burung di Asia Timur (Lee et al., 2008) dan lainnya. Sedangkan di Indonesia belum tersedia informasi mengenai penelitian penentuan jenis kelamin berbasis molekuler pada Aves, terutama untuk jenis-jenis burung endemik Indonesia. Tujuan Penelitian ini dilakukan untuk menentukan jenis kelamin pada beberapa jenis Aves berdasarkan gen CHD-W dan CHD-Z menggunakan primer 2550F dan 2718R. Jenis-jenis Aves yang diuji yaitu Gallus gallus domesticus (ayam Kampung), Coturnix coturnix japonica (puyuh jepang), Anas platyrhynchos (itik), Columba livia (merpati), Gracula religiosa robusta (beo nias), Cacatua moluccencis (kakatua maluku), dan Cacatua sulphurea (kakatua-kecil Jambul-kuning). 2 TINJAUAN PUSTAKA Klasifikasi Aves Aves adalah hewan yang tubuhnya tertutup bulu, tidak memiliki gigi, berjalan dengan dua kaki, dan memiliki struktur tulang yang termodifikasi untuk terbang (Stevens, 1996). Welty (1982) menambahkan bahwa Aves memiliki tungkai atau lengan depan termodifikasi untuk terbang, tungkai belakang teradaptasi untuk berjalan, berenang dan hinggap, jantung memiliki empat ruang, rangka ringan, memiliki kantong udara, berdarah panas, tidak memiliki kandung kemih dan bertelur. Ayam Kampung Indonesia memiliki berbagai jenis ayam lokal, baik yang asli maupun hasil adaptasi yang dilakukan puluhan bahkan ratusan tahun yang lalu. Ayam lokal yang tidak memiliki karakteristik khusus disebut sebagai ayam Kampung. Masyarakat pedesaan umumnya memelihara ayam Kampung untuk mendapatkan daging, telur maupun sebagai tabungan yang sewaktu-waktu dapat diuangkan (Nataamijaya, 2010). Mansjoer (1985) menyatakan bahwa ayam Kampung tidak mempunyai ciriciri tertentu atau dengan kata lain penampilan fenotipenya masih sangat beragam. Keragaman ciri-ciri sifat kualitatif terutama pada corak bulu, warna kulit cakar dan bentuk jengger. Identifikasi jenis kelamin ayam Kampung dapat dilakukan sejak DOC dengan vent method. Metode ini membutuhkan keahlian yang tinggi, sehingga masih sedikit orang yang dapat melakukannya. Piliang (1992) menyatakan bahwa metode ini dilakukan dengan melihat organ kopula rudimenter di dalam kloaka. DOC jantan akan tampak papila yang menonjol, sedangkan pada betina tidak terdapat. Puyuh Puyuh jepang merupakan subspesies yang berasal dari Asia. Jenis ini dimanfaatkan untuk diambil daging dan telurnya (Minvielle, 2004). Puyuh dewasa menunjukkan sexual dimorfism, tetapi pada puyuh anakan (DOQ) sulit untuk ditentukan jenis kelaminnya berdasarkan fenotipe. Puyuh jantan memiliki bulu putih yang berbentuk garis melengkung tebal di bagian kepala sampai ke bagian belakang, bulu leher dan dadanya berwarna cokelat muda (cinamon) tanpa ada bercak kehitaman, bulu punggung berwarna campuran cokelat gelap, abu-abu dengan garis putih, bulu sayap seperti bulu punggung dengan belang kehitaman, panjang sayap kira-kira 89 cm. Puyuh jantan muda mulai bersuara atau berkicau pada umur 5-6 minggu. Selama puncak musim kawin, puyuh jantan akan berkicau setiap malam dengan suara keras. Puyuh betina dewasa memiliki warna tubuh yang mirip dengan puyuh jantan, kecuali warna bulu pada kerongkongan dan dada bagian atas puyuh betina berwarna cokelat muda lebih terang (sawo matang) dengan bercak cokelat tua atau kehitam-hitaman (Kasiyati, 2009). Sebagian puyuh dewasa juga sulit dibedakan jenis kelaminnya karena memiliki pola fenotipe yang sulit didefinisikan (Morinha et al., 2011). Vali dan Doosti (2011) juga mengungkapkan bahwa penentuan jenis kelamin puyuh jepang dewasa dan DOQ sulit dilakukan. Itik Itik merupakan salah satu ternak unggas yang dikenal sebagai penghasil telur dan daging. Itik alabio, itik bali, itik mojosari dan itik pegagan adalah bangsa itik lokal yang dikenal sebagai penghasil telur (Brahmantiyo et al., 2003). Itik mojosari menunjukkan potensi produksi telur yang cukup baik, yang sebanding dengan potensi produksi jenis-jenis itik lokal yang lain, sehingga layak untuk dipakai dalam program persilangan (Prasetyo dan Susanti, 1997). Pola warna bulu itik mojosari sebagian besar didominasi oleh warna lurik-coklat gelap. Variasi warna diantaranya adalah kombinasi warna lurik dengan belang putih pada daerah leher dan bagian dada (Suparyanto, 2003). Karakteristik itik mojosari menurut Prasetyo et al. (1998) memiliki bentuk tubuh seperti botol dan berjalan tegak, warna bulu itik jantan maupun betina tidak berbeda, yaitu berwarna kemerah-merahan dengan variasi coklat, hitam dan putih. Itik jantan dan betina dapat dibedakan dari bulu ekor, yaitu selembar atau dua lembar ekor yang melengkung ke atas pada jantan. Warna paruh dan kaki itik jantan lebih hitam daripada itik betina. Merpati Merpati lokal yang terdapat di Indonesia adalah burung merpati pendatang yang berasal dari burung merpati liar (Columba livia) yang penyebaran aslinya di daerah Eropa (Antawidjaja, 1988). Merpati dapat beradaptasi dengan mudah di darat 4 maupun di udara, lehernya panjang dan fleksibel, kepalanya termasuk besar, karena mempunyai otak yang besar, tubuhnya kompak dan kaku, organ vitalnya terlindungi secara baik terhadap serangan musuhnya (Levi, 1945). Merpati betina biasanya lebih kecil dan tidak terlalu ribut dibandingkan dengan merpati jantan saat kawin. Ukuran tubuh merpati jantan lebih besar dangan tekstur bulu lebih besar dan bulu leher tebal. Merpati jantan pada saat bercumbu membuat gerakan melingkar, memekarkan bulu ekor dan menjatuhkan atau merebahkan sayap (Blakely dan Bade, 1998). Beo Nias Burung beo memiliki kepandaian dalam menirukan suara yang didengarnya, sehingga banyak disukai oleh masyarakat. Gracula religiosa adalah burung monomorfik, yaitu sulit dibedakan antara jantan dan betina, dan tergolong Appendix II dalam CITES (Soehartono dan Mardiastuti, 2002). Identifikasi jenis kelamin pada beo dapat dilakukan dengan pengamatan tingkah laku. Berdasarkan hasil penelitian Hayati (1999), tingkat keaktifan dan perilaku state (memeriksa sarang, masuk sarang dan membawa bahan sarang) lebih banyak dilakukan oleh individu jantan. Individu betina lebih aktif dalam mendekati pasangannya. Kakatua Kakatua tergolong burung paruh bengkok (Psittacines). Burung-burung tersebut banyak diminati di pasar dalam negeri maupun luar negeri karena berbagai alasan, diantaranya memiliki tingkat kecerdasan yang tinggi, jinak, warna bulu yang cerah, dan mampu meniru berbagai suara (Soehartono dan Mardiastuti, 2002). Identifikasi jenis kelamin burung paruh bengkok di daerah tropis sulit dilakukan karena tidak menunjukkan perbedaan morfologi eksternal (Miyaki et al., 1998). Kakatua Maluku. Kakatua maluku (Cacatua moluccensis) merupakan jenis burung endemik di kepulauan Maluku. C. moluccensis memiliki bulu tubuh dengan warna merah muda dengan panjang tubuh 52 cm (Astuti, 2011). Jenis ini digolongkan Appendix I dalam CITES (Soehartono dan Mardiastuti, 2002) dan tergolong terancam punah (Coates dan Bishop, 2000). 5 Kakatua-kecil Jambul-kuning. Keberadaan kakatua-kecil Jambul-kuning di alam bebas mendekati kepunahan akibat perburuan liar dan deforestasi habitat, serta tergolong Appendix II dalam CITES (Soehartono dan Mardiastuti, 2002). Jenis ini terancam punah akibat penangkapan yang berlebihan untuk perdagangan burung dalam sangkar, dan sekarang langka akibat kegiatan ini (Coates dan Bishop, 2000). A C E B.1 B.2 D F G Gambar 1. Beberapa Jenis Aves (A) Ayam Kampung1, (B.1) Puyuh Jepang Jantan2, (B.2) Puyuh Jepang Betina2, (C) Itik3, (D) Merpati4, (E) Beo Nias5, (F) Kakatua Maluku4, dan (G) Kakatua-kecil Jambul-kuning4 Sumber : 1. Nataamijaya (2010) 2. Kasiyati (2009) 3. www.deptan.go.id 4. Coastes dan Bishop (2000) 5. MacKinnon et al. (2010) 6 Tabel 1. Klasifikasi Taksonomi Beberapa Species dari Kelas Aves No. Ordo Famili Genus Species Nama Lokal Nama Umum Pustaka 1. Galliformes Phasianidae Gallus Gallus gallus domesticus Ayam Kampung Kampung chicken Al-Nasser et al. (2007) 2. Galliformes Phasianidae Coturnix Coturnix coturnix japonica Puyuh jepang Japanese quail Nishibori et al. (2002) 3. Anseriformes Anatidae Anas Anas platyrhynchos Itik Duck Srigandono (1998) 4. Columbiformes Columbidae Columba Columba livia Merpati Pigeon Radioputro (1985) 5. Passeriformes Sturnidae Gracula Gracula religiosa robusta Beo nias Hill myna Monroe dan Sibley (1993) 6. Psittaciformes Psittacidae Cacatua Cacatua moluccensis Kakatua maluku Salmon-crested cockatoo Forshaw (1989) 7. Psittaciformes Psittacidae Cacatua Cacatua sulphurea Kakatua-kecil Jambul-kuning Yellow-crested cockatoo Forshaw (1989) 7 Penentuan Jenis Kelamin pada Aves Determinasi jenis kelamin sangat diperlukan untuk memahami bentuk-bentuk tingkah laku, perubahan ekologi, genetika dan evolusi (Clutton-Brock, 1986). Jenis kelamin dapat diidentifkasi menggunakan beberapa pendekatan, diantaranya: (a) pengamatan tingkah laku, (b) ada tidaknya brooding patch, (c) perbedaan dalam pola morfometrik, (d) pemeriksaan gonad menggunakan laparoscopy, dan (e) pemeriksaan kromosom jenis kelamin (Dubiec dan Zagalska-Neubauer, 2006). Metode pertama dan kedua dapat diterapkan secara umum hanya pada musim kawin, dan analisis morfometrik dapat menimbulkan bias. Beberapa kasus menunjukkan bahwa pembedaan jenis kelamin berdasarkan pada morfologi sulit dilakukan (Kocijan et al., 2011; Lee et al., 2008). Pemeriksaan gonad menggunakan laparoscopy dan pemeriksaan kromosom jenis kelamin dapat digunakan untuk menentukan jenis kelamin pada Aves monomorfik (Griffiths, 2000). Namun, pemeriksaan gonad sulit dilakukan di luar musim kawin (ketika gonad mengecil) dan karena ukuran tubuh Aves yang relatif kecil dibandingkan dengan ternak lainnya (Dubiec dan Zagalska-Neubauer, 2006). Selain kelima metode tersebut, dapat juga dilakukan autosexing. Metode autosexing dapat dilakukan untuk membedakan jenis kelamin unggas dari pertumbuhan bulu (Mincheva et al., 2012), warna bulu, dan warna kerabang telur (Lalev et al., 2012). Mincheva et al. (2012) menyebutkan bahwa adanya alel pertumbuhan bulu cepat dan lambat pada ayam White Plymouth Rock memungkinkan untuk dilakukan autosexing berdasarkan laju pertumbuhan bulu. Ayam jantan akan memiliki frekuensi alel pertumbuhan bulu lambat yang lebih tinggi daripada ayam betina. Secara umum, determinasi jenis kelamin pada Aves cukup sulit sebelum dewasa. Namun, pada jenis-jenis monomorfik hal ini sulit dilakukan meskipun telah melewati masa pubertas. Beberapa jenis Aves seperti ayam, kalkun, itik, angsa, burung hantu dan burung paruh bengkok sulit untuk diidentifikasi jenis kelaminnya secara morfologis (Griffiths dan Tiwari, 1995; Griffiths et al., 1998). Teknik PCR dengan menggunakan primer spesifik untuk penentuan jenis kelamin telah diketahui dapat digunakan sebagai penentu jenis kelamin burung monomorfik (Ellegren, 1996). Teknik ini dapat mendeteksi adanya kromosom W dan Z melalui gen yang berada 8 pada kedua kromosom tersebut, yaitu gen Chromodomain Helicase DNA-binding (Ellegren, 2001; Dubiec dan Zagalska-Neubauer, 2006; Cerit dan Avanus, 2007). Gen Chromodomain Helicase DNA-binding (CHD) Betina pada Aves membawa masing-masing satu kopi kromosom Z dan W (heterogamet), sedangkan jantan adalah homogamet (membawa sepasang kromosom Z) (Ellegren, 2001). Terdapat dua gen yang diketahui terdapat pada kromosom W, yaitu CHD-W dan ATP synthesis α-sub unit (ATP5AW). Kedua gen tersebut berada pada bagian nonrekombinan kromosom W. Bagian homolog dari kedua gen tersebut (yaitu CHD-Z dan ATP5AZ) terdapat pada kromosom Z (Cerit dan Avanus, 2007). Gen merupakan penanda yang paling akurat untuk identifikasi jenis kelamin karena gen terbuat dari DNA fungsional dan berubah sangat lambat. Gen CHD pada kromosom Z dan W dapat dijadikan penanda yang paling umum digunakan untuk identifikasi jenis kelamin pada Aves (Dubiec dan Zagalska-Neubauer, 2006). Perbedaan rekombinasi diantara fragmen Z dan W pada gen ini menunjukkan bahwa keduanya berada di luar pseudoautosomal region. CHD terdiri dari dua intron yang berlokasi diantara fragmen-fragmen yang berubah dengan sangat lambat, dimana intron pada kromosom Z berbeda panjangnya dengan intron pada kromosom W. Pasangan primer digunakan dalam penentuan jenis kelamin yang dirancang untuk membatasi fragmen gen dalam intron. Hal ini menyebabkan dapat dibedakannya produk dari kromosom Z dan W dalam gel. Oleh sebab itu, jantan diidentifikasi dengan satu pita dan betina diidentifikasi dengan dua pita dalam gel (Gambar 2), dengan beberapa pengecualian (Dubiec dan Zagalska-Neubauer, 2006). Gambar 2. Penentuan Jenis Kelamin pada Aves: (1) dan (3) Jantan, (2) dan (4) Betina Sumber : Dawson et al. (2001) 9 Sumber DNA Total Teknik PCR memerlukan suatu DNA cetakan (DNA template) yang akan diperbanyak secara in vitro. DNA terdapat pada semua makhluk hidup mulai dari mikroorganisme sampai organisme tingkat tinggi seperti manusia, hewan dan tanaman. DNA terdapat di dalam sel dan di dalam inti sel. DNA yang terdapat di dalam sel dapat berupa DNA mitokondria, DNA kloroplas (pada tumbuhan) atau DNA penyusun kromosom (pada mikroorganisme), sedangkan DNA yang terdapat di dalam inti sel disebut juga sebagai DNA inti. Keseluruhan DNA yang menyusun masing-masing komponen tersebut disebut sebagai DNA genom (Muladno, 2002). Sel terdapat di semua bagian tubuh makhluk hidup, sehingga DNA dapat diekstrak dari segala macam organ tubuh (Muladno, 2002). Sumber DNA pada Aves secara umum dapat diperoleh dari darah. Darah dalam jumlah sedikit dapat dikumpulkan dengan mengambil darah pada bagian vena lengan atau sayap (tergantung spesies dan umur Aves) (Dubiec dan Zagalska-Neubauer, 2006). DNA juga dapat diperoleh melalui isolasi dari bulu burung, karena koleksi sampel bulu menimbulkan rasa sakit yang lebih sedikit daripada pengambilan darah. Selain itu, biaya yang dibutuhkan lebih murah dan dapat mengurangi risiko kontaminasi (Cerit dan Avanus, 2007). Ekstraksi DNA dari fosil, spesimen museum, sampel forensik, rambut atau bulu dan feses biasanya lebih sulit dilakukan (Taberlet et al., 1996). Ekstraksi dan purifikasi DNA pada prinsipnya adalah suatu cara atau metode untuk memisahkan DNA total dari komponen sel lainnya (Sulandari dan Zein, 2003). Isolasi DNA dari organisme eukariote (seperti hewan, manusia dan tanaman) biasanya dilakukan melalui proses penghancuran sel, pemusnahan protein dan RNA, dan pemurnian DNA. Secara kimiawi penghancuran sel dilakukan dengan memanfaatkan senyawa kimia seperti lisozim, EDTA (etilendiamin tetraasetat) dan SDS (sodium dodesil sulfat). Protein dan RNA dihilangkan menggunakan phenol, chloroform dan enzim proteinase. Pemberian etanol dan NaCl dilakukan untuk memurnikan DNA (Muladno, 2002). Kualitas dan jumlah DNA yang diperoleh dapat bervariasi tergantung asal jaringan, metode penyimpanan, dan cara ekstraksi. Pengukuran kualitas dan jumlah DNA dapat dilakukan dengan alat spektrofotometer atau dengan melihat intensitas molekul DNA dalam gel. Tingkat kemurnian berkorelasi dengan kualitas DNA. 10 Kemurnian DNA ditentukan dengan menghitung rasio antara nilai A260 dan A280 pada sampel DNA yang diukur menggunakan spektrofotometer (Muladno, 2002). Molekul DNA dikatakan murni apabila rasio kedua nilai tersebut lebih dari 1,8 (Marerro et al., 2009). Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) merupakan teknik untuk menggandakan jumlah molekul DNA secara in vitro. Proses ini berjalan dengan bantuan enzim polimerase dan primer. Primer merupakan oligonukleotida spesifik pada DNA template yang berukuran pendek, yaitu sekitar 18-24 pasang basa. Primer akan menempel pada DNA cetakan di tempat spesifik. Enzim polimerase merupakan enzim yang dapat mencetak urutan DNA baru. Hasil PCR dapat langsung divisualisasikan dengan elektroforesis atau dapat digunakan untuk analisis lebih lanjut (Williams, 2005). PCR diaplikasikan dalam diagnosis dan dalam deteksi gen tertentu (baik yang menguntungkan maupun yang membahayakan) pada ternak domestik (Nicholas, 2004). Prinsip perbanyakan molekul DNA pada target yang diinginkan melalui teknik PCR terdiri dari denaturasi, annealing, dan ekstensi. Denaturasi awal dilakukan sebelum enzim Taq polymerase ditambahkan. Proses ini berlangsung selama tiga menit untuk meyakinkan bahwa molekul DNA yang ditargetkan ingin dilipatgandakan jumlahnya benar-benar telah terdenaturasi menjadi DNA untai tunggal. Denaturasi berikutnya membutuhkan waktu 30 detik pada suhu 95 oC. Pada suhu 95 oC molekul DNA mengalami denaturasi sehingga strukturnya berubah dari untai ganda menjadi untai tunggal. Suhu kemudian diturunkan menjadi 50 oC sampai 60 oC. Pada kisaran suhu ini akan terjadi annealing atau penempelan primer. Primer forward dan primer reverse akan berkomplemen dengan posisi komplemen masingmasing. Setelah kedua primer tersebut menempel di posisi masing-masing, enzim Taq polymerase mulai mensintesis molekul DNA baru dari ujung 3’ masing-masing primer ke ujung 5’. Sintesa molekul DNA baru ini terjadi pada suhu 72 oC. Proses ini disebut dengan ekstensi. Siklus PCR biasanya berlangsung sebanyak 30 - 35 kali (Muladno, 2002). 11 MATERI DAN METODE Lokasi dan Waktu Penelitian dilaksanakan di Laboratorium Genetika Molekuler Ternak, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan IPB dan Laboratorium Terpadu, Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan IPB. Penelitian ini dilakukan pada bulan Januari sampai dengan bulan Mei 2012. Materi Sampel Sampel darah sebagai sumber DNA diambil dari ayam, puyuh, itik dan merpati. Sedangkan sampel bulu diambil dari beo nias, kakatua maluku, kakatuakecil Jambul-kuning. Sumber dan jumlah masing-masing tersebut ditunjukkan pada Tabel 2, sedangkan gambar sampel-sampel Aves yang digunakan ditunjukkan pada Gambar 3. Bahan-bahan yang digunakan dalam mengambil sampel darah diantaranya kapas, alkohol dan EDTA. Alat-alat yang dibutuhkan diantaranya spoit, pipa kapiler haematokrit dan tabung 1,5 ml. Sedangkan untuk menyimpan sampel bulu digunakan plastik seal kemudian disimpan di dalam freezer. Tabel 2. Sampel Aves yang Digunakan dalam Penelitian Jenis Aves Lokasi Pengambilan Sampel Jenis Sampel Jumlah (ekor) ♂ ♀ Ayam Kampung Kandang ABC Fakultas Peternakan IPB Darah 2 2 Jenis Kelamin tidak diketahui - Puyuh jepang Kandang B Fakultas Peternakan IPB Darah 2 2 - Itik Kandang B Fakultas Peternakan IPB Darah 2 2 - Merpati Dramaga, Bogor Darah 2 2 - Beo nias Penangkaran Burung Megananda Bird Orchid Farm (MBOF), Ciluer, Bogor Bulu - - 1 Kakatua maluku Penangkaran Burung Megananda Bird Orchid Farm (MBOF), Ciluer, Bogor Bulu - - 2 Kakatua-kecil Jambul-kuning Penangkaran Burung Megananda Bird Orchid Farm (MBOF), Ciluer, Bogor Bulu - - 2 A.1 A.2 B.1 C B.2 D F E G Gambar 3. Sampel Aves yang Digunakan dalam Penelitian: (A.1) Ayam Kampung Jantan, (A.2) Ayam Kampung Betina, (B.1) Puyuh Jantan, (B.2) Puyuh Betina, (C) Itik, (D) Merpati, (E) Beo Nias, (F) Kakatua Maluku, dan (G) Kakatua kecil-Jambul kuning Sumber : Dokumentasi Pribadi 13 Ekstraksi DNA Total Bahan-bahan yang dibutuhkan untuk ekstraksi DNA dari sampel darah diantaranya RBC lysis buffer, buffer 1x STE, SDS (Sodium Dodesil Sulfat) 10%, Proteinase K (5 mg/ml), phenol, CIAA (Chloroform Isoamil Alkohol), NaCl (5 M), EtOH 96% dan TE 80%. Peralatan yang digunakan diantaranya satu set micropippet beserta tipnya, vortex, sentrifuge, inkubator, dan freezer. Ekstraksi DNA dari sampel bulu menggunakan bahan-bahan Yang with Urea, Proteinase K (10 mg/ml), PB Buffer, PE Buffer, dan Elution Buffer. Alat-alat yang digunakan diantaranya satu set micropippet beserta tipnya, sentrifuge, inkubator, tabung spin, tabung 1,5 ml dan spektrofotometer. Polymerase Chain Reaction Bahan-bahan yang digunakan dalam PCR adalah sampel DNA, destilation water, 10 x buffer, MgCl2, pasangan primer forward dan reverse, enzim Taq polymerase dan dNTPs. Alat-alat yang digunakan diantaranya mesin PCR thermocycler, vortex, micro sentrifuge, tabung PCR, satu set mikopipet dan tipnya, dan refrigerator. Primer yang digunakan dalam penelitian ini berdasarkan Fridolfsson dan Ellegren (1999) yaitu 2550F dan 2718R yang terdiri dari: primer forward: 5´-GTT ACT GAT TCG TCT ACG AGA-3´ dan primer reverse: 5´-ATT GAA ATG ATC CAG TGC TTG-3´. Sekuen gen CHD diperoleh dari NCBI (http://www.ncbi.nlm.nih.gov/). Nomor akses dari sekuen gen CHD-Z dan CHD-W merpati masing-masing adalah AY517719 dan AY517718. Nomor akses dari sekuen gen CHD-Z dan CHD-W pada ayam Hutan masing-masing adalah GU132943 dan GU132944. Agarose Gel Electrophoresis Bahan-bahan yang digunakan untuk membuat agarose gel 1,5% diantaranya larutan 0,5 x TBE (Tris-Borat EDTA) 30 ml, serbuk agarose 0,45 gram, EtBr 2,5 μl. Bahan-bahan lainnya yang dibutuhkan dalam elektroforesis menggunakan gel agarose adalah sampel DNA hasil PCR, loading dye (0,01% Xylene Cyanol, 0,01% Bromtimol Blue, 50% gliserol), dan marker 100 bp. Peralatan yang digunakan 14 diantaranya satu set tray pencetak gel, timbangan digital, power supply 100 volt, pipet mikro, tip, beaker glass, microwave, stirrer, dan UV Transilluminator. Prosedur Pengambilan Sampel Darah dan Bulu Sampel darah diperoleh dengan mengambil darah menggunakan spoit atau pipa kapiler haematokrit di vena axillaris bagian sayap. Bagian kulit yang akan diambil darahnya dioles alkohol terlebih dahulu. Darah yang diambil sebanyak 1,5 ml kemudian dimasukkan ke dalam tabung 1,5 ml dan dicampur dengan serbuk EDTA agar tidak menggumpal. Sampel darah disimpan dalam refrigerator (suhu + 4 o C) sebelum diproses lebih lanjut. Sedangkan sampel bulu yang didapatkan segera dikemas dalam plastik seal dan disimpan di dalam freezer sebelum diekstraksi. Ekstraksi DNA Total Sampel Darah. Ekstraksi DNA dilakukan menggunakan acuan Sambrook et al. (1989) yang dimodifikasi. Sebanyak 50 µl darah ditambahkan dengan 800 µl RBC lysis buffer, kemudian disentrifugasi 800 rpm selama lima menit hingga terbentuk endapan. Endapan tersebut ditambah dengan 1 x STE sebanyak 300 µl, 40 µl 10% SDS dan 10 µl Proteinase K 5 mg/ml lalu diinkubasi selama dua jam dengan suhu 55 o C. Setelah itu ditambahkan 400 µl phenol, 400 µl CIAA dan 40 µl NaCl 5M, kemudian digoyang pelan di suhu ruang selama satu jam. Tahap selanjutnya adalah sentrifugasi dengan kecepatan 12000 rpm selama lima menit. Sebanyak 400 µl cairan bening di lapisan paling atas dipindahkan ke tabung baru dan ditambahkan 800 µ l EtOH absolut (70%) dan 40 µl NaCl 5 M lalu dibekukan selama 12 jam. Sampel kemudian disentrifugasi dengan kecepatan 12000 rpm selama lima menit dan terbentuk endapan putih. Endapan tersebut ditiriskan dan ditambah dengan 100 µl TE 80%. Sampel Bulu. Sampel bulu bagian calamus (Gambar 4) dipotong kecil dan masingmasing ditambahkan 1000 µl Yang with Urea dan 100 µl Proteinase K (10 mg/ml) lalu diinkubasi selama 12 jam pada suhu 38 oC. Selanjutnya, sampel ditambahkan dengan 20 µl Proteinase K (10 mg/ml) dan diinkubasi pada suhu 55 oC selama dua jam. Sampel disentrifugasi dengan kecepatan 2000 rpm selama lima menit. Sebanyak 15 500 µl sampel diambil, kemudian ditambahkan dengan 2500 µl PB Buffer. Campuran tersebut dipindahkan ke tabung spin column sebanyak 750 µl dan disentrifugasi dengan kecepatan 13000 rpm selama satu menit. Tahapan ini diulangi hingga seluruh campuran sampel dan PB Buffer habis. Sebanyak 750 µl PE Buffer dimasukkan ke dalam tabung spin column dan disentrifugasi kembali dengan kecepatan 13000 rpm selama satu menit. Kemudian ditambahkan 50 µl Elution Buffer pada tabung spin column. Selanjutnya, sampel didiamkan selama lima menit dan disentrifugasi dengan kecepatan 13000 rpm selama satu menit. Sebanyak 50 µl Elution Buffer ditambahkan kembali dan didiamkan selama lima menit, kemudian disentrifugasi. Calamus Gambar 4. Bagian Calamus pada Bulu Aves Sumber : Dokumentasi Pribadi Uji Kualitas DNA. Kualitas DNA hasil ekstraksi diukur kemurnian dan konsentrasinya menggunakan spektrofotometer. Selain itu, secara kualitatif kualitas DNA dapat dilihat dengan elektroforesis menggunakan agarose gel 1,5%. Polymerase Chain Reaction (PCR) Sampel DNA hasil ekstraksi diambil sebanyak 0,1 - 2 µl ditambah dengan premix dengan volume 23 µl. Premix dibuat dengan campuran 0,3 µl primer; 0,2 µl dNTPs; 1 µl MgCl2; 2,5 µl 10 x buffer; 0,1 µl enzim Taq polymerase; dan 18,9 µ l destilation water. Campuran sampel DNA dan premix tersebut diinkubasi menggunakan mesin PCR thermocycler. Proses amplifikasi diawali tahap denaturasi pada suhu 94 oC selama lima menit. Tahap kedua terdiri dari 30 siklus, masingmasing siklus terdiri dari proses denaturasi pada suhu 94 oC selama 30 detik, annealing primer pada suhu 60 oC selama 45 detik dan ekstensi DNA pada suhu 72 16 o C selama satu menit. Tahapan terakhir adalah pemanjangan primer pada suhu 72 oC selama sepuluh menit. Hasil amplifikasi DNA tersebut divisualisasi dengan elektroforesis. Elektroforesis DNA hasil amplifikasi dielelektroforesis menggunakan agarose gel dengan konsentrasi 1,5%. Sebanyak 0,45 g serbuk agarose ditambahkan dengan 30 ml 0,5 x TBE. Campuran tersebut dipanaskan hingga mendidih dan ditambahkan dengan 2,5 µl EtBr, kemudian dicetak pada cetakan hingga mengeras. Masing-masing sampel DNA hasil PCR sebanyak 5 µl ditambahkan dengan 1 µl loading dye dan dimasukkan ke dalam sumur-sumur di dalam gel, kemudian di-running pada larutan 0,5 x TBE dengan voltase 100 volt selama kurang lebih 30 - 45 menit. Pita-pita DNA akan tampak dengan bantuan sinar ultra violet pada UV Transilluminator. Rancangan dan Analisa Data Genotyping Jenis kelamin pada Aves ditentukan dengan jumlah pita hasil elektroforesis. Pita tunggal menunjukkan jenis kelamin jantan, dan pita ganda menujukkan jenis kelamin betina (Cerit dan Avanus, 2007). 17 HASIL DAN PEMBAHASAN Ekstraksi dan Purifikasi DNA Total DNA total yang diperoleh dalam penelitian bersumber dari darah dan bulu. Ekstraksi DNA yang bersumber dari darah dilakukan dengan metode phenolchloroform, sedangkan ekstraksi DNA dari bulu dilakukan menggunakan kit extraction. Kualitas DNA yang dihasilkan dari dua sumber tersebut diukur secara kualitatif dan kuantitatif. Pengukuran kualitas DNA secara kuantitatif dilakukan menggunakan spektrofotometer, sedangkan pengukuran kualitas DNA secara kualitatif dilakukan dengan menggunakan agarose gel electrophoresis dengan konsentrasi 1,5%. Kualitas DNA bersumber dari darah yang diukur menggunakan spektrofotometer ditunjukkan pada Tabel 3. Tabel 3. Hasil Pengukuran Kualitas DNA yang Bersumber dari Darah No. Sampel Kemurnian Konsentrasi (µg/ml) 1. Ayam Kampung (a) 1,546 1670 2. Ayam Kampung (b) 1,438 230 3. Ayam Kampung (c) 0,996 5640 4. Ayam Kampung (d) 1,741 1010 5. Puyuh (a) 1,417 340 6. Puyuh (b) 1,417 170 7. Puyuh (c) 1,391 320 8. Puyuh (d) 1,100 110 9. Itik (a) 1,100 110 10. Itik (b) 1,200 60 11. Itik (c) 1,433 2020 12. Itik (d) 1,611 580 13. Merpati (a) 1,571 110 14. Merpati (b) 1,667 100 15. Merpati (c) 1,429 100 16. Merpati (d) 1,500 150 Rataan 1,410 795 Kemurnian DNA yang bersumber dari darah tergolong rendah, karena molekul DNA dikatakan murni menurut Marerro et al. (2009) apabila kemurniannya lebih dari 1,8. Hal ini disebabkan adanya pengotor DNA yang berupa protein darah. Seperti yang dijelaskan oleh Tataurov et al. (2008), bahwa sampel asam nukleat dapat terkontaminasi dengan molekul lain seperti protein, senyawa organik dan lainlain. Rodwell (1983) mendefinisikan protein darah sebagai salah satu bentuk makromolekul disamping asam nukleat dan polisakarida, biokatalisator, hormon reseptor, dan tempat penyimpanan informasi genetik. Darah adalah jaringan yang beredar dalam sistem pembuluh darah yang tertutup. Darah terdiri dari unsur-unsur sel darah (merah dan putih) dan trombosit yang terdapat dalam medium cair yang disebut plasma, campuran yang sangat kompleks tidak hanya terdiri dari protein sederhana tetapi juga protein campuran seperti glikoprotein dan berbagai jenis lipoprotein. Adanya protein ini menyebabkan kemurnian DNA pada darah tergolong rendah. Sedangkan kualitas DNA bersumber dari bulu yang diukur menggunakan spektrofotometer ditunjukkan pada Tabel 4. Tabel 4. Hasil Pengukuran Kualitas DNA yang Bersumber dari Bulu No. Sampel Kemurnian Konsentrasi (µg/ml) 1. Beo nias 1,429 200 2. Kakatua maluku (a) 1,273 280 3. Kakatua maluku (b) 1,643 230 4. Kakatua-kecil Jambulkuning (a) 1,250 200 5. Kakatua-kecil Jambulkuning (b) 1,400 210 Rataan 1,399 224 Hal yang menyebabkan rendahnya kemurnian DNA yang bersumber pada bulu adalah adanya keratin pada bulu. Bulu burung merupakan suatu modifikasi dari jaringan kulit yang menanduk. Pough et al. (2005) menjelaskan bahwa lebih dari 90% bagian bulu adalah beta keratin, 1% lipid, 8% air, dan sisanya protein dan pigmen, seperti melanin. Keratin pada bulu dapat menjadi pengotor DNA maupun penghambat (inhibitor) pada saat proses PCR (Schill, 2007). Adanya faktor penghambat menyebabkan ekstraksi DNA dari bulu sulit dilakukan dengan metode 19 phenol-chloroform, sehingga ekstraksi dilakukan dengan menggunakan kit. Schill (2007) menjelaskan bahwa ekstraksi DNA dengan menggunakan kit umumnya menghasilkan DNA dengan kualitas yang lebih baik. Pengukuran jumlah DNA dengan spektrofotometer didasarkan pada prinsip iradiasi sinar ultraviolet yang diserap oleh nukleotida dan protein dalam larutan. Analisis asam nukleat umumnya dilakukan untuk penentuan konsentrasi rata-rata dan kemurnian DNA yang terdapat dalam sampel. Jumlah dan kemurnian tertentu diperlukan untuk kinerja optimal sampel DNA yang digunakan. Asam nukleat menyerap sinar ultraviolet dengan pola tertentu. Sampel ditembus sinar ultraviolet dan fotodetektor cahaya pada 260 nm, semakin besar cahaya yang diserap sampel, maka semakin tinggi konsentrasi asam nukleat dalam sampel (Sambrook dan Russel, 2001). Spektrofotometer dapat digunakan untuk penentuan tingkat kemurnian DNA yang berkorelasi dengan kualitas DNA yaitu dengan melihat rasio absorbansi pada panjang gelombang 260 dan 280 nm (A260/280). Rasio absorbansi pada 260 nm dan 280 nm umumnya digunakan untuk menilai kontaminasi DNA oleh protein karena protein menyerap cahaya pada panjang gelombang 280 nm (Tataurov et al., 2008). Jumlah atau kuantitas DNA yang diukur menggunakan spektrofotometer menunjukkan jumlah DNA yang bersumber dari darah lebih tinggi daripada DNA yang bersumber dari bulu. Darah mengandung lebih banyak sel berinti daripada bulu. Bagian bulu yang digunakan untuk ekstraksi adalah bagian calamus. Sel berinti dari bulu diperoleh dari sel epitel dan darah yang menempel pada calamus. Calamus merupakan bagian bulu yang tertanam pada kulit (Pough et al., 2005). Selain menggunakan spektrofotometer, kualitas DNA ditentukan oleh intensitas cahaya pita DNA yang muncul pada agarose gel (Gambar 5). Pita DNA dari darah lebih terang daripada DNA dari bulu. Hal ini menunjukkan konsentrasi DNA yang berasal dari darah lebih tinggi daripada DNA yang berasal dari bulu. Konsentrasi DNA yang digunakan dalam penelitian ini yaitu 50 μg/ml, adapun untuk sampel yang memiliki konsentrasi DNA di atas 50 μg/ml dilakukan pengenceran dengan menambahkan air destilata. Penggunaan sampel dengan konsentrasi DNA yang sama dilakukan agar keberhasilan amplifikasi seragam. 20 (-) (+) Gambar 5. Elektroforesis DNA Hasil Ekstraksi dengan Agarose Gel 1,5% Amplifikasi dan Visualisasi Gen CHD DNA hasil ekstraksi kemudian diamplifikasi menggunakan proses Polymerase Chain Reaction (PCR). Sebanyak 21 sampel DNA Aves berhasil diamplifikasi dengan suhu annealing 60 oC untuk sampel DNA ayam dan puyuh, dan suhu annealing 55 oC untuk sampel DNA itik, merpati, beo nias, kakatua maluku, dan kakatua-kecil Jambul-kuning. Sambrook et al. (1989) menjelaskan bahwa setiap 1% ketidakcocokan dari basa dalam DNA untai ganda (double-stranded DNA) mengurangi melting temperature (Tm) 1-1,5 oC. Sebanyak 21 sampel DNA hasil PCR dielektroforesis menggunakan agarose gel dengan konsentrasi 1,5%, dan berhasil diidentifikasi jenis kelaminnya (Gambar 6). Secara fisik, agarose tampak seperti bubuk putih yang sangat halus. Agarose yang dijual secara komersial terkontaminasi dengan polysacarida, garam dan protein. Banyak sedikitnya kontaminasi di dalam gel dapat mempengaruhi migrasi DNA di dalam gel dan kemampuan mengambil DNA dari dalam gel untuk digunakan sebagai substrat dalam reaksi enzimatis (Muladno, 2002). 21 (-) 600 bp 400 bp (+) Gambar 6. Hasil PCR Gen CHD-Z dan CHD-W pada Tujuh Spesies Aves: (a) Ayam Kampung, (b) Puyuh, (c) Itik, (d) Merpati, (e) Beo Nias, (f) Kakatua Maluku, dan (g) Kakatua-kecil Jambul-kuning dengan Agarose Gel Electrophoresis 1,5% (-) 600 bp 400 bp (+) Gambar 7. Rekonstruksi Hasil PCR Gen CHD-Z dan CHD-W pada Tujuh Spesies Aves: (a) Ayam Kampung, (b) Puyuh, (c) Itik, (d) Merpati, (e) Beo Nias, (f) Kakatua Maluku, dan (g) Kakatua-kecil Jambul-kuning dengan Agarose Gel Electrophoresis 1,5% Seluruh sampel dari Aves jantan menunjukkan pita tunggal, sedangkan pada betina menunjukkan pita ganda, kecuali pada itik dan merpati (Gambar 6 dan Gambar 7). Pita tunggal pada Aves jantan dikarenakan gen CDH yang teridentifikasi adalah gen CHD-Z, yaitu gen CHD yang berada pada kromosom Z. Sedangkan pada betina, gen CHD berada pada kromosom Z (CHD-Z) dan juga W (CHD-W), sehingga muncul dua buah pita DNA (Cerit dan Avanus, 2007; Dubiec dan ZagalskaNeubauer, 2006). Dubiec dan Zagalska-Neubauer (2006) menjelaskan bahwa primer 22 2550F/2718R menghasilkan satu pita pada beberapa spesies Aves betina. Namun, betina dan jantan pada itik dan merpati dapat dibedakan secara mudah karena keduanya memiliki panjang fragmen yang berbeda. Situs penempelan primer forward dan reverse pada merpati dan ayam Hutan tersebut dapat dilihat pada Gambar 8. Sedangkan untuk jenis Aves lainnya yang diteliti belum ada sekuen gen CHD-Z maupun CHD-W, sehingga tidak diketahui letak situs penempelan primer dan panjang sekuen gen CHD-Z dan CHD-W. CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 1 ATTGAAATGATCCAGTGCTTGTTTCCTTAGTTCCCCTTTTATTG GTTACTGATTCGTCTACGAGAACGTGGCAACAGAGTACTGATTT GCTACTGATTCGTCTGCGAGAACGTGGCAACAGAGTTCTGATTT GTTACTGATTCGTCTACGAGAACGTGGCAACAGAGTACTGATTT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 45 ATCCATCAAGTCTCTAAAGAGATTGAATACTATAGTTAAAAAGC TCTCTCAGATGGTTAGGATGCTAGACATATTAGCAGAGTATTTG TCTCTCAGATGGTGAGGATGCTGGACATCCTAGCAGAATATCTG TCTCTCAGATGGTGAGGATGCTAGACATCCTAGCAGAATACTTG CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 89 AATTTTATATTCAAAATATTCTAATATTCTCTATACAAAATCTC AAGTATCGTCAATTTCCCTTTCAGGTGAGAATTTTTCTGGTAGT AAGTATCGCCAGTTTCCCTTCCAGGTAACAATCTCGAGTAACCA AAGTATCGTCAGTTTCCTTTTCAGGTAAGAATTTTGATGGTAGT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 133 AGAGCACCTTGAATTCTCAACTGCTAAAACTGTTATGTGAAGGT AGCCAAGAAGCCTTGATCTTTACCACTTTATCCTTTTTGTAGAT AGAGGTCTTGATCCTGAACTTAAGAAAAATCATGTTTATATTCT AGCCAAGAAGCCTTGATCTTTGCCACTTTATCTTAAGTAAAAGT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 177 GAAAAAAGTAACGCAACACTGCACATAATTTTTAAATTAATCTA TTATGAAAGTTTAATTTTACATACAGGAAAAGACTGGCAATTAA GAGGGTGACATGGTGGAGTGAGCTGTACAGATGTCGTGAAATCT GTCCTTTCTGTAGAAAAGACTTCTAAAAGTTTAATTTTATGTAT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 221 TTTCCTTTCAAAATACTACTTAGTACAAAACCACATTTTCTTTT TGCATGCTAAATAGTATTTTGAAGTTAAACTGATGAATTAGAAA CCATTCTCTGTGATACATAAAAGTCAACTGGGCACTGTCCTGGT AGAAAAAGACTGGCAATTACTATGGTGTGAGGTGTTGCATTATT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 265 ATCTTTTCTTAAGCAAAGTGGTAAAGATCATATAATTGCAAAAC GATGAAGTGTTTACATTACTTTTATTCCACCCCACCCCCTCAGT TAGCCTGCTGTAGCAGACCTTGCTTGGAAACAGGACAAGATGAC CTCCTCCTCCTCCTTCCCCCCCATTCCTCCCCTTGCCCTCAGTT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 309 AGTCGAATTTGGAAAGGACTGCTGGAGGTCATCTTGTCTAAGTC TGTTTTGGCAATTGAGAATTAAAGTTGCTCTGATTAGAATATAG CTCTAGAGGTCGTTGCCAGTATTTCAACCATCTGTGATTATTTG GTTTTGGCAATTGAGTATTCAGGTTGCTCTGATTAGAATATAGT CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 353 CCCTACTCAGGTGGGGACAGTTAAAGCAGGTTTCACACGGTTAT AAGGAATTCCTTTTTAACTGTATTATTCAATCTCTTTAGAGACT ATCTTCACCATTTTGCTTAAGAAAAGAAAGCAACTTTCAGTTAA ATGAGTTCCTTTTTAACTGTAATATTTGATCTCTTTAGAGACTT dilanjutkan... 23 lanjutan... CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 397 GTCCAGGTGGCTTTTGAATGTCAAAGAGGATGGAGATTCCATGA TGATGGATCAATAAAAGGGGAATTGAGGAAACAAGCACTGGATC AAAGATTATGTGAACAAATATGTTAACATTCCTTCTTTTTGTTC GATGGATCAATAAAAGGAGAACTGAGGAAACAAGCACTGGATCA CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 441 CCTCTGGGCAACTTGTTCAGTGCTCCGTCAGCCTCAGAGTAAAG ATTTCAAT-----------------------------------CTTCACATTGCTGTTTTATCAGTTAAAAAGTCAAGTTACTGTGA TTTCAAT------------------------------------- CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 485 AAAAGATTTTTCTTATATTCAAGGTCAAAGCTTCTTGGCTACTA -------------------------------------------TGGGAATATAGCTAAAGAATTACTTTTAGACTGTAGTTTTCAAT -------------------------------------------- CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 529 CCACCACAACTCTTACCTGAAAAGGAAACTGACGATACTTCAGA -------------------------------------------CTCTTTAGAGACTTGATGGATCAATAAAAGGGGAATTGAGGAAG -------------------------------------------- CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 573 TATTCTGCTAAGATGTCCAGCATCCTCACCATCTGTGAGAAAAT -------------------------------------------CAAGCACTGGATCATTTCAAT------------------------------------------------------------------ CHDZ CHDW CHDZ CHDW C. C. G. G. livia livia gallus gallus 617 GAGTACTCTGTTGCCACGTTCTCGTAGACGAATCAGTAAC------------------------------------------------------------------------------------------------------------------------------------- Gambar 8. Situs Penempelan Primer pada Sekuen Gen CHD-Z dan CHD-W pada Columba livia dan Gallus gallus. Situs Penempelan Primer Forward (Warna Kuning), Situs Penempelan Primer Reverse (Warna Hijau) Sekuen target gen CHD-Z yang dibatasi oleh primer 2550F/2718R pada merpati berukuran lebih panjang daripada gen CHD-W. Panjang sekuen gen CHD-Z pada merpati adalah 656 bp, dan panjang CHD-W 448 bp. Sekuen target gen CHD-Z dan CHD-W tidak ditemukan pada ayam Kampung, tetapi ditemukan pada ayam Hutan. Sekuen gen CHD-Z pada ayam Hutan (593 bp) juga berukuran lebih panjang daripada sekuen gen CHD-W (447 bp) seperti yang ditunjukkan pada Gambar 8. Panjang pita CHD-Z yang lebih panjang daripada CHD-W menyebabkan pita CHDZ berada di atas pita CHD-W. Muladno (2002) menjelaskan bahwa migrasi molekul DNA berukuran besar lebih lambat daripada migrasi molekul berukuran kecil. Perbedaan panjang antara sekuen gen CHD-Z dan CHD-W berjarak 146 bp pada ayam Hutan dan 208 bp pada merpati. Dubiec dan Zagalska-Neubauer (2006) menyatakan bahwa primer 2550F/2718R dapat mengamplifikasi gen CHD-Z dan CHD-W dengan perbedaan sekitar 150-250 bp. 24 Implementasi Penentuan Jenis Kelamin Aves di Indonesia Metode ini akan berguna untuk studi, program pemuliaan dan program konservasi burung-burung langka seperti kakatua dan beo. Pengembangan keilmuan dapat dilakukan seperti untuk mengobservasi gen-gen lain yang berada di kromosom jenis kelamin untuk keperluan penentuan jenis kelamin. Hasil penelitian juga dapat dijadikan acuan untuk menentukan jenis kelamin bangsa-bangsa lain dalam species yang sama. Misalnya, dengan diketahuinya pola pita CHD-Z dan CHD-W pada Gallus gallus maka dapat dijadikan acuan untuk bangsa-bangsa ayam lain, seperti ayam pelung, ayam cemani, ayam arab, dsb. Penentuan jenis kelamin juga penting untuk kepentingan pemulian ternak, salah satunya untuk seleksi pejantan dan indukan, sehingga dapat mengembangkan ternak sesuai dengan tujuan. Beo nias, kakatua maluku dan kakatua-kecil Jambul-kuning termasuk dalam daftar Appendix CITES. CITES merupakan peraturan yang mengatur perdagangan internasional flora dan fauna yang dilindungi. Beo nias dan kakatua-kecil Jambulkuning terdaftar dalam Appendix II, sedangkan kakatua maluku tercatat dalam kategori Appendix I. Kedua kategori ini dilarang diperdagangkan kecuali dalam kondisi tertentu, misalnya keturunannya (Soehartono dan Mardiastuti, 2002). Ketiga jenis burung endemik Indonesia ini sangat diminati di pasar internasional. Pasar terbesar untuk kakatua maluku dan kakatua-kecil Jambul-kuning diantaranya Amerika Serikat dan Eropa, sedangkan pasar beo nias adalah negaranegara Asia (Soehartono dan Mardiastuti, 2002). Tingginya permintaan burungburung tersebut menyebabkan populasinya menurun drastis di alam, sehingga dibuatlah peraturan perdagangan seperti yang tertera dalam CITES. Namun, hingga kini permintaan ketiga jenis burung tersebut masih tinggi. Penangkaran atau captive breeding merupakan solusi dari tingginya permintaan pasar ketiga jenis burung tersebut. Penangkaran diartikan sebagai suatu kegiatan untuk mengembangbiakan jenis-jenis satwa liar dan tumbuhan alam, bertujuan untuk memperbanyak populasinya dengan mempertahankan kemurnian jenisnya, sehingga kelestarian dan keberadaannya di alam dapat dipertahankan yang meliputi pula kegiatan mengumpulkan bibit atau induk, pembiakan atau perkawinan atau penetasan telur, pembesaran anak, serta restocking atau pemulihan populasinya di alam (Thohari, 1987). 25 Penangkaran beo nias, kakatua maluku maupun kakatua-kecil Jambul-kuning belum banyak berkembang di Indonesia. Hal ini disebabkan karena para penangkar kesulitan untuk mengawinkan burung akibat sulitnya menentukan burung jantan dan betina. Dengan penentuan jenis kelamin yang akurat seperti dengan menggunakan pendekatan molekuler, diharapkan dapat memperbaiki manajemen perkawinan dan meningkatkan populasi jenis-jenis endemik Indonesia. 26 KESIMPULAN DAN SARAN Kesimpulan Sebanyak 21 sampel Aves dapat ditentukan jenis kelaminnya berdasarkan gen CHD menggunakan primer 2550F san 2718R. Jenis-jenis Aves tersebut adalah ayam Kampung, puyuh jepang, itik, merpati, beo nias, kakatua maluku, dan kakatua-kecil Jambul-kuning. Saran Perlu dilakukan penelitian lebih lanjut untuk mengetahui sekuen lengkap gen CHD-Z dan CHD-W pada puyuh jepang, itik, beo nias, kakatua maluku, dan kakatua-kecil Jambul-kuning, yaitu dengan menggunakan metode sequencing. Selain itu, perlu dilakukan penelitian untuk mengisolasi DNA secara non-invasif, seperti dengan menggunakan feses atau bulu yang rontok. 27 PENENTUAN JENIS KELAMIN PADA KELAS AVES MENGGUNAKAN METODE POLYMERASE CHAIN REACTION (PCR) SKRIPSI ISYANA KHAERUNNISA DEPARTEMEN ILMU PRODUKSI DAN TEKNOLOGI PETERNAKAN FAKULTAS PETERNAKAN INSTITUT PERTANIAN BOGOR 2012 1 PENENTUAN JENIS KELAMIN PADA KELAS AVES MENGGUNAKAN METODE POLYMERASE CHAIN REACTION (PCR) SKRIPSI ISYANA KHAERUNNISA DEPARTEMEN ILMU PRODUKSI DAN TEKNOLOGI PETERNAKAN FAKULTAS PETERNAKAN INSTITUT PERTANIAN BOGOR 2012 1 RINGKASAN ISYANA KHAERUNNISA. D14080155. 2012. Penentuan Jenis Kelamin pada Kelas Aves Menggunakan Metode Polymerase Chain Reaction (PCR). Skripsi. Departemen Ilmu Produksi dan Teknologi Peternakan, Fakultas Peternakan, Institut Pertanian Bogor. Pembimbing Utama : Dr. Jakaria, S.Pt., M.Si. Pembimbing Anggota : Maria Ulfah, S.Pt., M.Sc.Agr. Jenis kelamin pada Aves penting diketahui untuk berbagai tujuan terutama dalam bidang pemuliaan, konservasi dan pengembangan keilmuan. Penentuan jenis kelamin sulit dilakukan pada beberapa jenis Aves, terutama pada jenis-jenis burung monomorfik seperti kakatua (Psittacidae) dan beo (Sturnidae). Hal ini menyebabkan hampir semua

Dokumen baru

Tags

Dokumen yang terkait

Analisa Aspergillus fumigatus dengan Menggunakan Polymerase Chain Reaction (PCR) dan Kultur Pada Sputum Penderita Batuk Kronis
2
78
88
Uji Diagnostik Polymerase Chain Reaction –Restriction Fragment Length Polymorphism Dalam Menegakkan Diagnosis Onikomikosis.
1
94
82
Deteksi Dan Penentuan Virus Dengue Serotipe 3 Dari Serum Penderita Demam Dengue/Demam Berdarah Dengue Di Rumah Sakit Kota Medan Menggunakan Reverse Transcriptase Polymerase Chain Reaction
1
38
65
Deteksi Dan Penentuan Serotipe Virus Dengue Tipe 1 Dari Nyamuk Aedes Aegypti Dengan Menggunakan Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Di Kota Medan
1
38
80
Perbandingan antara Metode SYBR Green dan Metode Hydrolysis Probe dalam Analisis DNA Gelatin Sapi dan DNA Gelatin Babi dengan Menggunakan Real Time Polymerase Chain Reaction (PCR)
1
62
90
Analisis Cemaran Daging Babi Pada Kornet Sapi di Wilayah Ciputat dengan Menggunakan Metode Polymerase Chain Reaction (PCR)
2
12
72
Deteksi DNA Babi dan DNA Sapi dengan Menggunakan Metode Insulated Isothermal Polymerase Chain Reaction (ii-PCR)
1
8
66
Analisis Cemaran Daging Babi pada Produk Bakso Sapi yang Beredar di Wilayah Ciputat Menggunakan Real- Time Polymerase Chain Reaction (PCR) dengan Metode Hydrolysis Probe.
1
47
86
Amplifikasi DNA Leptospira dengan menggunakan metode Insulated Isothermal Polymerase Chain Reaction (ii-PCR)
2
22
64
Analisis Kandungan Gelatin Babi dan Gelatin Sapi pada Cangkang Kapsul Keras yang Mengandung Vitamin A Menggunakan Real-Time Polymerase Chain Reaction
0
12
80
Akurasi Polymerase Chain Reaction (PCR) Dibandingkan dengan Uji Tuberkulin untuk Diagnosis Tuberkulosis pada Anak
0
0
5
Chain Reaction (PCR) pada Sampel Sumber Air Minum
0
0
8
BAB II TINJAUAN PUSTAKA 2.1 Mikosis Paru - Analisa Aspergillus fumigatus dengan Menggunakan Polymerase Chain Reaction (PCR) dan Kultur Pada Sputum Penderita Batuk Kronis
0
1
26
BAB I PENDAHULUAN 1.1 Latar Belakang - Analisa Aspergillus fumigatus dengan Menggunakan Polymerase Chain Reaction (PCR) dan Kultur Pada Sputum Penderita Batuk Kronis
0
0
8
Analisa Aspergillus fumigatus dengan Menggunakan Polymerase Chain Reaction (PCR) dan Kultur Pada Sputum Penderita Batuk Kronis
0
0
15
Show more